ID: 1157326092

View in Genome Browser
Species Human (GRCh38)
Location 18:46669668-46669690
Sequence CTTGGAGATGGGAAGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1058
Summary {0: 1, 1: 1, 2: 5, 3: 96, 4: 955}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157326085_1157326092 -7 Left 1157326085 18:46669652-46669674 CCACACTGCAAAGTCCCTTGGAG 0: 1
1: 0
2: 2
3: 28
4: 163
Right 1157326092 18:46669668-46669690 CTTGGAGATGGGAAGGTGGAAGG 0: 1
1: 1
2: 5
3: 96
4: 955
1157326084_1157326092 -6 Left 1157326084 18:46669651-46669673 CCCACACTGCAAAGTCCCTTGGA 0: 1
1: 0
2: 0
3: 13
4: 137
Right 1157326092 18:46669668-46669690 CTTGGAGATGGGAAGGTGGAAGG 0: 1
1: 1
2: 5
3: 96
4: 955
1157326081_1157326092 5 Left 1157326081 18:46669640-46669662 CCACACCATCACCCACACTGCAA 0: 1
1: 1
2: 0
3: 49
4: 450
Right 1157326092 18:46669668-46669690 CTTGGAGATGGGAAGGTGGAAGG 0: 1
1: 1
2: 5
3: 96
4: 955
1157326082_1157326092 0 Left 1157326082 18:46669645-46669667 CCATCACCCACACTGCAAAGTCC 0: 1
1: 0
2: 1
3: 15
4: 249
Right 1157326092 18:46669668-46669690 CTTGGAGATGGGAAGGTGGAAGG 0: 1
1: 1
2: 5
3: 96
4: 955

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157326092 Original CRISPR CTTGGAGATGGGAAGGTGGA AGG Intronic
900114235 1:1021643-1021665 CCAGGAGCTGAGAAGGTGGAGGG + Intronic
900422808 1:2562926-2562948 AGGGGAGGTGGGAAGGTGGAGGG - Intronic
900544191 1:3219456-3219478 CTTGGAGCTGGGGCGGGGGAAGG + Intronic
900626665 1:3611618-3611640 GTAGGAGATGGGGAGGGGGAAGG - Intergenic
900742873 1:4341359-4341381 ACTGAAGATGGAAAGGTGGAAGG + Intergenic
900828871 1:4949639-4949661 CATGGAAATGGGAAGCTGGAAGG - Intergenic
900838867 1:5031055-5031077 CTGGGAGAAGGCAAGGGGGAGGG - Intergenic
900947055 1:5836997-5837019 CCTGGAGCTGGGAAGGTGTGGGG - Intergenic
901508277 1:9700439-9700461 CCAGGAGGTGGGAAGGTGAAAGG + Intronic
901668808 1:10842107-10842129 CTTGGTGATGAGCAGGTGTAGGG - Intergenic
901711076 1:11115588-11115610 CTTGCAGAAGTGGAGGTGGAGGG - Intronic
901732524 1:11290512-11290534 CTTTGAGTAGGGGAGGTGGATGG - Intronic
902332380 1:15736889-15736911 CTGGGTCATGGGATGGTGGAGGG - Intronic
902567408 1:17321246-17321268 CCGGGAGATGGGAAAGTGGGGGG + Intronic
902711307 1:18241869-18241891 CTTGCATATGGTAAGGCGGAAGG + Intronic
902797499 1:18808927-18808949 CATGGAGATGGGCCGGTGGCAGG - Intergenic
902884401 1:19394227-19394249 CTTTGAGAGGGCAAGGAGGACGG - Intronic
903004080 1:20286953-20286975 GTTGGAGAATGCAAGGTGGATGG - Intergenic
903083702 1:20835694-20835716 CTTTGAGAGGCCAAGGTGGAAGG + Intronic
903099494 1:21016440-21016462 CTTTGAGAGGTGGAGGTGGAAGG + Intronic
903114908 1:21170743-21170765 CTTGGGGAGGTCAAGGTGGATGG + Intronic
903204865 1:21773892-21773914 CTTTGGGAGGGCAAGGTGGAAGG + Intronic
903463380 1:23534840-23534862 CTGGGAGATGGGAAAGTGTAGGG - Intergenic
903470601 1:23584662-23584684 CTTTGAGAGGCCAAGGTGGATGG - Intronic
904129248 1:28263385-28263407 CTTGGAGTGGGCAGGGTGGAGGG - Intronic
904509823 1:30995123-30995145 CTAGGAGATTTGAAGGAGGAGGG - Exonic
904616946 1:31755110-31755132 CATGGGGATGGGAAGGAGGCAGG - Intronic
905025127 1:34844582-34844604 CTTGGACAGTGGAGGGTGGAGGG - Intronic
905121720 1:35687606-35687628 CTTTGAGAGGCCAAGGTGGAAGG + Intergenic
905175292 1:36131389-36131411 CTTTGGGAAGGGAAGGTAGAAGG + Intergenic
905432631 1:37935603-37935625 CCTGGTGATGGGAATGGGGAAGG - Intronic
905546931 1:38807532-38807554 GCTGGAGATGGGAGGTTGGAGGG - Intergenic
906527072 1:46500163-46500185 CTTGGTGCTGGGGAGGGGGAGGG + Intergenic
906564528 1:46789295-46789317 CTTGGAGAGGGGGATGTGGCAGG - Intronic
906662174 1:47590719-47590741 CTGGTACATGGGAAGGTGGGAGG + Intergenic
906720084 1:47997734-47997756 CCTGGCGAAGGGAAGGAGGAGGG - Intergenic
907248053 1:53120567-53120589 GTTGGGGAAGGGATGGTGGATGG - Intronic
907388349 1:54140111-54140133 ATGGGGGATGGGGAGGTGGAAGG + Intronic
907393054 1:54171187-54171209 GTGGGAGATCGGAAGGTGGGAGG + Intronic
907412849 1:54294693-54294715 CTTGGAGATGGAAGGGAGGCTGG - Intronic
907425080 1:54374441-54374463 CTTTTAGATGGGAAGGAGCAGGG - Intronic
907673666 1:56499079-56499101 CTTGAAGGGGGGAAGGTGGGGGG - Intronic
907718479 1:56950044-56950066 CATGGAGGTGGGAAAGGGGAGGG + Intronic
908326199 1:63026210-63026232 CTTTGAGAGGCCAAGGTGGAAGG + Intergenic
908553847 1:65237275-65237297 CTTTGAGATGTCAAGGTGGAAGG - Intergenic
908734652 1:67263327-67263349 CTTTGAGAGGCCAAGGTGGAAGG - Intergenic
908818083 1:68054300-68054322 CTTGGAGAGGCCAAGGTGGGAGG + Intergenic
909831472 1:80196680-80196702 GTGGGAAAAGGGAAGGTGGATGG + Intergenic
910067789 1:83174350-83174372 CCTTCAGTTGGGAAGGTGGAGGG + Intergenic
910442590 1:87267801-87267823 GTTGGGGAGGGGAAGGTGAATGG - Intergenic
910457695 1:87414940-87414962 CTTTGAGAGGCGAAGGTGGATGG + Intergenic
911048732 1:93651369-93651391 CTGGCAGATGGGAAGCTGGATGG + Intronic
911105937 1:94131577-94131599 GTTGGAGCTGGGAAGGAGAACGG + Intergenic
911730962 1:101291952-101291974 CATGGAGATGTGAAAGTGCAGGG - Intergenic
913600674 1:120418789-120418811 CTTTGAGATGCCAAGGTGGGAGG - Intergenic
914086384 1:144457844-144457866 CTTTGAGATGCCAAGGTGGGAGG + Intronic
914192278 1:145421795-145421817 CTTTGAGATGCCAAGGTGGGAGG + Intergenic
914590184 1:149099739-149099761 CTTTGAGATGCCAAGGTGGGAGG + Intronic
914916002 1:151819626-151819648 CTTGGAGAAGGGAAGAGGCAGGG - Intronic
915094188 1:153447829-153447851 CTTTGGGATGCCAAGGTGGAAGG - Intergenic
915213024 1:154324220-154324242 CTTGGAGAGGGGAAGGCTAAGGG + Intronic
915244344 1:154545681-154545703 CTTTGAGAGGCCAAGGTGGAAGG - Intronic
915297179 1:154929639-154929661 TTTGGGGATGGGAAGGGGTAAGG - Intronic
915992817 1:160533249-160533271 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
916094409 1:161336213-161336235 CTTTGAGATGCCAAGGTGGGTGG + Intronic
916759741 1:167805687-167805709 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
917334874 1:173916539-173916561 AGTGGAGATGGGAAGATGAATGG - Intronic
917516212 1:175710664-175710686 CTTGGAGAGTGGAAGTGGGAAGG - Intronic
917536293 1:175876975-175876997 CCTGAAGATGGGGAGGTGGCAGG - Intergenic
917571616 1:176271728-176271750 GTTGGAGATGAGAAGGAGGGAGG - Intergenic
917754798 1:178088418-178088440 ATTGGAGGTGGAAAGGTGGCAGG + Intergenic
917832318 1:178905209-178905231 CTTTGATATGGGAAGGAGGCTGG - Intronic
918327942 1:183427932-183427954 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
918702078 1:187617674-187617696 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
919520876 1:198584844-198584866 GGTGGAGAATGGAAGGTGGAAGG - Intergenic
919540868 1:198843588-198843610 CTTTGAGATGCCAAGGTGGGTGG + Intergenic
919737510 1:200962267-200962289 CTTGGAGAGGCCAAGGTGGCTGG + Intergenic
919794942 1:201316021-201316043 CTTGGGGATGGATAGATGGATGG + Intronic
920005226 1:202828409-202828431 CTTTGGGATGCCAAGGTGGAAGG + Intergenic
920005510 1:202830627-202830649 CTTTGGGATGCCAAGGTGGAAGG - Intergenic
920099448 1:203507797-203507819 CGTGGAGAAGGGAGGGTGGGAGG + Intronic
920519464 1:206612593-206612615 CGAGGGGATGGGAAGGTGGGGGG - Intergenic
920674808 1:208031501-208031523 CCAGGAGATGGGAGGGTGGGAGG - Intronic
921900723 1:220447770-220447792 GTTGGAGATGAGAAGGGTGAGGG + Intergenic
922303639 1:224325326-224325348 CTTAGGGAGGCGAAGGTGGAAGG + Intronic
922322497 1:224500944-224500966 CATGGAGATGTGATGGTGCAGGG - Intronic
922502689 1:226109028-226109050 CTTTGAGAGGCCAAGGTGGAAGG - Intergenic
922843748 1:228666201-228666223 CTTGGAAAGGCTAAGGTGGATGG - Intergenic
923203718 1:231738090-231738112 CTTGGAGAAGCCAAGGTGGGAGG - Intronic
923417555 1:233778342-233778364 ATTGGAGGTGGGAGGGTGGAAGG - Intergenic
923584913 1:235259939-235259961 CTTTTAGGTGGGAAGGAGGATGG - Intronic
923800904 1:237207320-237207342 CTTTGAGAGGTGGAGGTGGATGG + Intronic
924728106 1:246688698-246688720 ATTGGAGAGGCGGAGGTGGAAGG - Intergenic
1062813410 10:482037-482059 CATGGAGATGGGAATCCGGATGG + Intronic
1063060822 10:2550532-2550554 ATTGGAGAGTGCAAGGTGGAAGG + Intergenic
1063488646 10:6443175-6443197 TTTGGACATTGGAAGGTAGAGGG + Intronic
1063643184 10:7852025-7852047 CTTTGAGATGCTGAGGTGGAAGG - Intronic
1064347005 10:14541433-14541455 GGTGGAGATGGGAACGTGCACGG - Intronic
1064834429 10:19510007-19510029 CTTGGAGAGGGGGATGTGGCAGG + Intronic
1064844115 10:19632307-19632329 ACTGGAGATTGGAAGGTGGAAGG - Intronic
1065283658 10:24166004-24166026 ATTGGAGGTGGGGAGGAGGATGG - Intronic
1065956081 10:30694651-30694673 CTTGGAGTTGGGATGTTGGCTGG + Intergenic
1066118323 10:32259735-32259757 CTTTGAGAGGGCAAGGTGGGAGG - Intergenic
1066410783 10:35166896-35166918 CTTTGAGAGGCCAAGGTGGATGG + Intronic
1066479285 10:35779819-35779841 CTTTGAGATGCTGAGGTGGACGG - Intergenic
1067136308 10:43609927-43609949 CTTTGAGAGGCCAAGGTGGAAGG - Intronic
1067225366 10:44372852-44372874 CTGTGGGATGGGATGGTGGAGGG - Intronic
1067700813 10:48570649-48570671 CTTGCAGGTGGGAAGTAGGAAGG + Intronic
1067828561 10:49596980-49597002 CTTTGAGAGGGGAACCTGGACGG - Intergenic
1068520187 10:58069049-58069071 GTTGGAGATGGGAATGTGGTTGG - Intergenic
1068689943 10:59905484-59905506 CTTTGGGTTGGGAGGGTGGACGG - Intronic
1068814745 10:61296633-61296655 ATTGGAGTTGGGAAAGGGGACGG + Intergenic
1069060975 10:63894190-63894212 ATGGGAGAAGGGAAGGAGGAAGG - Intergenic
1069489239 10:68847384-68847406 TTTGGGGATTGGAAGGTAGAAGG + Intronic
1069802586 10:71091284-71091306 TTAGGAGATGTGAAGATGGAAGG + Intergenic
1069942735 10:71966080-71966102 CCAGGAGATGGGAGGGTTGATGG - Intronic
1071151614 10:82641973-82641995 CTTGGAAAGGGGGAGGTTGAGGG - Intronic
1072455911 10:95575631-95575653 CTTTGAGAGGCCAAGGTGGAAGG + Intergenic
