ID: 1157327394

View in Genome Browser
Species Human (GRCh38)
Location 18:46678953-46678975
Sequence GAGAAGTCCCGCCTTCACAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 88}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157327393_1157327394 -8 Left 1157327393 18:46678938-46678960 CCTGGGGTCTGCTGTGAGAAGTC 0: 1
1: 0
2: 0
3: 15
4: 165
Right 1157327394 18:46678953-46678975 GAGAAGTCCCGCCTTCACAGCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1157327391_1157327394 -2 Left 1157327391 18:46678932-46678954 CCAGGCCCTGGGGTCTGCTGTGA 0: 1
1: 0
2: 1
3: 44
4: 463
Right 1157327394 18:46678953-46678975 GAGAAGTCCCGCCTTCACAGCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1157327381_1157327394 18 Left 1157327381 18:46678912-46678934 CCCAGCTGACTGCCCCAAGCCCA 0: 1
1: 0
2: 1
3: 20
4: 279
Right 1157327394 18:46678953-46678975 GAGAAGTCCCGCCTTCACAGCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1157327392_1157327394 -7 Left 1157327392 18:46678937-46678959 CCCTGGGGTCTGCTGTGAGAAGT 0: 1
1: 0
2: 1
3: 24
4: 206
Right 1157327394 18:46678953-46678975 GAGAAGTCCCGCCTTCACAGCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1157327390_1157327394 -1 Left 1157327390 18:46678931-46678953 CCCAGGCCCTGGGGTCTGCTGTG 0: 1
1: 0
2: 4
3: 49
4: 532
Right 1157327394 18:46678953-46678975 GAGAAGTCCCGCCTTCACAGCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1157327388_1157327394 5 Left 1157327388 18:46678925-46678947 CCCAAGCCCAGGCCCTGGGGTCT 0: 1
1: 0
2: 4
3: 51
4: 462
Right 1157327394 18:46678953-46678975 GAGAAGTCCCGCCTTCACAGCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1157327389_1157327394 4 Left 1157327389 18:46678926-46678948 CCAAGCCCAGGCCCTGGGGTCTG 0: 1
1: 0
2: 9
3: 88
4: 865
Right 1157327394 18:46678953-46678975 GAGAAGTCCCGCCTTCACAGCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1157327382_1157327394 17 Left 1157327382 18:46678913-46678935 CCAGCTGACTGCCCCAAGCCCAG 0: 1
1: 0
2: 2
3: 45
4: 369
Right 1157327394 18:46678953-46678975 GAGAAGTCCCGCCTTCACAGCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1157327380_1157327394 24 Left 1157327380 18:46678906-46678928 CCTAAGCCCAGCTGACTGCCCCA 0: 1
1: 0
2: 3
3: 36
4: 316
Right 1157327394 18:46678953-46678975 GAGAAGTCCCGCCTTCACAGCGG 0: 1
1: 0
2: 0
3: 6
4: 88
1157327387_1157327394 6 Left 1157327387 18:46678924-46678946 CCCCAAGCCCAGGCCCTGGGGTC 0: 1
1: 0
2: 3
3: 56
4: 457
Right 1157327394 18:46678953-46678975 GAGAAGTCCCGCCTTCACAGCGG 0: 1
1: 0
2: 0
3: 6
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157327394 Original CRISPR GAGAAGTCCCGCCTTCACAG CGG Intronic
900002377 1:21775-21797 GCGAAGGCCGGCCTGCACAGGGG - Intergenic
900022096 1:192299-192321 GCGAAGGCCGGCCTGCACAGGGG - Intergenic
900675924 1:3886226-3886248 GGGAAGTCCTTCCTTCTCAGCGG + Intergenic
900780978 1:4617043-4617065 TAGAGGTCCCCCCCTCACAGTGG + Intergenic
901139433 1:7018925-7018947 GAGAAGGCCCGTCTGCAGAGGGG + Intronic
903935155 1:26890326-26890348 AGGAAGTCCCGCCCTCACGGCGG + Intergenic
904402507 1:30266064-30266086 GAGAACTCCTGCCTTCAGAAAGG - Intergenic
909013638 1:70360585-70360607 GAGTAACCCCTCCTTCACAGGGG - Intronic
915545858 1:156597358-156597380 GAGAAGTCCATCCTCCACAAAGG + Intronic
917593913 1:176508026-176508048 GAGAAGTCATGCCTTCATAGTGG + Intronic
918825422 1:189317102-189317124 GGGAAGTCCTGCCTACTCAGGGG + Intergenic
922324979 1:224519463-224519485 GAGAACTCCCGCAATCATAGAGG - Intronic
923494764 1:234514397-234514419 GAGGAGGCCCACCTTCTCAGTGG - Intergenic
1065366458 10:24942015-24942037 AAGAAGTCCCACCCTCACAGAGG - Intronic
1070074336 10:73120602-73120624 GTGAATTCCAGCCTCCACAGAGG + Intronic
1072413695 10:95229641-95229663 AAGAAGTACAGCTTTCACAGAGG - Intergenic
1075273694 10:121075376-121075398 CAGAAGTTCTGCCTTCTCAGTGG - Intergenic
