ID: 1157327112

View in Genome Browser
Species Human (GRCh38)
Location 18:46677323-46677345
Sequence CTCCATTGGGTGCCTGACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157327106_1157327112 -6 Left 1157327106 18:46677306-46677328 CCATTGGGTGCCGTTCCCTCCAT 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1157327112 18:46677323-46677345 CTCCATTGGGTGCCTGACCAAGG 0: 1
1: 0
2: 2
3: 13
4: 134
1157327104_1157327112 -2 Left 1157327104 18:46677302-46677324 CCCTCCATTGGGTGCCGTTCCCT 0: 1
1: 0
2: 1
3: 4
4: 108
Right 1157327112 18:46677323-46677345 CTCCATTGGGTGCCTGACCAAGG 0: 1
1: 0
2: 2
3: 13
4: 134
1157327105_1157327112 -3 Left 1157327105 18:46677303-46677325 CCTCCATTGGGTGCCGTTCCCTC 0: 1
1: 0
2: 0
3: 9
4: 77
Right 1157327112 18:46677323-46677345 CTCCATTGGGTGCCTGACCAAGG 0: 1
1: 0
2: 2
3: 13
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157327112 Original CRISPR CTCCATTGGGTGCCTGACCA AGG Intronic
900410108 1:2508549-2508571 CTCTATTTGGTGCGTGCCCACGG + Exonic
900673281 1:3869009-3869031 CACCACTGCCTGCCTGACCAGGG + Intronic
902040004 1:13485691-13485713 CTCCATTGGTGGCCTGAGCCTGG + Intronic
903472675 1:23598448-23598470 CTCCATGGGGTGCCAGGCCCAGG - Intronic
903781588 1:25823443-25823465 TTCCCTTGGGTGGCTGGCCAGGG + Intronic
904027880 1:27516040-27516062 CTCCACTAGGTGCCTCCCCATGG - Intergenic
904264753 1:29311784-29311806 CTGCAGAGGGTGCCTGAGCAGGG + Intronic
904288630 1:29469742-29469764 CTCCATGGGGTTCATCACCAAGG + Intergenic
905935612 1:41821762-41821784 GTCCTTTGGCTGCCTGAGCAAGG + Intronic
908018836 1:59878553-59878575 CTCCAGTGGCTGCTTGATCACGG + Intergenic
908790964 1:67780926-67780948 CTCCTTTGGCTGCCTGGACATGG + Intronic
915876580 1:159617041-159617063 CTCAAGTGGGTCCCTGACCCAGG + Intergenic
917021624 1:170594512-170594534 TTTCAGTGGGGGCCTGACCAAGG - Intergenic
917232737 1:172855729-172855751 CTCAAGTGGGTCCCTGACCCTGG - Intergenic
919273351 1:195379963-195379985 CTCCTTAGGGTGCCTTGCCAGGG + Intergenic
920432796 1:205929412-205929434 CACCTTTGGGTGTCTGACCCAGG + Intronic
1065271679 10:24039469-24039491 CTCAATTGTGTGGCTGACAAGGG - Intronic
1072211294 10:93249090-93249112 CTCCCCAGGGTGCCAGACCAGGG - Intergenic
1076246312 10:128950167-128950189 CTCCAGTGGGGGCCTTCCCATGG - Intergenic
1076781824 10:132728796-132728818 CTCCAGTGCGTGCCTCACCACGG - Intronic
1076790841 10:132775876-132775898 CTCCATGGGGTGCATGAGGAGGG + Intronic
1077145276 11:1041705-1041727 CTCTCCTGGGTGCCTGCCCAAGG - Intergenic
1077232570 11:1464604-1464626 CTCCATGGGGAGCCTGCCCTGGG + Intergenic
1082640903 11:55659135-55659157 CTCCACTGAGTGACTGACCAGGG - Intergenic
1083510280 11:63202825-63202847 CTCAAGTGGGTCCCTGACCCCGG + Intronic
1084701404 11:70788598-70788620 CCCCATTGGGTGCCTGAAATGGG - Intronic
1085043845 11:73342360-73342382 CTCCCTTGGGTGGAAGACCAGGG + Intronic
1085337319 11:75706183-75706205 CTCCAAAGCTTGCCTGACCACGG + Intergenic