1072742204 10:97916120-97916142 CTTGAAAATGACAAGGTGGAAGG - Intronic
1073048124 10:100651990-100652012 GTTGGAGTGGGGAAGGTGGTGGG - Intergenic
1073116640 10:101095259-101095281 CTTGGAGATGGGAGGATGGAAGG - Intronic
1073479983 10:103780283-103780305 CTTGGGGAAGGGAAGGAGAAAGG - Intronic
1073734522 10:106330558-106330580 TTTTGGGAGGGGAAGGTGGATGG + Intergenic
1073826714 10:107332222-107332244 CATGGGGAAGGGAAGGAGGAAGG - Intergenic
1073896818 10:108170775-108170797 CTTGGAGATGGAAAGGAAGTGGG - Intergenic
1074866335 10:117546282-117546304 ATGGGCGATGGGAAGGTAGAGGG + Intronic
1075265563 10:120997536-120997558 ATTGGAGGTGAGAAGGTGCAGGG - Intergenic
1075686177 10:124366868-124366890 CTGGGAGCTGGGATGGTGGTGGG - Intergenic
1076015037 10:127020987-127021009 CTTTGAGCTGGGAAGGTAGCAGG + Intronic
1076212950 10:128664949-128664971 CTGGGGGATGGGAATGGGGAAGG + Intergenic
1076336596 10:129710574-129710596 TTTGAAGAAGGGGAGGTGGATGG + Intronic
1076368903 10:129939259-129939281 CTGGGAGAGGGGAGGGTGGAGGG - Intronic
1076583329 10:131529672-131529694 CCTGGAGATGGGATGGTGTGAGG - Intergenic
1077383439 11:2258064-2258086 CAGGGAGATGGGTGGGTGGAGGG - Intergenic
1078064969 11:8072280-8072302 CTTGGAGATGCAGAGGGGGAAGG + Intronic
1078162587 11:8854630-8854652 CTTTGAGAGGGCAAGGTGGGAGG + Intronic
1078479940 11:11666925-11666947 GATGGAGATGGGAAGTTTGAGGG + Intergenic
1079122862 11:17697409-17697431 CTTGGGGATGGAAAGGGGGCTGG + Intergenic
1079524213 11:21364812-21364834 CAGGGAGATGAGAAGGTGAAGGG + Intronic
1079597111 11:22263849-22263871 ATTGGAGGTGGGAAGGTGCAGGG - Intronic
1080378971 11:31747407-31747429 TGTGGAGAGGGGAGGGTGGAGGG + Intronic
1080673742 11:34405559-34405581 TGTGGAGATGGGAGGGTGGAGGG - Intergenic
1080673772 11:34405701-34405723 TGTGGAGATGGGAGGGTGGAAGG - Intergenic
1080673819 11:34405902-34405924 TGTGGAGATGGGATGGTGGAGGG - Intergenic
1081014564 11:37859680-37859702 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
1081027744 11:38036596-38036618 ATTGAAGATGGTAATGTGGAAGG - Intergenic
1081061495 11:38483461-38483483 CTTTGAGAGGCCAAGGTGGAAGG - Intergenic
1081094498 11:38916375-38916397 CTTTGAGATGCCAAGGTGGGCGG - Intergenic
1081444930 11:43121989-43122011 TTGGGAGATGGCAAGGCGGAGGG - Intergenic
1081530200 11:43953269-43953291 CTTTGGGATGCCAAGGTGGATGG + Intergenic
1081745935 11:45472422-45472444 CTGGGAGAGGGGAAAATGGAGGG + Intergenic
1082097040 11:48139386-48139408 CCTGGGGATGAGAAGGTGGGTGG - Intronic
1082673004 11:56058401-56058423 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
1082900719 11:58248067-58248089 ATTGGAGACAGGAAGGTGGGAGG + Intergenic
1083022499 11:59521429-59521451 CTTTGAGAGGCCAAGGTGGATGG + Intergenic
1083083051 11:60113464-60113486 CTTGGAGCAGGGATGGGGGATGG + Intergenic
1083388089 11:62327344-62327366 CTTGGAGAGGGGAATGTGGCAGG - Intergenic
1084217799 11:67659930-67659952 CTTGGGGAGGCCAAGGTGGATGG + Intergenic
1084676489 11:70638393-70638415 CTTGCAGATGGGAAAGCTGAGGG + Intronic
1084785689 11:71440498-71440520 TGGGGAGATGGGCAGGTGGATGG + Intronic
1085033810 11:73288471-73288493 CTGGCAGAAGGGAACGTGGAAGG - Intronic
1085186494 11:74580185-74580207 CATGGAAATGGAGAGGTGGAAGG - Intronic
1087409717 11:97776227-97776249 CTTTGAGAGGCCAAGGTGGACGG + Intergenic
1087440828 11:98181322-98181344 CTTGGGGAGGTCAAGGTGGAAGG + Intergenic
1087476251 11:98638637-98638659 TTTGGAGATGTGTAGATGGATGG + Intergenic
1087837670 11:102891073-102891095 CTGGGAGATGGGACTGTGGCTGG - Intergenic
1088432893 11:109778050-109778072 TTTGAAGATGGGAAGCTGGTGGG - Intergenic
1088507614 11:110541769-110541791 CATGGAAATGGGAGGATGGAGGG - Intergenic
1088736858 11:112734819-112734841 CTTGGAGTGAGGAAGGTGGGTGG + Intergenic
1088801762 11:113313411-113313433 CTTGGAGATGAGAAGCAAGATGG - Intergenic
1089195726 11:116693056-116693078 CTTGGAGATGGGAGCCAGGAGGG - Intergenic
1089395270 11:118132503-118132525 ATTGCAGATGGGAAGGTAGCAGG + Intergenic
1089734471 11:120540180-120540202 CTTGGATGTGGGAAAGTGCATGG + Intronic
1090910965 11:131118934-131118956 CTTTGAGAGGGCAAGGTGGAAGG - Intergenic
1091226799 11:133962005-133962027 TTTGGAGAGGGCAAGATGGATGG - Intergenic
1091317047 11:134621844-134621866 GTTGGAGCTGGGGAGGAGGAAGG + Intergenic
1091662552 12:2395460-2395482 CTTTGAGAGGCCAAGGTGGATGG - Intronic
1091701105 12:2663571-2663593 CTCGGAGAAGGGCAGGAGGATGG + Intronic
1091725758 12:2845504-2845526 CTTGGAAAGGGGGAGGTGGAGGG + Intronic
1091786944 12:3248888-3248910 CTGGGAGCTGGGCAGGTGGTGGG - Intronic
1091841467 12:3624290-3624312 CCTGGAGAAGGGAGGGTGGAGGG - Intronic
1092064876 12:5581684-5581706 CATGGCGAGGGGAAGGAGGAGGG - Intronic
1092162798 12:6325173-6325195 CTTGGGGAGGGGGAGGGGGAGGG - Intronic
1092455141 12:8636410-8636432 CTCGGAGAGGGGAATGTGGCAGG - Intergenic
1093183258 12:15990597-15990619 TTTGGAGTTTGGAGGGTGGAAGG - Intronic
1093383149 12:18519952-18519974 CTTGGAGAGGGGGATGTGGCAGG - Intronic
1093567784 12:20628935-20628957 TTTGATGATGTGAAGGTGGATGG + Intronic
1093832790 12:23784831-23784853 CTTTGAGAGGGTAAGGTGGGAGG + Intronic
1095599884 12:44002323-44002345 CTTGGAGATGGGCAGATGCACGG + Intronic
1095907394 12:47392006-47392028 CTGGGAGATGGAAAGGGAGAAGG - Intergenic
1095995259 12:48076972-48076994 CTACAAGATGGGAGGGTGGAAGG - Intronic
1096077286 12:48813837-48813859 CTTGGAGGTGGGTGGGTGGTAGG + Intronic
1096484521 12:51969354-51969376 CCTGGAGATGCAAAGGTGAATGG + Intronic
1096557376 12:52411686-52411708 CTTGGAGCTGGGAAGCTTGAGGG + Intergenic
1096657922 12:53103306-53103328 CTTGGAGCTGGGCATCTGGATGG + Intergenic
1097284003 12:57863870-57863892 CCTGGGGATGTGAAGGAGGAGGG + Intergenic
1097369267 12:58757001-58757023 CTGGGAGATGTGGAGGTGGCAGG + Intronic
1097733715 12:63157803-63157825 CTTTGAGAGGCCAAGGTGGATGG - Intergenic
1098066848 12:66627829-66627851 CTTGGAGCTGGGATTGTGTAAGG + Intronic
1098685683 12:73417053-73417075 GTTGAGGATGAGAAGGTGGAGGG + Intergenic
1098977756 12:76920884-76920906 CTTGGAGATGTGATTTTGGATGG + Intergenic
1100275255 12:93065940-93065962 CTTGGAGCTGGGGAAGAGGAAGG + Intergenic
1100356223 12:93833258-93833280 TTTGCAGATGGGAAGATAGATGG + Intronic
1100819869 12:98420860-98420882 CTGGGAGATGGGCAGGTGACAGG + Intergenic
1100824563 12:98462657-98462679 CTTGGAGAGGCCAAGGTAGATGG - Intergenic
1100883543 12:99044524-99044546 GTTGGAGATGGGAATGAGGGAGG + Intronic
1100947711 12:99805378-99805400 CTTGGGGATGCCAAGGTGGAAGG + Intronic
1100985563 12:100199427-100199449 CTTGGAGAAAGGAGGGTGGATGG + Intronic
1101425134 12:104581954-104581976 CTTTGAGATGGGGATGGGGATGG + Intronic
1101890019 12:108704962-108704984 ATTGGTGATGGGATGGTGGCAGG + Intronic
1102414474 12:112748576-112748598 CTTTGAGATGCCAAGGTGGGAGG - Intronic
1102460645 12:113097621-113097643 CCTGGAGATGGGAAGGGAGAAGG - Exonic
1102795165 12:115683032-115683054 CTTGGAGAGGCCAAGGTGGGAGG - Intergenic
1102836326 12:116063937-116063959 CTTTGAGATGGTGAGGTGGCCGG + Intronic
1102864378 12:116362285-116362307 CTTGGGGATGCCAAGGTGGGCGG + Intergenic
1103031270 12:117615413-117615435 CTTGGAGATGGGTAGGTAATGGG - Intronic
1103478030 12:121232818-121232840 CTTGGAGAAGGGAAGGTGGGAGG - Intronic
1103541622 12:121670116-121670138 CTTGGAGAGGCTGAGGTGGATGG - Intronic
1103762406 12:123260667-123260689 CTTTGAGAGGCTAAGGTGGAAGG + Intergenic
1104211819 12:126696221-126696243 CTTTGAGAAGGGAAGGTGAAGGG - Intergenic
1104761721 12:131300840-131300862 CTAGGGGATGGGAATGGGGAGGG - Intergenic
1104842547 12:131831906-131831928 GGGGGAGATGGGAAGGGGGAAGG + Intronic
1105053442 12:133076057-133076079 CTTGGACCTAGGAAGGTGGAAGG + Intergenic
1105529723 13:21208425-21208447 CTTGGAGGTAGGAAGGTATATGG + Intergenic
1106142917 13:27026118-27026140 CGTGGAGCTGGGCAGGAGGAGGG - Intergenic
1107409354 13:40144134-40144156 CTGGGAGATGGTAAGGAGCACGG - Intergenic
1107420974 13:40246126-40246148 CCTGAAGTTGGGAAGATGGAGGG + Intergenic
1108123239 13:47212528-47212550 CTTGGTGGTGGGAGGATGGAGGG + Intergenic
1108601835 13:52001536-52001558 TTTGGATATGGGATGTTGGAGGG - Intronic
1108749280 13:53430743-53430765 CTTTGGGATGCCAAGGTGGATGG - Intergenic
1109245043 13:59943966-59943988 CTTTGAGAGGTCAAGGTGGAAGG + Intronic
1109959758 13:69615070-69615092 CTTGGAGAGCGGAATGTGGCAGG + Intergenic
1110621564 13:77601764-77601786 CTTGGAGGTGGGTTGGTGGGAGG - Intronic
1110994582 13:82090599-82090621 GGTGGGGAGGGGAAGGTGGAGGG - Intergenic
1111337574 13:86842063-86842085 GTTGGAGATGGGAGGGTGGTTGG + Intergenic
1111610690 13:90603210-90603232 CATGCAGATGGGCAGGTGCAGGG + Intergenic
1112256000 13:97831777-97831799 CTTGGACATGGAAAGGAGGCAGG - Intergenic
1112403762 13:99099658-99099680 CTTTGAGATGCCAAGGTGGGCGG + Intergenic
1112797405 13:103071333-103071355 CTAGGAGGTGGGTAGGTGGATGG + Intergenic
1112852038 13:103718089-103718111 GTTGGAGATGGGACTTTGGAAGG + Intergenic
1113047105 13:106168006-106168028 CATGGAGATGGGGAGAGGGAGGG - Intergenic
1113791575 13:113031603-113031625 CTGGGAGATGGGGAGGAGGGCGG + Intronic
1113823593 13:113232722-113232744 CTTGGAGAAGGGAAGCTGCTGGG + Intronic
1114469894 14:22953378-22953400 CTTTGAGATGCCAAGGTGGGAGG - Intronic
1114491885 14:23107735-23107757 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1114496269 14:23135008-23135030 CTTTGGGAAGGCAAGGTGGAAGG - Intronic
1114578835 14:23737499-23737521 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
1114654863 14:24310064-24310086 GTTGGTGATGGGAAGGAGCAGGG + Intronic
1114796770 14:25724703-25724725 CTTTGAGATGCCAAGGTGGAAGG - Intergenic
1116183362 14:41564684-41564706 CTTTGAGAGGCCAAGGTGGATGG - Intergenic
1116574614 14:46557310-46557332 CCTGGAGAGGGGATGGTGAAAGG - Intergenic
1117162400 14:53002231-53002253 CTGGGAGATGAGAAGGAGGGAGG - Intergenic
1117412468 14:55463211-55463233 TTTGGAGATGGGATGAAGGAAGG - Intergenic
1117697870 14:58384601-58384623 CTTGGAGTGGGGTATGTGGAGGG + Intergenic
1117867183 14:60162130-60162152 CTTTGAGAGGCCAAGGTGGAAGG + Intronic
1118259326 14:64232976-64232998 CTGAGAGTTGGGAAGGTGGAGGG + Intronic
1118593484 14:67418970-67418992 CTAGGGGGTGGCAAGGTGGATGG - Intergenic
1118626212 14:67661775-67661797 CTTTGAGATGCCAAGGTGGGAGG - Intronic
1118935537 14:70284618-70284640 CTTGGAAATGGGAATGTGGCAGG - Intergenic
1119078125 14:71664967-71664989 CCTAGAAATGGGAAGGAGGATGG + Intronic
1119577563 14:75740613-75740635 CTTTGAAATTGGCAGGTGGAGGG - Intronic
1119769699 14:77212839-77212861 CTTGGAGTTGGGCAGGAGGTGGG - Intronic
1119831181 14:77703839-77703861 CTTTGAGATGCCAAGGTGGGTGG - Intronic
1119917029 14:78411739-78411761 CTTGGATAGGGGGAGGTGCAGGG - Intronic
1121076179 14:91070240-91070262 CTTGGAGATGAGGGGGTGAAGGG + Intronic
1121102979 14:91262939-91262961 GGTGGAGATTGCAAGGTGGAGGG - Intergenic
1121423412 14:93831713-93831735 CTTTGAGAGGCTAAGGTGGACGG + Intergenic
1121642382 14:95494440-95494462 CTGGGAGATGGGGAAGTGCAAGG + Intergenic
1121771638 14:96549178-96549200 CTTGGAGATAGGTAGATAGATGG + Intronic
1122442564 14:101742289-101742311 CTTTGGGAGGGCAAGGTGGATGG - Intergenic
1122573760 14:102727284-102727306 CTTGGAGGTGGGGGGGTGGGGGG - Exonic
1122672047 14:103379848-103379870 CTTGGTGAGGGGAAAGAGGAGGG - Intergenic
1122766256 14:104072914-104072936 CTTGTTGTTGGGGAGGTGGAGGG + Intergenic
1122944172 14:104998161-104998183 CTTTGAGAGGCCAAGGTGGAAGG + Intronic
1123012536 14:105356299-105356321 CCAGGAGATGGGAGCGTGGAGGG + Intronic
1202919304 14_KI270723v1_random:16200-16222 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1202925327 14_KI270724v1_random:18794-18816 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
1123459749 15:20459112-20459134 CTTGGAGATGGGAGGGCCGATGG + Intergenic
1123658313 15:22541308-22541330 CTTGGAGATGGGAGGGCCGATGG - Intergenic
1123723689 15:23081915-23081937 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1124032467 15:26024042-26024064 GGTGGAGATGGCTAGGTGGAAGG - Intergenic
1124265979 15:28234949-28234971 CTTGGAGATGGGAGGGCCGATGG + Intronic
1124312178 15:28635800-28635822 CTTGGAGATGGGAGGGCCGATGG - Intergenic
1124918696 15:34002318-34002340 GTTGGGGATGGGAGGGTGGGAGG - Intronic
1125258733 15:37798006-37798028 CTTTGAGAGGGGAAGGAGGCTGG - Intergenic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125551977 15:40551907-40551929 CTTTGAGAGGCCAAGGTGGAAGG + Intronic
1125770948 15:42165598-42165620 CTTGGGGATTGGAAGGATGAGGG - Intronic
1125903011 15:43366598-43366620 TTTGAAGATGAGAAGGTGGCAGG - Exonic
1126343901 15:47673407-47673429 GTTGGAGAAGGGAAGGAGGAGGG - Intronic
1126396507 15:48224027-48224049 CAAGGAGAAGGGAAAGTGGAAGG - Intronic
1127587962 15:60396586-60396608 ATTGGTGGTGGGGAGGTGGAGGG - Intronic
1127664911 15:61136195-61136217 CTTTCAGATGGGAGGGTGGGTGG - Intronic
1128058404 15:64718002-64718024 CCTGGAGCTGGGAAGTTGGTGGG - Intergenic
1128166851 15:65473081-65473103 CTGGGAGGTGGCAAGGTGGGAGG + Intronic
1128249023 15:66152008-66152030 CCTGGAGCTGGGCAGGTGGGAGG - Intronic
1128375592 15:67072776-67072798 CTTGAAGATGGGAAGACTGAAGG - Intronic
1128410468 15:67391965-67391987 TTTTGAGATGTGAAGGGGGATGG - Intronic
1128475430 15:67993245-67993267 CTTGGAGTTGGGAGAGTGAAGGG - Intergenic
1128776146 15:70321958-70321980 CGTGGTGATTGGAAGTTGGAAGG + Intergenic
1129205907 15:74036842-74036864 CTCGGTGATGGCAAGGTGCAGGG - Intronic
1129224318 15:74158149-74158171 CGTGTAGATGGAAAGGTGGGAGG - Intergenic
1129432833 15:75513521-75513543 CTTTGAGAGGCCAAGGTGGATGG + Intronic
1129752703 15:78077200-78077222 CTTGGAGGAAGGAGGGTGGATGG + Intronic
1129854984 15:78817175-78817197 CTTTGAGAGGGTAAGGTGGGAGG + Intronic
1129997878 15:80022649-80022671 GCAGGAGATGGGAAGGTGGGAGG - Intergenic
1130032571 15:80328915-80328937 GATGGGGATGGGGAGGTGGAGGG + Intergenic
1130819271 15:87477049-87477071 TTAGGAGATGGATAGGTGGAAGG - Intergenic
1131175961 15:90210003-90210025 CCTGGAGATGGGAGGCTGGTTGG + Intronic
1131513467 15:93062680-93062702 GATGGAGAAGGGAAGGTGGGAGG + Intronic
1131635814 15:94231754-94231776 CTGGGAGTTGGGGAGCTGGAGGG + Intronic
1131670765 15:94617304-94617326 CTTGGAGAGAGGAAGGAGGGGGG - Intergenic
1131901275 15:97090296-97090318 CTTTGAGAAGGGAAGGTGGCTGG - Intergenic
1132073462 15:98799798-98799820 CTTGAAGGGGGGCAGGTGGAGGG - Intronic
1132414266 15:101609613-101609635 CATTGAGATGGGGCGGTGGAGGG + Intergenic
1133225605 16:4338951-4338973 TTTACAGATGGGGAGGTGGAAGG - Exonic
1133515876 16:6508209-6508231 TTTGGAGGGTGGAAGGTGGAAGG + Intronic
1133526031 16:6606513-6606535 CTCGTAGAGGGGAAGGAGGAGGG - Intronic
1133531908 16:6663152-6663174 GTAGGAGATGGGGAGGAGGAAGG + Intronic
1134040151 16:11062132-11062154 CTTGGAGCTGGGAGGGAGGGAGG + Intronic
1134111123 16:11516113-11516135 CCAGGAGATGGGAAGGGGGTAGG - Intronic
1134817434 16:17217573-17217595 ATTTGAGAAGGGAAGGAGGAGGG - Intronic
1134905102 16:17972994-17973016 CTTTGGGATGCCAAGGTGGAAGG + Intergenic
1135169248 16:20168730-20168752 CTGGGAGAAGGGAGGGTGAAGGG - Intergenic
1135191410 16:20357739-20357761 GATGGGGGTGGGAAGGTGGAGGG + Intergenic
1135265487 16:21021996-21022018 CATTGAGAAGGCAAGGTGGATGG + Exonic
1135356495 16:21773361-21773383 GTAGGAGATTGGAGGGTGGAAGG + Intergenic
1135391219 16:22095011-22095033 TTTTGAGAAGGGAAGGTGAAGGG - Intronic
1135454991 16:22589504-22589526 GTAGGAGATTGGAGGGTGGAAGG + Intergenic
1135526907 16:23220212-23220234 CCTGGAGTAGGGAAGGAGGAAGG - Intergenic
1135985255 16:27179249-27179271 TGTGGAGATGGGAAGATGGAGGG + Intergenic
1136094467 16:27945120-27945142 CTTGGAGGTGGGAGGATTGAGGG + Intronic
1136342279 16:29652467-29652489 CTTTGAGAGGCTAAGGTGGACGG + Intergenic
1136522128 16:30803901-30803923 CTTTGAGAAGCGAAGGTGGGTGG - Intergenic
1136591224 16:31218965-31218987 TTTGGGGATGGGAAGATGGCTGG + Intronic
1136607835 16:31348461-31348483 ATGGGTGATGGGAGGGTGGATGG + Intergenic
1136704159 16:32172341-32172363 CTTGGAGACGGGAGGGCCGATGG + Intergenic
1136763750 16:32757065-32757087 CTTGGAGACGGGAGGGCCGATGG - Intergenic
1136804349 16:33113321-33113343 CTTGGAGACGGGAGGGCCGATGG + Intergenic
1137701696 16:50502358-50502380 CTGGGAGATGGGAAGGAGGTAGG + Intergenic
1137757437 16:50913864-50913886 CTTTAAAATGAGAAGGTGGAGGG + Intergenic
1137833010 16:51562317-51562339 CTTGGATATGGGAAGAAGGAGGG + Intergenic
1137868835 16:51929873-51929895 CTTTGGGAAGGGAAGGTTGATGG - Intergenic
1138159059 16:54736298-54736320 GTTCGGGATTGGAAGGTGGAAGG - Intergenic
1138350194 16:56342216-56342238 CCTGGAGTGGGGAAGGAGGAGGG + Intronic
1138537412 16:57667322-57667344 CTTGGCAATTGGAAGGTGAAGGG - Intergenic
1138544375 16:57706936-57706958 ATGGGAGATGGGTAGGAGGATGG - Intronic
1138653787 16:58478145-58478167 CTTTGAGAGGCCAAGGTGGATGG + Intronic
1138726854 16:59149620-59149642 CTTGCAGATGGAAAGCTGGGAGG + Intergenic
1138923736 16:61565673-61565695 CTTTGAGATGCCAAGGTGGGTGG + Intergenic
1139361008 16:66400165-66400187 ATTGGATCTGGGAAGGTGGGCGG + Intronic
1139621912 16:68152117-68152139 CTTTGAGAGGCCAAGGTGGACGG + Intronic
1139655073 16:68382549-68382571 TGTGGAGATAGGAAGGTGGTGGG + Intronic
1140735486 16:77894398-77894420 GTTGGTGAAGGGAAGGTGCAGGG + Intronic
1140856115 16:78979249-78979271 CTGGGAGGTGGGAATGGGGATGG - Intronic
1140904980 16:79402366-79402388 CTTGGAAATGGGGAGCAGGAAGG + Intergenic
1140948686 16:79795427-79795449 CTTAGAGATGGAAATTTGGAAGG + Intergenic
1141131673 16:81441692-81441714 CTGGGATAGTGGAAGGTGGAGGG + Intergenic
1141994287 16:87626895-87626917 TTTGGGGAGGGCAAGGTGGAAGG + Intronic
1142018839 16:87767184-87767206 ATTTTAAATGGGAAGGTGGAAGG - Intergenic
1142326215 16:89416539-89416561 CTTTGAGATGTCAAGGTGGGTGG - Intronic
1203065900 16_KI270728v1_random:1017386-1017408 CTTGGAGACGGGAGGGCCGATGG - Intergenic
1142532827 17:594474-594496 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532844 17:594546-594568 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532860 17:594619-594641 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532875 17:594690-594712 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532892 17:594762-594784 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532907 17:594835-594857 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532922 17:594906-594928 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532939 17:594979-595001 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532955 17:595050-595072 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532970 17:595121-595143 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142532986 17:595192-595214 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533001 17:595265-595287 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533016 17:595336-595358 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533033 17:595408-595430 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533048 17:595481-595503 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533065 17:595552-595574 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533082 17:595624-595646 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533100 17:595696-595718 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533116 17:595767-595789 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533131 17:595838-595860 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533146 17:595909-595931 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142533161 17:595980-596002 CTGGGAGATGGGAAGGGGTCTGG + Intronic