1088907201 11:114163728-114163750 CTCCATATGGTGCCTTAGCAGGG + Intronic
1090416947 11:126547281-126547303 CCCCTTTGGGTGGCTTACCATGG + Intronic
1090522436 11:127493692-127493714 CTCCACTGGGTCCCTGGCCTTGG + Intergenic
1091181068 11:133605262-133605284 CTCCAGTGGGTCCCTGGTCAAGG - Intergenic
1091222414 11:133937144-133937166 CGCCATGTGGTGCCTGGCCACGG + Intronic
1096529850 12:52235631-52235653 CTCCTTTGGGTGTCTGACCAAGG + Intronic
1097333011 12:58352787-58352809 CTAGATTGAGTGCCTGATCATGG - Intergenic
1099030897 12:77524453-77524475 CTCAAGTGGGTCCCTGACCCCGG + Intergenic
1099527729 12:83736196-83736218 CTCAAGTGGGTCCCTGACCCCGG - Intergenic
1101524826 12:105519303-105519325 CTCAAGTGGGTCCCTGACCCCGG - Intergenic
1102215785 12:111160628-111160650 CTCCATTGGCTCCCTGGACATGG - Intronic
1102867702 12:116387090-116387112 CTGCATTGGGAGCCTGGCCAAGG - Intergenic
1104665320 12:130643460-130643482 TCCCATGGGGTGCCTGTCCATGG - Intronic
1105024796 12:132840710-132840732 CTCCCTTGTGTGAGTGACCACGG - Intronic
1107985847 13:45775576-45775598 CTCCCCTGGCTGCCTGAGCAGGG - Intergenic
1108166717 13:47700936-47700958 CCGCATTGGTTCCCTGACCATGG + Intergenic
1108306987 13:49147255-49147277 TTCCATTTGCAGCCTGACCAGGG + Intronic
1109955669 13:69562623-69562645 CTGCATTGGGTGGCTGAGCACGG + Intergenic
1110056918 13:70985447-70985469 CTCCATGAGGTCCCTGCCCATGG + Intergenic
1111071324 13:83171842-83171864 CTCAAGTGGGTCCCTGACCCCGG + Intergenic
1115907192 14:38212529-38212551 CTACATTGGAAGCCTGAGCAGGG + Exonic
1118498513 14:66333407-66333429 CTCAAGTGGGTCCCTGACCCTGG + Intergenic
1121921149 14:97882813-97882835 CTCCATTGGTTGTATGAACATGG + Intergenic
1122459259 14:101881823-101881845 ATCCAGTGGGTGCAAGACCAAGG - Intronic
1122521249 14:102345373-102345395 GTGCCGTGGGTGCCTGACCAGGG - Intronic
1130432393 15:83861340-83861362 CTCAAGTGGGTCCCTGACCCCGG + Intronic
1134239691 16:12496408-12496430 CTCCATTGAGTGCCTCACAATGG - Intronic
1139370705 16:66467722-66467744 CTCCAGTGCGTGCCTCTCCAGGG + Intronic
1142045787 16:87924486-87924508 CTCCATGGGGTGCCTCTCCCCGG + Intronic
1143290814 17:5826646-5826668 CTCCATTGAGTTCAGGACCAGGG + Intronic
1149721717 17:58851720-58851742 CTCAAGTGGGTCCCTGACCCAGG - Intronic
1152460465 17:80439540-80439562 CTCCACTCGGGGCCTGGCCAGGG - Intergenic
1154509231 18:15077693-15077715 CTCCATTGGCTGCCTTACAATGG - Intergenic
1157327112 18:46677323-46677345 CTCCATTGGGTGCCTGACCAAGG + Intronic
1161458975 19:4385330-4385352 CTTCATGAGGTGCCTGAACAAGG + Intronic
1163827887 19:19533742-19533764 CTCCTTTGGGCGCCTCACCCGGG - Intronic
1164832787 19:31335437-31335459 TTCCAGTAGATGCCTGACCAGGG - Intronic
1165041360 19:33070123-33070145 CCCAGTTGGGTGCCTGTCCAGGG + Intergenic
1165148919 19:33749769-33749791 CTCCCTTTGGAGCCTGACCCTGG - Intronic
1165810314 19:38607972-38607994 CTCCCTGGGGTCCCTGACCTGGG + Exonic