1142626444 17:1195337-1195359 CTTGGAGAGGCCAAGGTGGGAGG - Intronic
1143329347 17:6121967-6121989 CAGGGAGGTGGGAAGGTGGGTGG + Exonic
1143464923 17:7130348-7130370 CTTTGAGATGCCAAGGTGGGTGG + Intergenic
1143637757 17:8176153-8176175 CTCAGAGATGGGAATGGGGACGG + Intronic
1143832001 17:9659999-9660021 CTTTGGGATGGGAATGGGGATGG + Intronic
1144037709 17:11382320-11382342 CTTTGGGAGGGGAAGGTGGAAGG - Intronic
1144574998 17:16423782-16423804 CCTGGAGAGGGGAAGTGGGAAGG - Intronic
1144831847 17:18136311-18136333 CATGGAGAAGGGAGGCTGGAGGG - Intronic
1144899262 17:18568931-18568953 GATGGAGAAGGGAAGGTGGGAGG - Intergenic
1144930481 17:18855116-18855138 CTTGGAGAATGGATGGCGGATGG + Intronic
1145040986 17:19578437-19578459 CTTTGGGAGGGCAAGGTGGAAGG - Exonic
1145243245 17:21251851-21251873 TTTCAAGAAGGGAAGGTGGAGGG - Intronic
1145295350 17:21587340-21587362 CTTTGAGATGCCAAGGTGGGTGG - Intergenic
1146033889 17:29390035-29390057 TTTGGAGGTGGGAAGCAGGAAGG + Intergenic
1146188895 17:30747696-30747718 CTTTGAGAGGCCAAGGTGGAAGG - Intergenic
1146322514 17:31858221-31858243 CGTGGAGATGAGAAAGTGCAGGG - Intronic
1146333782 17:31952016-31952038 CTTTGAGAGGCCAAGGTGGAAGG - Intronic
1146433975 17:32825534-32825556 ATTTGAGAGGCGAAGGTGGATGG - Intronic
1146633849 17:34489779-34489801 CTTGGAGTTTGGAAGGTTGGGGG + Intergenic
1146648484 17:34591411-34591433 CTTGGGGATGTGGAGGTGGGAGG - Intronic
1147304452 17:39553677-39553699 CTTGAAGATAGGAAGATGGCAGG + Intronic
1148622467 17:49044725-49044747 CTGGGAGATTGGTAGGTGGAGGG + Intronic
1148962755 17:51407156-51407178 GTTGGAGATGGATGGGTGGACGG - Intergenic
1148968983 17:51462845-51462867 ATAGGAGATGAGATGGTGGAAGG - Intergenic
1149420556 17:56506781-56506803 CATGGAAATGCTAAGGTGGATGG + Intronic
1149597779 17:57874390-57874412 CGTGGAGATGTGAGTGTGGAAGG + Intronic
1149675591 17:58458471-58458493 CTTGGAGAAGGCAAGGATGAAGG - Intronic
1149992526 17:61390900-61390922 CTTGGAGAAGGAAAGGTTGCAGG + Intronic
1150174812 17:63041490-63041512 CTCGGAGATGGGAAGGGGTTTGG + Intronic
1151210066 17:72537842-72537864 CTTTGAGAGGGCAAGGTGGGCGG - Intergenic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1151878098 17:76878716-76878738 CTTGGGGAGGCCAAGGTGGATGG - Intronic
1151886040 17:76923896-76923918 AGTGGGGATGGGAACGTGGAAGG + Intronic
1152164883 17:78696898-78696920 CTTGGCAATAGGAATGTGGAAGG + Intronic
1152291777 17:79443972-79443994 TTGGGAGATGGGAAGAGGGATGG - Intronic
1152302595 17:79503968-79503990 CAAGGAAATGGGAAGGTGGGTGG + Intronic
1152312460 17:79559437-79559459 ATAGTAGATGGGTAGGTGGATGG + Intergenic
1152418824 17:80181004-80181026 CTTTGAGAGGCGAAGGGGGAAGG - Intronic
1152534874 17:80944745-80944767 CTTTGAGAAGCCAAGGTGGATGG + Intronic
1152568699 17:81111821-81111843 CTTGGGGATGGAAGGGTGGTGGG - Intronic
1153089138 18:1323975-1323997 CTTGGAGAGGTGAGGGAGGAAGG + Intergenic
1153152521 18:2111317-2111339 CTTGGATTTGGGCAGGTGGTGGG - Intergenic
1153243898 18:3055054-3055076 CTTTGAGAAGGCAAGGTGGGAGG + Intergenic
1153253897 18:3151084-3151106 CTTGGAGAGGCTAAGGTGGGAGG - Intronic
1153431029 18:5017304-5017326 CTTTGAGAGGCAAAGGTGGAAGG + Intergenic
1153460728 18:5329821-5329843 CTCTTAGATGGGAAGGAGGAAGG + Intergenic
1154347895 18:13558881-13558903 CTTGTAGAGGGGCAGGGGGAGGG - Intronic
1154459340 18:14564355-14564377 AGTGAAGATGGCAAGGTGGACGG + Intergenic
1154482919 18:14854947-14854969 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1156457422 18:37302590-37302612 CCTGGAGGTGGGGAGGTGGAGGG + Intronic
1156659129 18:39325995-39326017 CTTGGAGAAGAGAAGATGGGTGG + Intergenic
1157119193 18:44892791-44892813 CTTGGAGATGTGAAGATTTAAGG - Intronic
1157191189 18:45583078-45583100 ATTGGAGAAGGGAAGCAGGAAGG + Intronic
1157326092 18:46669668-46669690 CTTGGAGATGGGAAGGTGGAAGG + Intronic
1157565790 18:48678405-48678427 CTTGGGGGTGGGGAGGTGGCTGG - Intronic
1157844397 18:50989477-50989499 CTTGGGGAGGCCAAGGTGGATGG + Intronic
1157884191 18:51350576-51350598 CAGGGAGAAGGGAAGGGGGAAGG - Intergenic
1158218315 18:55123416-55123438 CTTTGAGAGGTCAAGGTGGAAGG - Intergenic
1158253675 18:55519991-55520013 TCAGGGGATGGGAAGGTGGAGGG - Intronic
1158444618 18:57508612-57508634 CATGGAGTTGGGAAAGTGCATGG - Intergenic
1160976786 19:1796682-1796704 CTCAGAGATGGGGAGGTGGGTGG + Intronic
1161134483 19:2611591-2611613 CTTGGAGAGGCCAAGGTGGGAGG + Intronic
1161242734 19:3231546-3231568 TTTGTAGATGGGTGGGTGGATGG + Intronic
1161242742 19:3231578-3231600 TTTGTAGATGGGTGGGTGGATGG + Intronic
1161423841 19:4191208-4191230 ACTGGAGAAGGGCAGGTGGAGGG - Intronic
1161555228 19:4937905-4937927 CTTGGAGAGGCGGAGGTGGGCGG + Intronic
1161693834 19:5754052-5754074 CAAGGAGGTGGGAAGGAGGAAGG - Intronic
1161698433 19:5782916-5782938 CTTGGGGATGGGGAGGGGGCTGG - Intergenic
1161717164 19:5882538-5882560 CTGGCAGATGGGAAGCTGGAAGG - Intronic
1161820618 19:6528848-6528870 CTGGGAGATGGGAAGGGAGTTGG + Intergenic
1161821494 19:6533434-6533456 GATGGAGAGGGGAAGGGGGAAGG - Intronic
1161846343 19:6713736-6713758 CTGGGAGTGGGGAAGGTGGGGGG - Intronic
1161927285 19:7310700-7310722 CTTTGAGAGGCCAAGGTGGATGG - Intergenic
1162052242 19:8041594-8041616 CCTGGAGATGGGCAGAGGGAGGG + Intronic
1162330545 19:10026451-10026473 CTTTGAGAGGCCAAGGTGGAAGG - Intergenic
1162414179 19:10524479-10524501 CTTTGAGTTGGGAAGGAGAAGGG - Intergenic
1162850126 19:13424716-13424738 CTTTGAGAGGCTAAGGTGGAGGG - Intronic
1163112199 19:15168283-15168305 CTTTGGGATGGGAAGGCAGAAGG + Intronic
1163350456 19:16773558-16773580 CTTGGAGATGGGAAGCTTGGAGG - Intronic
1163779793 19:19240197-19240219 GCTGGAGAAGGGAAGGGGGAAGG - Intronic
1163971746 19:20804486-20804508 CTTTGAGAGGCCAAGGTGGATGG - Intronic
1164023942 19:21333185-21333207 CTTGGAGATGCCAAGGTGGGTGG + Intergenic
1164579972 19:29428985-29429007 GTAGGAGAGGGGAAGGTGGGAGG + Intergenic
1164928691 19:32154152-32154174 CTTGCAGAGGCCAAGGTGGATGG - Intergenic
1164973562 19:32552947-32552969 CTTTGAGAGGTGAAGGTGGGAGG + Intergenic
1165083374 19:33324816-33324838 CTTTGAGAGGCCAAGGTGGAAGG + Intergenic
1165295168 19:34920924-34920946 CTTGGAGAGGGGAATGTGGCAGG - Intergenic
1165334393 19:35158881-35158903 CTTTGAGAGGCCAAGGTGGATGG + Intronic
1165607140 19:37115397-37115419 CTTGGAGAGGGGGATGTGGCAGG + Intronic
1165691859 19:37869709-37869731 CATGGAGATGGTAAGCTTGAAGG - Intergenic
1166226499 19:41399015-41399037 CTTGGAGATGGGGAGAAGAAAGG + Intronic
1166346541 19:42169905-42169927 CTTGCAGATGGGGAGGGGGCCGG + Intronic
1166596323 19:44053308-44053330 CTTGGTGAGGGGGATGTGGAAGG + Intronic
1166704997 19:44903574-44903596 CGAGGAGATGGGAAAGTGGACGG - Exonic
1166708650 19:44923217-44923239 CTTTGAGATGCCAAGGTGGGAGG + Intergenic
1167021507 19:46879840-46879862 CTTTGAGAGGCCAAGGTGGACGG + Intergenic
1167225383 19:48235625-48235647 CTTTGGGATGCCAAGGTGGAAGG - Intronic
1167695817 19:51015216-51015238 CTTGGAGATGGGAATGGGGTGGG + Intronic
1167792152 19:51689415-51689437 CGGGGAGAAGGGAAGGAGGATGG + Intergenic
1167939704 19:52936827-52936849 CTTGGAGAGGGGAATGTGGCAGG - Intronic
1167940865 19:52944781-52944803 CTCGGAGAGGGGGATGTGGAAGG + Intronic
1168095157 19:54110245-54110267 CGGAGGGATGGGAAGGTGGAAGG - Intronic
1168268473 19:55236612-55236634 CTTGGAGAAGGGAAACTGGAGGG + Intronic
1168358570 19:55718665-55718687 CTTGGCGAGGGGAATGTGGCTGG - Intronic
1168633008 19:57971963-57971985 AGTGGAGATGGGTAGGTGGTGGG + Intronic
1168638622 19:58015485-58015507 CTTTGAGAGGCCAAGGTGGAAGG - Intergenic
925016011 2:524795-524817 CTTGGAGCTGGTGAGGTGAAGGG - Intergenic
925023909 2:593331-593353 CATGGAGATGGGCACGCGGATGG + Intergenic
925260198 2:2522054-2522076 ATGGGGGATGGGCAGGTGGATGG - Intergenic
925287245 2:2723805-2723827 CTTGGTGGTGGTAAGATGGACGG - Intergenic
926757714 2:16249589-16249611 CCTGGAGATGGGGAGGGAGACGG + Intergenic
927037151 2:19189764-19189786 ATTGGGAATGGGAAGGTGGAAGG + Intergenic
927078791 2:19607531-19607553 GTTGGAGAGGGGAAGGACGAAGG - Intergenic
927368509 2:22327370-22327392 CTTTGAGATGCCAAGGTGGGAGG + Intergenic
927601177 2:24442901-24442923 CTTTGTGAGGGGAAGGTGGGAGG + Intergenic
927921067 2:26971951-26971973 CTGCAAGATGGGCAGGTGGAGGG - Intronic
927960742 2:27239359-27239381 CTTGGAGAAGGGCATGTGGCTGG - Exonic
929427127 2:41854945-41854967 CTTGGCAATGGGAAGGGGAAGGG - Intergenic
929761652 2:44811975-44811997 CTTGGGGATGCCAAGGTGGAAGG - Intergenic
929818995 2:45258504-45258526 CCTGGAGATTAGAAGGAGGAAGG - Intergenic
929851321 2:45592970-45592992 CTTAGAGTTGGGAAGGGGTAGGG + Intronic
929887520 2:45892098-45892120 CGTGGAGATGGTAAGGTACAGGG - Intronic
929995150 2:46821406-46821428 ACAGGAGATGGGAAAGTGGAAGG + Intronic
930084025 2:47480134-47480156 ATGGGGGATGGGAAGGGGGAGGG - Intronic
930430847 2:51274104-51274126 CTATGGGATGGGAAGGTGTAAGG + Intergenic
930966914 2:57340032-57340054 CTTGGAGGGTGGAGGGTGGAGGG - Intergenic
931301153 2:60979538-60979560 TTTTGAGATGGGGAGGTGGCGGG - Intronic
931404621 2:61963959-61963981 GTTGGTGATGGGATGGTGGCTGG + Intronic
931527572 2:63173545-63173567 TTTGGGGATGGGCAGGAGGATGG + Intronic
931903462 2:66817921-66817943 CTTTGAGATGGACAGGTGAAAGG + Intergenic
933711410 2:85328470-85328492 CGTGGAGTCGGGAAGGAGGAGGG - Intergenic
933854987 2:86404319-86404341 CACTGAGTTGGGAAGGTGGAGGG - Intergenic
934048596 2:88191424-88191446 CTTGGATAAGGGATGGTGGGAGG - Intergenic
934592567 2:95568985-95569007 ATTGGAGATGAGAAGTTGCAAGG + Intergenic
934951814 2:98580710-98580732 CTTGGAGATGGGGAGGCAGGAGG - Intronic
934971577 2:98768622-98768644 CTTGGAGATGAGAAGACAGATGG - Intergenic
935008989 2:99113367-99113389 GGGGGAGAGGGGAAGGTGGAGGG + Intronic
935152330 2:100449319-100449341 GGTGGAGATGGGAAGGTGAAGGG - Intergenic
935234463 2:101126924-101126946 GAAGGAGATGAGAAGGTGGAAGG - Intronic
935944074 2:108270224-108270246 CTTCCAGATGGGAAGGTGGGTGG - Intergenic
936441187 2:112554935-112554957 CTTTGAGATGCCAAGGTGGGTGG + Intronic
936632477 2:114218497-114218519 CTTGGAGATGTGAAGATGGAGGG + Intergenic
937279444 2:120707325-120707347 CTGGGAGGGGGAAAGGTGGAGGG + Intergenic
937354334 2:121188459-121188481 CATGGGGATGGCAAGGTGGCTGG - Intergenic
937685282 2:124689365-124689387 CTTGGATCTTGGAAGGTGAATGG + Intronic
937685561 2:124692538-124692560 CATGGAGGTTGGAAGGGGGAAGG + Intronic
937826544 2:126373314-126373336 CTGGGAGATGGGTATGTGGCAGG - Intergenic
938487139 2:131723199-131723221 CGAGGAGATGGGGAAGTGGACGG + Intronic
938797486 2:134730621-134730643 CTTGGAGCTGGAAAGGGAGATGG - Intergenic
938847396 2:135223569-135223591 CTTGGAGAGGCCAAGGTGGGTGG - Intronic
938877988 2:135553931-135553953 CTTTGAGAAGGCAAGGTGGGCGG - Intronic
938943785 2:136192239-136192261 CTTGGAGATGGGCTGGAGCAGGG - Intergenic
939422643 2:141993436-141993458 CTAGAAGATTGGAAGGTGGAGGG - Intronic
939480891 2:142745786-142745808 CTTTGAGAGGGCAAGGTGAAAGG + Intergenic
941062728 2:160866112-160866134 ATTGGAGATGAGAAGGTCAAGGG + Intergenic
941190467 2:162375682-162375704 CTTTGAGATGCCAAGGTGGGTGG + Intronic
942023839 2:171894001-171894023 CTGGGGGAGGGGAAGGAGGAGGG - Intronic
942245019 2:173999607-173999629 CCTGTAGATGGGAAAGGGGAGGG + Intergenic
942304296 2:174590523-174590545 CTTGGAGATGGGAGCATGGCAGG + Intronic
944049327 2:195449584-195449606 CTTTGAGAGGCCAAGGTGGATGG + Intergenic
945291187 2:208129142-208129164 CTTGCAAATGGGAAGCTGGTTGG - Intronic
945406455 2:209454578-209454600 CTTTGAGAGGCCAAGGTGGATGG - Intronic
945421716 2:209645940-209645962 CTTTGAGAGGTCAAGGTGGATGG + Intronic
945506439 2:210647113-210647135 CAAGGAGAGGGGAAGGTGGAAGG + Intronic
945845939 2:214944473-214944495 CTTGGAGATGGGAAAGGGTATGG + Intronic
946009666 2:216554614-216554636 CTAGGAGATGGGCTGGTGGAGGG + Intronic
946273397 2:218612526-218612548 CTTGGAGAGGCCAAGGTGGGCGG + Intronic
946708453 2:222482620-222482642 CTTTGAGATGCCAAGGTGGAAGG - Intronic
947154182 2:227144967-227144989 CTAGAAGGAGGGAAGGTGGAAGG + Intronic
947500016 2:230664894-230664916 CTTGGATATGGGGAGGAAGAAGG - Intergenic
947730146 2:232423755-232423777 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
948073761 2:235149105-235149127 CTTGAAGGTGTGAAGGTGGATGG - Intergenic
948256937 2:236575255-236575277 CTTGGGGCTGGGAAGGTAGGAGG - Intronic
948497246 2:238359334-238359356 CATGGAGATGGGCTGGAGGATGG - Intronic
948514908 2:238497829-238497851 CATGGAGATGGGAAGGGGAGTGG + Intergenic
948619952 2:239228032-239228054 CAAAGGGATGGGAAGGTGGAAGG + Intronic
948641037 2:239376102-239376124 CTTGGTGTTTGGATGGTGGAGGG - Intronic
948641045 2:239376146-239376168 CTTGGTGTTTGGATGGTGGAGGG - Intronic
948641060 2:239376231-239376253 CTTGGTGTTTGGATGGTGGAGGG - Intronic
948641068 2:239376275-239376297 CTTGGTGTTTGGATGGTGGAGGG - Intronic
948641076 2:239376319-239376341 CTTGGTGTTTGGATGGTGGAGGG - Intronic
948858801 2:240743084-240743106 CTTGGAGAAGAGAGGGTGGGAGG - Intronic
949076405 2:242061498-242061520 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1168877077 20:1179417-1179439 CTTGGGGGTGGGAGGGTGGGGGG - Intronic
1168963398 20:1883999-1884021 CTTGGAGGAGGGACTGTGGAGGG - Intergenic
1169034495 20:2438508-2438530 CTTTGAGATGCCAAGGTGGGCGG + Intergenic
1169163485 20:3403172-3403194 CTTGGATGTGGCAATGTGGAAGG - Intronic
1169431368 20:5539280-5539302 CTTTCAGAGGGGAAGGTGGGTGG + Intergenic
1169478371 20:5953154-5953176 TTTAGAGACGGGAAGGTGGCAGG - Intronic
1169581314 20:7026359-7026381 GTTGGAGGAGGGGAGGTGGAGGG + Intergenic
1170422770 20:16208852-16208874 CTTGGGGATAGGAAGGGGAAAGG + Intergenic
1170527891 20:17259660-17259682 CCTTGAGATAGGAAGGTAGAGGG + Intronic
1171292479 20:23990218-23990240 CTTGCAGCTGGGAAGGGGGCAGG - Intergenic
1171477342 20:25422328-25422350 CTTTGAGAGGCCAAGGTGGATGG + Intronic
1171498562 20:25575507-25575529 CTTTGGGAGGGCAAGGTGGATGG + Intronic
1171783266 20:29440490-29440512 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1171784021 20:29447328-29447350 CTTGGAGAAAGGCGGGTGGACGG + Intergenic
1171844851 20:30261377-30261399 CTTTGAGAGGGCAAGGTGGGTGG - Intergenic
1172184248 20:33021418-33021440 CTGGGAGGTGGGAAGGGGGCTGG - Intronic
1172231689 20:33340963-33340985 CAGGGTGATTGGAAGGTGGAGGG - Intergenic
1172260211 20:33557748-33557770 CTTTGAGAGGCCAAGGTGGAAGG - Intronic
1172292207 20:33784327-33784349 GAGGGAGATGGGAAGGAGGAGGG - Intronic
1172301540 20:33853735-33853757 CTGGGAGATGGGCGGGGGGAGGG + Exonic
1172535284 20:35667984-35668006 CTTTGGGAGGCGAAGGTGGATGG - Intronic
1172783023 20:37448412-37448434 ATTGGAGGTGGGAAGCGGGAGGG - Intergenic
1172975382 20:38902376-38902398 GTTGGAGGTGTGTAGGTGGATGG + Intronic
1173331943 20:42082562-42082584 CTTGGAGGTAGGAACTTGGAGGG + Intronic
1173515436 20:43662419-43662441 CTTTGGGAGGGCAAGGTGGAAGG - Intergenic
1173582658 20:44158665-44158687 TTAGTAGATGGGAGGGTGGATGG + Intronic
1173763959 20:45589125-45589147 AGTGGAGAGGTGAAGGTGGAAGG - Intergenic
1173988068 20:47278224-47278246 CTTGGGGAGGCCAAGGTGGAAGG - Intronic
1174204070 20:48827019-48827041 CTTGGAGATGGGGAGTTGGTGGG + Intronic
1174291429 20:49511801-49511823 CTAAGAGATGGAAATGTGGATGG + Intronic
1174339852 20:49888896-49888918 CTGGGAGAGGGGAAAGAGGATGG - Exonic
1174394776 20:50240215-50240237 CGTGGAGATGGGAATGTTTAAGG + Intergenic
1174736623 20:52971923-52971945 CTCGGGGCTGGGAAGGGGGAGGG - Intergenic
1175057901 20:56214786-56214808 CCTGGTGATGGGAAGGAGAATGG - Intergenic
1175076144 20:56375386-56375408 CTTGGAGAGGCCAAGGTGGGAGG - Intronic
1175189499 20:57201821-57201843 CTTTGAGAAGGGAAGAAGGAAGG - Intronic
1175336310 20:58198544-58198566 GGTGGAGAAGGGAAGGTGGCTGG + Intergenic
1175349909 20:58310093-58310115 CTTGGACGTGGGAGGGGGGAAGG - Intronic
1175479145 20:59299645-59299667 CTTTGAGAGGCCAAGGTGGATGG - Intergenic
1175825607 20:61934879-61934901 CTTGCAAAGGGGAAGATGGAAGG - Intronic
1176026930 20:62990545-62990567 CTTGCAGATGGGGTGGTGGCGGG - Intergenic
1176797683 21:13381630-13381652 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
1176814803 21:13588983-13589005 AGTGAAGATGGCAAGGTGGACGG - Intergenic
1176852538 21:13934291-13934313 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1177022834 21:15884623-15884645 CTTGGGGAAGTGGAGGTGGATGG + Intergenic
1177379297 21:20317589-20317611 ATTGGAGATGGGGAGGTGTTTGG - Intergenic
1177709943 21:24761216-24761238 TTTGGAGATTGGAGGGTGGGAGG - Intergenic
1177989552 21:28020874-28020896 CTTGGGGAGGCCAAGGTGGATGG + Intergenic
1178215541 21:30593263-30593285 CTTGGAGTGGGGATGGTGGGGGG - Intergenic
1179814537 21:43896998-43897020 CTTGGAGAGGGGGATGTGGCAGG + Intronic
1180086192 21:45509002-45509024 CTGGGAGATTAGAAGGTCGAAGG + Intronic
1180333660 22:11556101-11556123 CTTGGAGAGGGGTATGTGGCAGG + Intergenic
1180816135 22:18791051-18791073 CTTGGAGATTGGGAGGTGAGCGG - Intergenic
1180823546 22:18847979-18848001 CTTGCAGCTGGGAAGGGGGCAGG - Exonic
1181123974 22:20691078-20691100 CTTGCAGCTGGGAAGGGGGCAGG - Intergenic
1181189193 22:21126567-21126589 CTTGCAGCTGGGAAGGGGGCAGG + Exonic
1181202322 22:21225383-21225405 CTTGGAGATTGGGAGGTGAGCGG - Exonic
1181210006 22:21283928-21283950 CTTGCAGCTGGGAAGGGGGCAGG - Intergenic
1181304337 22:21906280-21906302 CTTGGAGATGGCAACGTGGCTGG - Intergenic
1181399513 22:22643016-22643038 CTTGCAGCTGGGAAGGGGGCAGG + Intergenic
1181423681 22:22819188-22819210 CTTGGAGCTGGGTAGGTGGCTGG - Intronic
1181459410 22:23077519-23077541 CTTGGAATTGGGAGGCTGGATGG + Intronic
1181649905 22:24253052-24253074 CTTGCAGCTGGGAAGGGGGCAGG - Intergenic
1181707473 22:24657694-24657716 CTTGCAGCTGGGAAGGGGGCAGG + Intergenic
1181873878 22:25924746-25924768 CATGGAGATTGGATTGTGGAGGG + Intronic
1182112158 22:27731499-27731521 CATGGGGATGGGATGGTGAAGGG - Intergenic
1182329647 22:29542047-29542069 CTGAGAGATGAGAAGGAGGAAGG - Intronic
1182644349 22:31795971-31795993 CTTGGAGAGGCCAAGGTGGGGGG - Intronic
1183142471 22:35955797-35955819 ATTGGAGATGGAATGGAGGATGG + Intronic
1183290344 22:36998292-36998314 CTTGGAGAAGGGATGGTGTCAGG - Intronic
1183295264 22:37025442-37025464 CTTGGAGAACTGAGGGTGGAAGG + Intronic
1183446206 22:37857116-37857138 CTTTGGGAGGTGAAGGTGGACGG + Intronic
1183449336 22:37883051-37883073 CTTTGAGAGGCGAAGGTGGGCGG + Intronic
1183524298 22:38314636-38314658 CGTAGAGATGGGGAGGTGGCTGG - Intronic
1183662437 22:39229595-39229617 TGTGGGGATGGGATGGTGGAAGG - Intronic
1183733926 22:39633129-39633151 ATTGGAGAGAGGAAGATGGAAGG - Intronic
1183812362 22:40267792-40267814 CCTGGAGATGGGAGGCTGTAGGG + Intronic
1183887938 22:40900683-40900705 CTTTGAGAGGCCAAGGTGGATGG + Intronic
1184204139 22:42990423-42990445 CTAGGAGCTGGGTAGGCGGAGGG - Intronic
1184323357 22:43761134-43761156 CTTGCAGAGTGGAAGGAGGAAGG - Intronic
1184435747 22:44474092-44474114 CTTGGAGAGGTTAAGGTGGGAGG - Intergenic
1184480048 22:44741061-44741083 CTTTGAGAGGGCAAGGTGGGTGG + Intronic
1184488373 22:44795341-44795363 ATTGCAGATGGCAGGGTGGAGGG + Intronic
1184502014 22:44880063-44880085 CTCTGAGATGGGGAGGTGGGAGG + Intergenic