925351114 2:3201226-3201248 CATCTTTGGGTGCCTGATCAGGG - Intronic
929566577 2:42990160-42990182 CTCAAGTGGGTCCCTGACCCCGG + Intergenic
929595042 2:43170502-43170524 CTCCTTTGCGAGCCTCACCAAGG + Intergenic
929961258 2:46497942-46497964 CTCCATGGGGTGCCTCTCAAGGG - Intronic
931455665 2:62408007-62408029 CTCCAGTGTGTGCCTGAGCCTGG + Intergenic
931977104 2:67654751-67654773 CTCAAGTGGGTCCCTGACCCCGG + Intergenic
933391510 2:81674837-81674859 CTCCTATGGGTGCTTGGCCATGG - Intergenic
935331437 2:101980374-101980396 CTCCCCTGGGTGCCTGGCCCTGG + Intergenic
938221220 2:129569501-129569523 CTCAAGTGGGTCCCTGACCCCGG + Intergenic
939151233 2:138475368-138475390 CTCCATTAGTTGCCTGACAAAGG + Intergenic
941593387 2:167447301-167447323 CTCAAGTGGGTCCCTGACCCCGG - Intergenic
1168806822 20:676501-676523 CTCCAGTGGGAGCCCGAGCAGGG - Intergenic
1173345033 20:42191490-42191512 CTCCATTTGGTCCATGCCCACGG - Intronic
1174191623 20:48744629-48744651 GTCCAGTGGGTGCCTGAGCCGGG + Intronic
1174495699 20:50940325-50940347 CTGCTTTGTGTGACTGACCATGG - Intronic
1175502006 20:59457122-59457144 CTCCATTTGGGGCCTGCCCTGGG - Intergenic
1175983662 20:62753762-62753784 CTCCATTGGAAGCCGGGCCATGG + Intronic
1176788838 21:13294115-13294137 CTCCATTGGCTGCCTTACAATGG + Intergenic
1177988001 21:28002256-28002278 CTCCATTGGCTGCCTTACAATGG + Intergenic
1179292138 21:40028181-40028203 CTCAAGTGGGTCCCTGACCCCGG - Intronic
1179292900 21:40033851-40033873 CTCAAGTGGGTCCCTGACCCCGG + Intronic
1179373809 21:40830928-40830950 CTCCATGGGATCCCTGGCCAAGG + Intronic
1179805608 21:43835282-43835304 CTCCATTGCGCCCCCGACCAGGG + Intergenic
1180224892 21:46386470-46386492 CTCCATTGGGAGCCTGTGCCTGG + Intronic
1180245874 21:46546831-46546853 CTTCTTGGGGGGCCTGACCATGG + Intronic
1183030231 22:35098291-35098313 CTGCATGGGGTTCCTGTCCATGG + Intergenic
1183580991 22:38726665-38726687 CTCCCTCTGGTGCCTGAGCAGGG + Intronic
951897553 3:27624661-27624683 CTTCATTTGGTGGATGACCATGG - Intergenic
957292768 3:78297951-78297973 ATCCATTATGTGCCAGACCAAGG - Intergenic
961638522 3:128350016-128350038 CGCCAGTGGGTGCCAGACCCAGG - Intronic
966309483 3:178577012-178577034 CTCAAGTGGGTCCCTGACCCCGG + Intronic
975518127 4:75269291-75269313 CTCAAATGGGTCCCTGACCCCGG + Intergenic
981232825 4:142378371-142378393 CACCAATGGGTGCCCGAGCAAGG - Intronic
981859789 4:149341006-149341028 CTCAAGTGGGTCCCTGACCCCGG - Intergenic
982581123 4:157180208-157180230 CTCAAGTGGGTTCCTGACCCCGG - Intergenic
985334882 4:188881607-188881629 GTCCTTCGGGTGCCTGAGCAGGG + Intergenic
987302806 5:16611524-16611546 CTCCATTCTGTGCCTATCCAAGG + Intronic
991105502 5:62837789-62837811 CTCAAGTGGGTCCCTGACCCCGG + Intergenic
992608869 5:78490322-78490344 CTGCAGTGGGTGCCTCACCCTGG + Intronic
994387269 5:99146896-99146918 CTCAAGTGGGTCCCTGACCCCGG + Intergenic
997579105 5:135006056-135006078 ATCCAATGGGGGCCAGACCATGG + Intronic