1184781287 22:46650951-46650973 CGAGGAGAGGGGAAGATGGAAGG - Intronic
1184910287 22:47527615-47527637 CTTGGGGAGGCCAAGGTGGATGG - Intergenic
1185161341 22:49231750-49231772 CTAGGAGAGAGGAAGGTGAAAGG - Intergenic
1203216941 22_KI270731v1_random:11505-11527 CTTGCAGCTGGGAAGGGGGCAGG + Intergenic
1203224588 22_KI270731v1_random:70030-70052 CTTGGAGATTGGGAGGTGAGCGG + Intergenic
1203266238 22_KI270734v1_random:16762-16784 CTTGGAGATTGGGAGGTGAGCGG - Intergenic
1203273689 22_KI270734v1_random:73885-73907 CTTGCAGCTGGGAAGGGGGCAGG - Intergenic
949492624 3:4604298-4604320 CGTGGAGTTGTGGAGGTGGAAGG + Intronic
949725647 3:7041294-7041316 CCTGGGAATGGGAAGGTGGAAGG - Intronic
949879175 3:8648487-8648509 CTAGGAAAAGGAAAGGTGGAAGG - Intronic
950287884 3:11759392-11759414 CTTGGAAGTGGTACGGTGGAAGG + Intergenic
950772523 3:15323684-15323706 CGTGGGGAAGGGCAGGTGGAGGG - Intronic
950885181 3:16356586-16356608 AGTGGAGATGGGATGGTGGGGGG - Intronic
950899322 3:16482987-16483009 CCTGGAGGAGGGAAGGTGGATGG - Intronic
951096532 3:18638263-18638285 ATTGGAGGGTGGAAGGTGGAAGG + Intergenic
952248945 3:31630378-31630400 CTTCAAGATGGGAAAGTAGAAGG - Intronic
952773988 3:37027157-37027179 CTTCGAGAGGCCAAGGTGGAAGG + Intronic
953309464 3:41863181-41863203 TTTGGAAAGGGGAAGGAGGAAGG - Intronic
953332036 3:42061794-42061816 CATGCAGATGGGTAGATGGATGG - Intronic
953461815 3:43087556-43087578 CGTGGAGCTAGGCAGGTGGATGG - Intronic
954018807 3:47719978-47720000 CTTGGAGAGGCCAAGGTGGGTGG - Intronic
954197518 3:49005445-49005467 CTTGGGGATGGGAAGGGGCTGGG - Intronic
954207882 3:49074023-49074045 CTTTGGGATGCCAAGGTGGACGG - Intronic
954288373 3:49635729-49635751 CTTTGAGAGGCGAAGGTGGGAGG + Intronic
954312004 3:49776989-49777011 CTTGGGGAGGCCAAGGTGGATGG + Intronic
954519747 3:51214261-51214283 CTTGGGGCTGGGAAGGAAGATGG + Intronic
954599990 3:51859605-51859627 CTTGGAGAGGGGAATTTGGCAGG - Intergenic
954763828 3:52897011-52897033 ATTCGAGATGGTAAGGTGGGAGG + Intronic
954856219 3:53646106-53646128 CATGGAGGTGGGAAGGTGGCTGG + Intronic
955882527 3:63563160-63563182 CTTGGGGATAAGAAGGTGCATGG - Intronic
956951400 3:74287735-74287757 GCTGGTGATGGGAGGGTGGAAGG + Intronic
957457617 3:80472674-80472696 CTGGGAGGTGGGGAGGTGGCTGG - Intergenic
958443800 3:94190300-94190322 CTTTGAGATGCCAAGGTGGGTGG + Intergenic
958463905 3:94434321-94434343 CATGGAGGTGGGAAGGAGGTTGG - Intergenic
959068448 3:101680605-101680627 CTGGGAGTGTGGAAGGTGGAAGG - Intergenic
959839707 3:110960140-110960162 CTTGGGGAGGGGAAGGGGGCTGG + Intergenic
959969518 3:112393564-112393586 ATAGGAGATGGCAAGGTGGAGGG + Intergenic
960117663 3:113912498-113912520 CTTGGAGAGGCCAAGGTGGGAGG + Intronic
960918732 3:122724691-122724713 CTTGGAGAGGGGGATGTGGCAGG + Intronic
961818555 3:129563728-129563750 CTTGGAGATGGGCAAGAGCAGGG - Intronic
962125568 3:132613653-132613675 CTTTGGGATGCCAAGGTGGATGG + Intronic
962187379 3:133274164-133274186 CTTGTAGATGGGAAGGCAGTGGG - Intronic
962767800 3:138581458-138581480 CTTTGAGAGGTGAAGGTGGGTGG + Intronic
962886221 3:139630383-139630405 CTGGGACTTGGGAGGGTGGAAGG + Intronic
963741193 3:149083664-149083686 CTTGGAGAGGCCAAGGCGGACGG + Intronic
964163737 3:153675986-153676008 CTATGAGATGGGAAGTTGTAGGG + Intergenic
964234364 3:154507529-154507551 CTTTGAGAGGTGAAGGTGGGAGG - Intergenic
964394212 3:156228583-156228605 CTTGGAGGTGGGAAGTGGGGAGG + Intronic
964432403 3:156621145-156621167 CTGGGAGATGGGTATGTGGCAGG + Intergenic
964606410 3:158565092-158565114 ACTTGAGGTGGGAAGGTGGAAGG - Intergenic
964752636 3:160066575-160066597 CTTGGGGAGGCCAAGGTGGAAGG - Intergenic
966393205 3:179474858-179474880 CTTTGGGAGGGCAAGGTGGAAGG - Intergenic
966797006 3:183724984-183725006 CTTTGAGAGGCCAAGGTGGATGG - Intronic
967099047 3:186200917-186200939 CTTTGAGAGGGGCAGCTGGAAGG + Intronic
967101089 3:186216241-186216263 CTTTGAGAGGCCAAGGTGGATGG - Intronic
967185904 3:186944337-186944359 GTAGGAGTTGGGAAGGTGGAGGG + Intronic
967205670 3:187118577-187118599 CTTTGAGAGGCCAAGGTGGAAGG + Intergenic
967294974 3:187955774-187955796 CTTGGGGATGGGTGGTTGGAGGG - Intergenic
967650398 3:191978382-191978404 ATTGGAGAGTGGAAGGTGGGAGG + Intergenic
967879741 3:194293077-194293099 CTTTGAGAGGCCAAGGTGGAAGG - Intergenic
968035059 3:195541538-195541560 CTTGGAGAGGCCAAGGTGGGAGG - Intronic
968129535 3:196184844-196184866 CTTGGACAGGGGCAGGTGCAGGG - Intergenic
968623914 4:1618040-1618062 CGTGAAGATGGGAAGATGGAGGG + Intronic
968675819 4:1878724-1878746 TGTGGAGTTGGAAAGGTGGAGGG + Intronic
968783988 4:2605050-2605072 CTTGGAGAGGCCAAGGTGGTAGG - Intronic
969013835 4:4089774-4089796 CTTTGAGAGGCCAAGGTGGATGG + Intergenic
969064030 4:4462858-4462880 CTTGTAGCTGGGAAAGGGGAAGG + Intronic
969202948 4:5620195-5620217 CTTGCACAAGGGAAGGTGCAAGG - Intronic
969304400 4:6317557-6317579 CTTGAAGATGGGAAGCAAGAAGG - Intergenic
969483840 4:7460668-7460690 CTTGTAGGTGGGAATGTGGAGGG + Intronic
969486199 4:7473736-7473758 CTTGGCAATGGGGAGGTGGGAGG + Intronic
969981404 4:11159838-11159860 CTTGGTGATTGGATTGTGGATGG + Intergenic
970072391 4:12176061-12176083 CTTTGAGAGGCCAAGGTGGATGG + Intergenic
970629825 4:17928161-17928183 CTTTGGGATGGTAAGGTGGGTGG + Intronic
971026905 4:22597990-22598012 CTCGGAGAGGGGAATGTGGCAGG + Intergenic
971094236 4:23380757-23380779 CTTTGAGAGGCTAAGGTGGAAGG - Intergenic
971166389 4:24188312-24188334 CTTGGGGATGGGAACAGGGAAGG - Intergenic
971237738 4:24857930-24857952 TTTGGAGTTGAGGAGGTGGAGGG - Intronic
971947405 4:33299205-33299227 ATTGGAGGGTGGAAGGTGGAAGG - Intergenic
972223688 4:36986761-36986783 ATTGGAGGTTGGAAGGTGGGAGG - Intergenic
972340355 4:38147605-38147627 CTTGAAGCTGGGAAGGTGGAGGG - Intergenic
972522463 4:39872419-39872441 CTTGGAGAGGCCAAGGCGGACGG + Intronic
972592075 4:40497373-40497395 CTTTGAGAGGCCAAGGTGGAGGG + Intronic
972651890 4:41025836-41025858 CTTGAAGCTGGGATGGTGGGGGG + Intronic
973224058 4:47762779-47762801 CTGGCAGATGGGAGGGTGGGAGG + Intronic
973727693 4:53792290-53792312 TTTGGAGGTGGGGAGGGGGACGG + Intronic
973807803 4:54542369-54542391 CTTGGAGATGTGATGATTGAGGG + Intergenic
974162837 4:58162227-58162249 CTTGAAGATGTGAAGGTGAAGGG - Intergenic
974707549 4:65541053-65541075 ATTGGAGATGAGAAAGGGGAAGG - Intronic
974836117 4:67253040-67253062 CTTTGAGAGGCCAAGGTGGATGG - Intergenic
974939155 4:68442912-68442934 CTTGGAGTAGAGAAGTTGGAAGG - Intergenic
975027371 4:69567772-69567794 CTTTGAGAGGTCAAGGTGGAAGG - Intergenic
975989338 4:80240850-80240872 CTTGGGGATGTAAAGGAGGAAGG - Intergenic
976004278 4:80410056-80410078 CTTGGAGAAGGGAAGACGAAGGG + Intronic
976385701 4:84455475-84455497 GTTTGTGATGGGAAGGTGTAAGG - Intergenic
976756599 4:88505188-88505210 CCTGGAGGTGGGAAGGTGCAAGG - Intronic
976789269 4:88859405-88859427 CCAGGAGATGGGAAGGAAGAAGG + Intronic
977147067 4:93456926-93456948 CCTGGATATGGAAGGGTGGAGGG - Intronic
978949929 4:114545773-114545795 ATGAGAGATGGCAAGGTGGAAGG + Intergenic
979309358 4:119184056-119184078 CTTTGGGAGGAGAAGGTGGATGG - Intronic
979835617 4:125363735-125363757 CTTTGAGAGGCCAAGGTGGACGG - Intronic
979910164 4:126355143-126355165 GTTGGAGCTGGGACAGTGGAGGG + Intergenic
980755504 4:137154285-137154307 ATTGGAGGTTGGAAGGTGGGAGG - Intergenic
982129637 4:152216549-152216571 CTTGGAGTTGGGAAGGGGTAGGG + Intergenic
983008623 4:162517829-162517851 CTTGCTGATGGGAATGTGCATGG + Intergenic
983996425 4:174188223-174188245 CTTGGAGAGTGGAGGGTGGGAGG + Intergenic
984289743 4:177780786-177780808 CTTCGAGATGCCAAGGTGGGTGG + Intronic
984604567 4:181770196-181770218 TATGGAGATGGGAAGGTTGAGGG + Intergenic
984747183 4:183232889-183232911 CTTTGAGAGGCCAAGGTGGATGG - Intronic
985089171 4:186345992-186346014 CGTGGAGATGGGGAGGGAGAGGG - Intergenic
986315635 5:6584585-6584607 CTTGGTGATGGGAAGGCCAAGGG + Intergenic
986363979 5:7011100-7011122 TTCTGAGATGGGAAGGTGCAGGG + Intergenic
986852850 5:11833044-11833066 CTTGGAAATGGAAAAGTGGATGG + Intronic
987296678 5:16559101-16559123 GTTGGAGGTGGGAAGGTGAAAGG - Intronic
987974209 5:24991469-24991491 CTTGGCGATGCCAAGGTGGGAGG - Intergenic
988979168 5:36547582-36547604 CATGGAGATGGGAAAGGAGATGG + Intergenic
989123440 5:38027557-38027579 GTTGGAGACGGGGAGGTGGTGGG - Intergenic
989795567 5:45467194-45467216 TTTGGGGAGGGGAAGGTGGTGGG - Intronic
989991592 5:50773879-50773901 CTTGGAGAGGGGGATGTGGCAGG + Intronic
990011182 5:51000245-51000267 ATTGGGAATGGGAGGGTGGATGG + Intergenic
990468960 5:56095734-56095756 CTGTGAGATTGGAAGGTGGGAGG - Intergenic
990908757 5:60832722-60832744 TTTGGAATTGGGAAGGGGGAAGG - Intronic
991663163 5:68970452-68970474 AAGGGAGCTGGGAAGGTGGAAGG - Intergenic
991736431 5:69633811-69633833 CTTGCAGCTGTGAAGGTGGCAGG - Intergenic
991736606 5:69634624-69634646 CTTGCAGCTGTGAAGGTGGCAGG - Intergenic
991758285 5:69899703-69899725 CTTGCAGCTGTGAAGGTGGCAGG + Intergenic
991758459 5:69900519-69900541 CTTGCAGCTGTGAAGGTGGCAGG + Intergenic
991758632 5:69901332-69901354 CTTGCAGCTGTGAAGGTGGCAGG + Intergenic
991812929 5:70489450-70489472 CTTGCAGCTGTGAAGGTGGCAGG - Intergenic
991815887 5:70509927-70509949 CTTGCAGCTGTGAAGGTGGCAGG - Intergenic
991816060 5:70510740-70510762 CTTGCAGCTGTGAAGGTGGCAGG - Intergenic
991837688 5:70775585-70775607 CTTGCAGCTGTGAAGGTGGCAGG + Intergenic
991837861 5:70776398-70776420 CTTGCAGCTGTGAAGGTGGCAGG + Intergenic
992000651 5:72432678-72432700 CCTGGAGCTGGGGAGGGGGAAGG + Intergenic
992071254 5:73151274-73151296 CCTAGGGGTGGGAAGGTGGAAGG + Intergenic
992312782 5:75519067-75519089 CTTTGAGAGGTCAAGGTGGAAGG - Intronic
992324657 5:75648910-75648932 CTTGATGATGGGGAGGTGGGAGG - Intronic
992753862 5:79886084-79886106 TGTGGAGATGGGAGGGTGGCGGG + Intergenic
993710266 5:91217392-91217414 GTTGGAGATGGGGAGGGAGAGGG - Intergenic
994387972 5:99154668-99154690 ATTGGAGAGTGGAGGGTGGAAGG + Intergenic
994388678 5:99163531-99163553 CTCAGAAATGGGAAGGTGGGAGG + Intergenic
995045172 5:107638094-107638116 CTTTGAGAGGCCAAGGTGGACGG - Intronic
995495175 5:112734200-112734222 ATGGGAGATGGTTAGGTGGATGG + Intronic
995525437 5:113047039-113047061 GTTGAAGAGGGGCAGGTGGAGGG - Intronic
995837333 5:116411549-116411571 CTTGTACATTGGAAGGAGGAAGG + Intronic
996862366 5:128082115-128082137 CTTGGAGAGGCGGAGGTGGGCGG + Intergenic
997016816 5:129945738-129945760 CTTGCAGATGGTAGGGTGGTAGG + Intronic
997551874 5:134760323-134760345 CTTAGAGGTGGGAAGGCGCAAGG + Intronic
997824239 5:137092074-137092096 CTTGGGTATTGGAAGGTGGATGG - Intronic
998636987 5:143966478-143966500 CTTGGAAATGGGAAGGAAGTAGG - Intergenic
999085483 5:148885122-148885144 CCTGGAGATTGGAAGTTGAATGG + Intergenic
999232587 5:150070340-150070362 CTGGGAGATTGGGAGGTGGCGGG - Intronic
999333993 5:150699539-150699561 CTTTGAGAGGCCAAGGTGGAAGG + Intronic
999616279 5:153428113-153428135 CTTGGGGAAGGGGAGATGGAAGG - Intergenic
999624069 5:153501710-153501732 CTGGCAGATGGGCAGGAGGATGG + Intronic
1000411389 5:160937560-160937582 CTGGGAGATGGGTATGTGGCAGG - Intergenic
1001329480 5:170752203-170752225 CATGGAGAAGGGAATGTTGAGGG + Intergenic
1001396400 5:171421731-171421753 CTTGGGGATGGAAGGGTGGACGG + Intronic
1001533093 5:172478686-172478708 CTTGGAGATGGGCCTTTGGAAGG - Intergenic
1001681268 5:173558793-173558815 CCTGGAGATGGGAAAATGGGAGG - Intergenic
1002118767 5:176985045-176985067 CTTGGAGAGGGGGATGTGGCAGG - Intronic
1002295374 5:178227835-178227857 CATGGAGATGGAGAGGTGGAGGG + Intronic
1002506387 5:179682005-179682027 CTTTGGGAGGGGAAGGTGGGTGG + Intronic
1003499742 6:6694570-6694592 CATGCAGATGGGCAGGTGGTGGG + Intergenic
1003530593 6:6934378-6934400 CTTTGAGAGGCTAAGGTGGAAGG + Intergenic
1003567106 6:7230900-7230922 CTTGGGGATGGACAGGTCGATGG - Exonic
1003567469 6:7232653-7232675 CTTGGGGATGGACAGGTTGATGG - Intronic
1003827841 6:9972129-9972151 CTTTCAGAGGCGAAGGTGGATGG - Intronic
1003893425 6:10584144-10584166 CTTGGCGAGGGGAATGTGGTGGG + Intronic
1004222277 6:13757057-13757079 CTTTGGGAGGCGAAGGTGGATGG + Intergenic
1005285353 6:24320573-24320595 CTTTGGGATGCCAAGGTGGACGG - Intronic
1005331327 6:24753299-24753321 GTGGGAGATGGGAAGGCAGAAGG - Intergenic
1005407129 6:25501290-25501312 CTTGGGGAGGGGAAGGAAGATGG - Intronic
1005450920 6:25971529-25971551 TTTGGAGATGGGAATGGTGATGG - Intronic
1005508978 6:26495127-26495149 CTTGCATATGTGAAGGTGGAGGG - Intergenic
1005549794 6:26900163-26900185 CTTGCAGCTGGGAAGGGGGCAGG - Intergenic
1005835247 6:29703908-29703930 CAAGGAGATAGAAAGGTGGATGG - Intergenic
1006453181 6:34117236-34117258 CTGGCAGATGGGAAGCTGGGGGG + Intronic
1006689026 6:35863618-35863640 CATGGGGAGGGGGAGGTGGAGGG + Intronic
1006829729 6:36961579-36961601 CCTGGAGATGGAGAGGGGGAAGG + Intronic
1006930841 6:37687310-37687332 CTTTGAGAGGCCAAGGTGGAAGG + Intronic
1007116688 6:39348096-39348118 CCTGGAGAAGGGAAGGAGAAAGG + Intronic
1007371084 6:41427542-41427564 CTGGGAGAGGGGAAGCTGGGGGG + Intergenic
1007590871 6:43020303-43020325 CCTGGTGAGGGTAAGGTGGAGGG + Intronic
1007690527 6:43698267-43698289 ATTGGAGGTGGGAAGCTTGAAGG - Intergenic
1007905601 6:45457411-45457433 ACTGGAGAAGGGAAGGTGGAAGG + Intronic
1007941994 6:45789992-45790014 CTTGAGGCTGAGAAGGTGGAAGG + Intergenic
1008300996 6:49839189-49839211 CTTTGAGAGGGCAAAGTGGAAGG + Intronic
1008340709 6:50360537-50360559 CTTGGATGAGGGAGGGTGGAAGG + Intergenic
1008434707 6:51462095-51462117 CTTGGAGATGGGTATGTGTGTGG + Intergenic
1008544415 6:52573243-52573265 GAAGGAGAAGGGAAGGTGGAGGG + Intronic
1008823119 6:55657902-55657924 TTTGGAGAGTGGAAGGTGGAAGG + Intergenic
1009508395 6:64516292-64516314 TTTGGAGAGTGGAAGGTGGAAGG + Intronic
1009803196 6:68569027-68569049 CTTTGAGAGGCCAAGGTGGATGG + Intergenic
1010403619 6:75477268-75477290 CTTGGAGTTGGGGAGAGGGAGGG + Intronic
1010749711 6:79604321-79604343 TTTGGAGGTGAGAAAGTGGAAGG - Intergenic
1011099519 6:83707439-83707461 TTTGGAGAAGGGAGGGTGGGTGG + Intronic
1011309699 6:85968418-85968440 TTTGGAAATGGGAAGGTAGGAGG - Intergenic
1011975234 6:93287681-93287703 TTTGGAGGTTGGAGGGTGGAAGG - Intronic
1012186100 6:96219008-96219030 CCTGGAGATGGTTAGGTTGAGGG - Intergenic
1012522971 6:100143053-100143075 CTTGAGGATGGGAAGGTTGGTGG + Intergenic
1012849923 6:104434344-104434366 TCTGGGGATGGGAAGGAGGAAGG + Intergenic
1013088934 6:106881893-106881915 CTTTGGGATGCCAAGGTGGACGG + Intergenic
1013201862 6:107905673-107905695 CTTGTAGATGGGGAGGTGAGAGG + Intronic
1014041138 6:116827037-116827059 CTAGAGGATGGGAAGGTGGGTGG + Intronic
1014196237 6:118562937-118562959 CTTGGGGAAGGTAGGGTGGAAGG - Intronic
1014232246 6:118916743-118916765 CTTGGAGAGGCCAAGGTGGGTGG - Intronic
1014735000 6:125083036-125083058 CTGGGAGATGAGATGGTAGAAGG - Exonic
1014797792 6:125746968-125746990 ATTGGAGGTGGGGAGGTGTAGGG - Intergenic
1015061992 6:128977366-128977388 CTTGGGGGTGCGGAGGTGGAAGG - Intronic
1015772758 6:136785726-136785748 CTTGGAGTGGTGAAGGTGGTGGG - Intronic
1016311271 6:142736185-142736207 CTTTGTGATGCCAAGGTGGATGG - Intergenic
1017019360 6:150127827-150127849 CTTGCAAAAAGGAAGGTGGAGGG - Intergenic
1017540031 6:155391604-155391626 CTTGGAGATGGTGGGGTGGAGGG + Intergenic
1017625073 6:156339733-156339755 CTTAGAGATGAGAAAGAGGAGGG + Intergenic
1018174947 6:161170363-161170385 CTTGGAGAAGGGAGGGAGGTTGG - Intronic
1018227345 6:161641040-161641062 CTTGGAGATGAGAAGGAAGATGG - Intronic
1018633384 6:165839887-165839909 GTTGGAGATGGGAATGGGGATGG - Intronic
1018633429 6:165840088-165840110 GGTGGAGATGGGAATGGGGATGG - Intronic
1018960971 6:168448357-168448379 GATGGAGATGGGGAGGAGGATGG + Intronic
1018960981 6:168448390-168448412 AATGGAGATGGGGAGGAGGATGG + Intronic
1019504757 7:1385329-1385351 CTTGCAGATGGGAGGTTGGGTGG + Intergenic
1019742424 7:2681502-2681524 CTTTGAGAGGGCAAGGCGGATGG - Intronic
1019902688 7:4035226-4035248 CTTTGAGAGGCCAAGGTGGATGG - Intronic
1020172898 7:5858822-5858844 CTTGGAGAGGCCAAGGTGGGTGG + Intergenic
1020231552 7:6322882-6322904 CTTTGGGATGCCAAGGTGGAAGG + Intergenic
1020273104 7:6608336-6608358 CATGCAGATTGGATGGTGGAGGG + Exonic
1020671904 7:11126610-11126632 CTTGGAAATGTGAAGGAGAAAGG - Intronic
1020804357 7:12770192-12770214 CATGGTGATGGGAAGGGGCATGG - Intergenic
1021030155 7:15723163-15723185 GTTGGAGATGGAGAAGTGGAGGG - Intergenic
1021576634 7:22111346-22111368 CTTGGAGATGGCAGGTTTGAAGG - Intergenic
1021883462 7:25115399-25115421 CTGGGAGATGGAACAGTGGAGGG + Intergenic
1021995519 7:26175901-26175923 CTTGGAGAGGGGGATGTGGCAGG + Intronic
1022021382 7:26402436-26402458 CTTTGAGATGTCAAGGTGGGTGG + Intergenic
1022111369 7:27234463-27234485 CATGGAGGTGATAAGGTGGAAGG + Intergenic
1022688060 7:32615426-32615448 CTTTGAGAGGCCAAGGTGGATGG - Intergenic
1022951720 7:35345614-35345636 CTTGGTGGTGGGGAGGTGGGAGG + Intergenic
1023032858 7:36106208-36106230 CTTTGAGAGGCCAAGGTGGAAGG - Intergenic
1023076306 7:36486092-36486114 GTTGGAGATGGGCTGGAGGAGGG - Intergenic
1023108368 7:36785463-36785485 ATTGGAGGTTGGAAGGTGGAAGG - Intergenic
1023120393 7:36903082-36903104 CTGTGAGATGGGCAGGTAGACGG - Intronic
1023583747 7:41707544-41707566 CTTGGAGATGGATAGGGAGAAGG - Intergenic
1023608829 7:41954401-41954423 CCTGGAGAGGGGAAGGGGGCTGG + Intergenic
1023788584 7:43733535-43733557 CTTTGAGAGGCCAAGGTGGACGG + Intergenic
1023891325 7:44393961-44393983 CTTGGAGGTGGGAAGGTGGAAGG - Intronic
1024022633 7:45385828-45385850 GTAGGGAATGGGAAGGTGGAAGG + Intergenic
1024200413 7:47101076-47101098 CTTGGAGATGGGAATGGGGCAGG + Intergenic
1024202951 7:47125127-47125149 CTTGCAGAGAGGAAGGTGGGAGG - Intergenic
1024551598 7:50566785-50566807 CTAGGAGATGGGCTGGGGGAGGG + Intergenic
1024560123 7:50637083-50637105 CTTGGGGAAGGTAAGGTGGGAGG - Intronic
1026107017 7:67429396-67429418 CATGGAGATGGGCAGGTGGGAGG + Intergenic
1026180439 7:68034629-68034651 CTTAGGGTTGGGAAGGTGTAAGG + Intergenic
1026248455 7:68645217-68645239 CATGCAGATGGGCAGGTGGTGGG - Intergenic
1026350520 7:69511403-69511425 CTAGGAGCTGGGCAGGAGGATGG - Intergenic
1026913135 7:74104273-74104295 CCTGGAGATGGAAAAGGGGATGG - Intronic
1026994365 7:74606172-74606194 CTAGGAGGTGGGAGGGAGGAAGG - Intergenic
1027252638 7:76408689-76408711 CTTGGAGCTGGGAGGGTAGGAGG - Intronic
1027276308 7:76560411-76560433 CCTTCAGTTGGGAAGGTGGAGGG - Intergenic
1029085886 7:98011437-98011459 CTTGGAGAGGCCAAGGTGGGTGG - Intergenic
1029482483 7:100821710-100821732 CTTTGAGATGCCAAGGTGGGAGG - Intronic
1029659745 7:101952142-101952164 CTTTGAGAGGCCAAGGTGGAAGG + Intronic
1029878788 7:103783236-103783258 CTTTGAGAGGGCAAGGTGGGAGG - Intronic
1029953440 7:104611637-104611659 CTTGGAAATGAGAAGATGAAGGG - Intronic
1030057267 7:105594302-105594324 CTGGCAGATGGCGAGGTGGAAGG + Intronic
1030244250 7:107363711-107363733 CTTTGAGAGGCCAAGGTGGACGG + Intronic
1030294350 7:107906588-107906610 CTAGGAAATGGAAGGGTGGAAGG - Intronic
1030610609 7:111684940-111684962 CTTTGGGATGCGAAGGTGGGTGG + Intergenic
1030912590 7:115270363-115270385 CTTTGAGAGGGTAAGGTGGGAGG - Intergenic
1031083208 7:117278117-117278139 CTTGTAGAAGGGAAGGTGGATGG + Exonic
1031209605 7:118805726-118805748 GTTGGAGATGGGATGCAGGAAGG + Intergenic
1031431949 7:121682590-121682612 TTTGGAGAAGGGAAGGGGAAAGG + Intergenic
1031630488 7:124037706-124037728 CTTTGAGATGGCAAGGTGGGAGG - Intergenic
1032179804 7:129665164-129665186 CTTGCAGATGGGAAATGGGAAGG + Intronic