998700715 5:144696365-144696387 CTCAATTGAATGACTGACCAGGG + Intergenic
1000145136 5:158446658-158446680 CTCAAGTGGGTGCCTGACCCCGG - Intergenic
1002100605 5:176855770-176855792 CTCCATGGGGAGGCTGCCCAGGG + Intronic
1003104531 6:3205234-3205256 CTCCATGGTCTGCCTGACAATGG + Intergenic
1004097166 6:12568144-12568166 CTTCATCGGCTGCCTGACCAAGG - Intergenic
1006258082 6:32846918-32846940 TTCCATTGGATGCCTCCCCAAGG - Intronic
1006316891 6:33296699-33296721 ATCCAGTAGGTGTCTGACCAGGG + Exonic
1015050132 6:128830152-128830174 CTCAAGTGGGTCCCTGACCCCGG + Intergenic
1015792212 6:136974950-136974972 GTCCTCTGGGTGCATGACCAGGG + Intergenic
1018424344 6:163667150-163667172 CCCCACTGTGTGCCTGCCCAGGG + Intergenic
1019596450 7:1860629-1860651 CTCCCTTGGGTGCCTAACCGAGG + Intronic
1023869717 7:44256739-44256761 CTCCAAGGGGTGCCTCACTAGGG + Intronic
1028078696 7:86547729-86547751 CTCAAGTGGGTCCCTGACCCTGG - Intergenic
1028465667 7:91148678-91148700 CTCCTGGGTGTGCCTGACCATGG - Intronic
1034028789 7:147737462-147737484 CTCAAGTGGGTCCCTGACCCAGG - Intronic
1035710818 8:1712549-1712571 CTCAACTGGGTCCCTGACCCTGG + Intergenic
1036559185 8:9887195-9887217 CTCCAACGGGCTCCTGACCAGGG + Intergenic
1038940030 8:32294119-32294141 CTCCGTAGGATGCCTGTCCACGG + Intronic
1039112510 8:34055468-34055490 CTCAAGTGGGTCCCTGACCCCGG + Intergenic
1039289177 8:36075437-36075459 CTGCATTGGGTGCCTGGCCAAGG + Intergenic
1039801853 8:40964687-40964709 CTCAACTGGGTCCCTGACCCTGG + Intergenic
1039834755 8:41247648-41247670 CTCCATTGGATCCCTGTCCTGGG - Intergenic
1042023006 8:64390345-64390367 CCCCTTTGGATGACTGACCAAGG - Intergenic
1042394554 8:68276989-68277011 CTCAAGTGGGTCCCTGACCCCGG + Intergenic
1044546624 8:93467009-93467031 CTCAAGTGGGTCCCTGACCCCGG + Intergenic
1049964670 9:767408-767430 CTCAAGTGGGTCCCTGACCTCGG + Intergenic
1050374117 9:4953146-4953168 CTCAAGTGGGTCCCTGACCCCGG - Intergenic
1051809227 9:21031409-21031431 CTCCAAGGGGTGCCTGGGCACGG + Intronic
1052951530 9:34217170-34217192 CTCCATTCTCTGACTGACCAAGG - Intronic
1056911969 9:90709286-90709308 CTCCACTGGGTGGCTGCCCGGGG + Intergenic
1060737290 9:126074146-126074168 CTCCAGTGGGTGTCTGTCCTGGG - Intergenic
1061715123 9:132514135-132514157 CTCCCCTGTGTCCCTGACCACGG + Intronic
1062319239 9:135982344-135982366 CTCCAGCAGGTGCCTGACCATGG + Intergenic
1186728365 X:12381830-12381852 CACCATTGGGTTCCAGGCCATGG - Intronic
1186759084 X:12704242-12704264 CTCCATTCTCTGCCTCACCAAGG + Intronic
1189065034 X:37798486-37798508 CTATAGTGGGTGCCTGGCCAAGG + Intronic
1190358164 X:49625493-49625515 CTCAAGTGGGTCCCTGACCCCGG - Intergenic
1190966090 X:55303083-55303105 CTCAAGTGGGTCCCTGACCCCGG - Intergenic
1191704889 X:64084298-64084320 CTCAAGTGGGTACCTGACCCCGG - Intergenic
1193299877 X:79877417-79877439 CTCCCTAGGTTGCATGACCAAGG - Intergenic
1195522514 X:105847855-105847877 CTCCATGAGGTGAGTGACCAGGG + Intronic