1032485044 7:132279383-132279405 CTTTGGGATGCCAAGGTGGAAGG + Intronic
1032816979 7:135485695-135485717 GATGGAGAAGGGAAGGGGGAAGG + Intronic
1033014893 7:137661753-137661775 CTTGGAGATGGGTAGGAAGGAGG + Intronic
1033147989 7:138887576-138887598 CTTGGGAAAGGGAAGGTGGGAGG - Intronic
1033308649 7:140242939-140242961 CTTGTAGGTGAGAAGCTGGAAGG + Intergenic
1033388258 7:140900511-140900533 CTTACATATGGGTAGGTGGAGGG - Intronic
1033582525 7:142750528-142750550 AGTGGAGATGGGAAGGGAGAAGG - Intronic
1033585552 7:142772022-142772044 AGTGGAGATGGGAAGGGAGAAGG - Intergenic
1033970990 7:147039360-147039382 CCTGGAGAGTGGAGGGTGGAAGG - Intronic
1034840396 7:154390421-154390443 CTTTGAGATTGGAAGGTGCTGGG + Intronic
1034936715 7:155204703-155204725 CTTTGGGATGGGATGGTGGAGGG - Intergenic
1035059284 7:156057102-156057124 CTTGGGGGTGGGAAAGTGGTTGG - Intergenic
1035831628 8:2701187-2701209 GTTGCAGTTGGCAAGGTGGAAGG - Intergenic
1036121124 8:6018831-6018853 CTTTGAGAAGCCAAGGTGGATGG + Intergenic
1036405458 8:8450896-8450918 ATGGGAGATGAGAAGGGGGAGGG + Intergenic
1036461456 8:8956943-8956965 CTTTGGGATGCCAAGGTGGATGG + Intergenic
1036681072 8:10874703-10874725 CTTGGAAATGAGAAGGAGAAAGG - Intergenic
1037287738 8:17318898-17318920 GTTGGAGATGTGAGGGTGTAGGG - Intronic
1037291031 8:17349589-17349611 ATGGGATTTGGGAAGGTGGAGGG - Intronic
1037315720 8:17597262-17597284 CTTTGAGAGGCCAAGGTGGACGG - Intronic
1037696754 8:21230324-21230346 CTTGGAGGTGAGGAGGTGGAAGG - Intergenic
1037884939 8:22590915-22590937 CCTGGAGATTGGCAGGTGGCTGG + Intronic
1038122524 8:24633483-24633505 CTTGGACATGGCAAGATGAAAGG - Intergenic
1038340744 8:26683175-26683197 CTCGGAGAGGGGAATGTGGCAGG + Intergenic
1038918132 8:32050532-32050554 TGTGGAAATGGGAAGGTGGCAGG - Intronic
1039509910 8:38083016-38083038 CATTGAGATAGGAAGCTGGAAGG - Intergenic
1039528625 8:38239128-38239150 CTTGGGGAGGCCAAGGTGGAAGG + Intronic
1040792938 8:51254594-51254616 GTTGGTGATGGGATGGTGGGAGG + Intergenic
1040879410 8:52189303-52189325 CTTGGATAAGGGAAAGTTGATGG + Intronic
1040927679 8:52701634-52701656 CTTGGAGAAGCCAAGGTGGGAGG - Intronic
1041089269 8:54287130-54287152 CATGGAGATAGGAAGGAGAATGG - Intergenic
1041433103 8:57806290-57806312 CTTGGAGAAGTGAAGGTAAAAGG + Intergenic
1042449416 8:68927043-68927065 CTTTGGGATGCTAAGGTGGATGG + Intergenic
1042508758 8:69589695-69589717 CTTGGAGATGGGGGGTGGGAAGG + Intronic
1043692605 8:83174381-83174403 CTGAGCGATGGGATGGTGGAGGG - Intergenic
1044662664 8:94606500-94606522 CTTTGAGAGGCCAAGGTGGAAGG - Intergenic
1045663722 8:104465139-104465161 CTTGGAGAGGGGGAGGTGTAAGG + Intronic
1045782648 8:105885936-105885958 AGTGGAGATGGGAAGGTCAAGGG - Intergenic
1045911235 8:107412841-107412863 CTAGCAGATGGAAATGTGGATGG + Intronic
1045913229 8:107435093-107435115 GTTGGAGCTGGGAAGGAGAAAGG + Intronic
1046011805 8:108557501-108557523 CTGGGGGATGGGAGGGTGGTTGG + Intergenic
1046126306 8:109913147-109913169 CTTTGTGATGCCAAGGTGGAAGG - Intergenic
1046703812 8:117428014-117428036 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
1046814406 8:118568291-118568313 CTTGGAGGTGGGAAGGTACCTGG + Intronic
1047160395 8:122371369-122371391 CTTGGAGAAAGGAGGGTGGGAGG + Intergenic
1047572652 8:126117097-126117119 CATGGAGATGGTAAGGTGAGGGG + Intergenic
1048182214 8:132205961-132205983 CTTTGGTATGTGAAGGTGGAAGG + Intronic
1048986628 8:139738342-139738364 CTGGGACATGGGCAAGTGGAGGG - Intronic
1049646126 8:143736519-143736541 CATGGAGGTGGGAAGGGGGCAGG + Intergenic
1050432781 9:5578884-5578906 CTTGGGGACTGGAAGGTGGGAGG - Intergenic
1051187541 9:14475819-14475841 CATGGAGATGGTAAAGGGGATGG - Intergenic
1051664416 9:19455347-19455369 CTTTGGGAGGGGAAGGTGGGTGG + Intergenic
1052749598 9:32476250-32476272 CTTTGAGAGGGCAAGGTGGGAGG + Intronic
1053068691 9:35087607-35087629 CTTTGAGAGGCCAAGGTGGAAGG + Intergenic
1053286517 9:36852808-36852830 CCTGGGGATGGAAAGGTTGAGGG - Intronic
1053351034 9:37413340-37413362 CTTGAAGCTGGGAAGGTTAAAGG + Intergenic
1053447893 9:38166992-38167014 GTTGAAGAAGGGAAGGAGGAAGG - Intergenic
1053575532 9:39355478-39355500 CTAGAAGGTGGGATGGTGGAGGG + Intergenic
1053840038 9:42183417-42183439 CTAGAAGGTGGGATGGTGGAGGG + Intergenic
1054097092 9:60914165-60914187 CTAGAAGGTGGGATGGTGGAGGG + Intergenic
1054118499 9:61189794-61189816 CTAGAAGGTGGGATGGTGGAGGG + Intergenic
1054163231 9:61694432-61694454 CTTTGGGAGGGCAAGGTGGATGG + Intergenic
1054589257 9:66992770-66992792 CTAGAAGGTGGGATGGTGGAGGG - Intergenic
1055002506 9:71468303-71468325 CTGGGAGAGGGGAAGCAGGATGG - Intergenic
1055313293 9:75007483-75007505 CTTGGAGAGGCCAAGGTGGGTGG + Intronic
1055343643 9:75311588-75311610 CTTGGACACAGGAAGGGGGAAGG - Intergenic
1055441592 9:76342011-76342033 CCTGGAGCAGAGAAGGTGGATGG + Intronic
1055987251 9:82063882-82063904 CTGGAAGGTGGGAGGGTGGAGGG - Intergenic
1056272545 9:84960508-84960530 TTTTGAGATAGGTAGGTGGATGG + Intronic
1056325439 9:85474703-85474725 CATGGAGATGGGAATGTGTTGGG + Intergenic
1056329011 9:85506234-85506256 CTTTGAGAGGCCAAGGTGGAAGG + Intergenic
1056902387 9:90611941-90611963 CTTGGGGATAGGATGGTGGCTGG - Exonic
1056950161 9:91035375-91035397 CTGGGAGATGGGAGGCTTGAGGG - Intergenic
1057159923 9:92882396-92882418 CTGGAAGGTGGGAAGGTGGAGGG + Intergenic
1057402982 9:94741013-94741035 CTTAAAGATGGGGAGGTGGCAGG + Intronic
1057595519 9:96412939-96412961 CTTTGAGAGGCCAAGGTGGATGG - Intronic
1057616916 9:96599971-96599993 CTTTGGGATGCCAAGGTGGATGG - Intronic
1057685752 9:97232886-97232908 CTTGGAGAGGGGGATGTGGCAGG - Intergenic
1057902417 9:98959965-98959987 CTTGGAGAAGGGAACATGCATGG - Intronic
1058234402 9:102471162-102471184 CTTTGAGATGCCAAGGTGGGGGG - Intergenic
1059340805 9:113596669-113596691 CTTGGAGGTGAGAGGCTGGATGG + Intronic
1059632635 9:116141064-116141086 CTTAGAGATGGGAAAATGCAGGG - Intergenic
1059791679 9:117647525-117647547 CTTGAACCTGGGGAGGTGGAGGG - Intergenic
1060515439 9:124262831-124262853 TTTGGACAGGGGAAGGGGGAGGG + Intronic
1060528554 9:124334208-124334230 GTTGGAGGTGGGCAGGTGGCTGG + Intronic
1061255802 9:129453763-129453785 ATGGGGGATGGGAAGATGGAGGG + Intergenic
1061328519 9:129878485-129878507 CTGGGAGATGGGATGCTGGCAGG + Intronic
1061382109 9:130264935-130264957 CATGGGGCTGGGGAGGTGGATGG + Intergenic
1061601923 9:131676008-131676030 CTTTGAGAGGCCAAGGTGGAAGG - Intronic
1062064825 9:134520928-134520950 CCTGGAGATGGAAAGGTGCTTGG + Intergenic
1062129051 9:134882927-134882949 TGTTGAGGTGGGAAGGTGGAGGG - Intronic
1062352590 9:136146364-136146386 CTTGGAGGTGGAAAGAAGGACGG - Intergenic
1062520870 9:136957343-136957365 GTTGGAGATGGGTGGGTGGATGG + Intronic
1062596186 9:137300813-137300835 CGGGGAGAAGGGAAGGGGGAGGG + Exonic
1203532556 Un_GL000213v1:160452-160474 AGTGAAGATGGCAAGGTGGACGG + Intergenic
1185551776 X:987701-987723 CTTGGAGAGGGGGATGTGGCAGG + Intergenic
1185640019 X:1584832-1584854 CTTGGGGAGGTCAAGGTGGAAGG + Intergenic
1186389044 X:9139847-9139869 ATTGGAGAGTGGAAGGTGGGAGG + Intronic
1186688326 X:11948601-11948623 CTTGGAAAGGGGAAGGGGAAGGG + Intergenic
1186767380 X:12784782-12784804 TAGGGAGATGGGAAGATGGAGGG - Intergenic
1186792082 X:13009312-13009334 CTTGGAGATGGGAATAGGGAAGG + Intergenic
1187928703 X:24274422-24274444 CTTGGAGATGGGGACGCTGATGG + Intergenic
1188024783 X:25196715-25196737 CTTAGACATGGAAAGGTAGATGG + Intergenic
1188281487 X:28275236-28275258 GATGAAGCTGGGAAGGTGGAAGG + Intergenic
1188770273 X:34145753-34145775 CTTGAACCTGGGGAGGTGGAGGG + Intergenic
1188981852 X:36733831-36733853 CTTGGAAATGGGTGGATGGATGG - Intergenic
1189486851 X:41441053-41441075 CTTTGAGAGGCCAAGGTGGATGG + Intergenic
1190370029 X:49731397-49731419 CATGGAGTTGGGAGGGTTGAGGG + Intergenic
1190691353 X:52915895-52915917 CTTGGAGTTGGGGTGATGGAAGG + Intergenic
1190694630 X:52939897-52939919 CTTGGAGTTGGGGTGATGGAAGG - Intronic
1191043366 X:56109151-56109173 CTTGGAGAGGCCAAGGTGGGAGG + Intergenic
1192814482 X:74576664-74576686 CTTTGGGATGCCAAGGTGGAAGG + Intergenic
1193084260 X:77434740-77434762 CTTGGGGGTGGGAAGGTGTGGGG + Intergenic
1193425097 X:81332539-81332561 CTTTGAGATGCCAAGGTGGGAGG - Intergenic
1194310776 X:92303131-92303153 CTTGGAGATAGAAAGGTGAGAGG + Intronic
1194565129 X:95477234-95477256 ATTGGAGAGTGGAGGGTGGAAGG + Intergenic
1195482495 X:105362250-105362272 CTTGAAAATGTGAAGGTGGATGG + Intronic
1196022370 X:111003561-111003583 CTTGGAGGTGGGAGGGAGAAGGG + Intronic
1196550168 X:117015132-117015154 CCTGGAGGTTGGAGGGTGGAAGG + Intergenic
1196823012 X:119718404-119718426 CTTTGAGAGGCCAAGGTGGAAGG + Intergenic
1196988072 X:121296520-121296542 CTTGGAGGTGAGCAGGAGGATGG + Intergenic
1197088139 X:122503675-122503697 ATTAGAGAGGGGAAAGTGGAAGG - Intergenic
1197677469 X:129346093-129346115 ATTGCAAAAGGGAAGGTGGATGG + Intergenic
1198119602 X:133579068-133579090 CTTGGAGATGAGAAAGAGCACGG - Intronic
1198241469 X:134791447-134791469 CTTGGAGAGGGGAAGGAAAAGGG + Intronic
1199550250 X:149053648-149053670 CTAGGACAGGGGGAGGTGGAAGG - Intergenic
1199681431 X:150227320-150227342 CTTGGAGGTAGGAAGTTTGAGGG + Intergenic
1200619054 Y:5417411-5417433 CTTGGAGATAGAAAGGTGAGAGG + Intronic
1200808388 Y:7456737-7456759 CTTTGGGATGGCAAGGTGGGAGG - Intergenic
1201282384 Y:12352875-12352897 CTTGGAGAGGGGAATTTGGCAGG - Intergenic
1201413999 Y:13729636-13729658 CTGGGGGATGGGCAGGGGGAAGG - Intergenic
1201481148 Y:14440896-14440918 CTTTGAGAGGCCAAGGTGGAAGG - Intergenic
1201600161 Y:15719566-15719588 CTTTGAGAGGCCAAGGTGGATGG - Intergenic
1201609230 Y:15822619-15822641 CTTGGCAATGGGAAGGTCAATGG + Intergenic