1079262790 11:18899763-18899785 GAGAAGTCCCTCCTTTTCAGTGG - Intergenic
1081977441 11:47244734-47244756 GAGAAGGCCCGGCTTCAGGGGGG - Exonic
1083198436 11:61104864-61104886 CAGCATTCCTGCCTTCACAGAGG + Intronic
1084646660 11:70463133-70463155 GAGAAGTCCCTCCTTCAGTGTGG - Intergenic
1087230640 11:95658034-95658056 GAGGAGAACCGACTTCACAGAGG + Intergenic
1089316538 11:117594930-117594952 GAGGAGTCCCTTCTTGACAGAGG - Intronic
1091347507 11:134864941-134864963 GAGAAGCCTCACCTTGACAGGGG + Intergenic
1091375795 12:23837-23859 GCGAAGGCCGGCCTGCACAGGGG - Intergenic
1092300247 12:7241453-7241475 AAGAAGTACAGCTTTCACAGAGG - Intergenic
1116257258 14:42571609-42571631 GAGAAGACCTGCCAGCACAGAGG + Intergenic
1116529205 14:45946801-45946823 GAGAAGTCAAGCCTTAACAAAGG + Intergenic
1129274893 15:74438526-74438548 GAGAAGTTCTCCATTCACAGTGG - Intergenic
1132451135 15:101969164-101969186 GCGAAGGCCGGCCTGCACAGGGG + Intergenic
1132657811 16:1048651-1048673 GCGGAGTCCCGCACTCACAGGGG + Intergenic
1139943223 16:70621086-70621108 GACAAGTCCCGCTTTCCTAGGGG - Intronic
1141645662 16:85366112-85366134 GCGCAGTCCCGCCTTCCCGGCGG - Intergenic
1144783473 17:17819365-17819387 GAGACCTGCCGCCTTCACAGTGG + Exonic
1148195336 17:45709001-45709023 GAGAGCTCCCGCCTTGAGAGTGG + Intergenic
1148721095 17:49753925-49753947 GAGTAGTTCCGTGTTCACAGAGG - Intronic
1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG + Intronic
1152574150 17:81132803-81132825 GGGAAGTCCTGCCTCCACACTGG - Intronic
1157006394 18:43589510-43589532 GTGAAGACCCGCCTGCAGAGAGG - Intergenic
1157327394 18:46678953-46678975 GAGAAGTCCCGCCTTCACAGCGG + Intronic
1160533309 18:79577786-79577808 GAGGAGTCTCTCCTTGACAGGGG - Intergenic
1160634129 19:63383-63405 GCGAAGGCCGGCCTGCACAGGGG - Intergenic
1167758834 19:51430553-51430575 GAGTAGTCCCCCATCCACAGTGG + Intergenic
929601750 2:43208759-43208781 GATTAATCCCTCCTTCACAGGGG + Intergenic
931719356 2:65056207-65056229 AAGAAGTCCCGGCTTCCCATAGG + Intergenic
931871051 2:66459974-66459996 GATAATTCCCTCCTCCACAGTGG - Intronic
936567350 2:113591645-113591667 GCGAAGGCCGGCCTGCACAGGGG + Intergenic
937062441 2:118990675-118990697 GGGAAGGCCTGCCTTCTCAGAGG + Intronic
938615827 2:132997243-132997265 GAGAAATTCTGCCTTTACAGAGG + Intronic
942594498 2:177580173-177580195 GAGTAGTCCCTCCTTCATAGCGG - Intergenic
946102279 2:217336195-217336217 GAGAGGTCCCGCATCCACTGAGG - Intronic
1171238974 20:23549872-23549894 GAGAAGAACTGACTTCACAGCGG + Intergenic
1175775140 20:61648367-61648389 GAGAAATCCTGTCTGCACAGAGG - Intronic
1181851665 22:25754110-25754132 GAGAATTCTGGCCTTCATAGGGG + Intronic
1183713699 22:39521270-39521292 GAGAAGTCCCGCCTCATAAGTGG + Exonic
1185354714 22:50361035-50361057 GAGAAGTCAAGTCTTCAAAGTGG - Intronic
950586875 3:13898773-13898795 CTGAAATCCAGCCTTCACAGAGG + Intergenic
950652854 3:14418303-14418325 GCCTAGTCCCGGCTTCACAGGGG - Intronic
969903864 4:10374779-10374801 GAGAAGCTCCTCTTTCACAGTGG - Intergenic
973331534 4:48914584-48914606 GGGAAGACTCGCTTTCACAGAGG + Intergenic
975847643 4:78541773-78541795 GAGAACTCCCTCCTACAAAGGGG + Intronic
976679958 4:87745661-87745683 GTGAAGCCCCGCCTTCAGACTGG - Intergenic
979193742 4:117895230-117895252 GAGAAGACCAGCCTTCACCATGG + Intergenic
979596622 4:122541791-122541813 GAGAAGTCCTGCCATCCCTGGGG + Intergenic
983835665 4:172380331-172380353 TAAAAGTCCCTCCCTCACAGTGG + Intronic
988850506 5:35175700-35175722 GAGAAGACCAGTCTTCACACTGG - Intronic
989520703 5:42396844-42396866 GAGAAGACCTGCCTGCAGAGAGG + Intergenic
989766926 5:45098140-45098162 GAGAAGTCCACTCTTCACTGTGG - Intergenic
992516116 5:77493681-77493703 GATAAGTCCCTCTTTCCCAGGGG - Intronic
999802830 5:155053657-155053679 GACAGGTCCCTGCTTCACAGAGG - Intergenic
1000752784 5:165117413-165117435 GAGAACTCACTCCTTAACAGGGG + Intergenic
1002447854 5:179301033-179301055 GAGGAGTCCAGGCTTCACTGAGG - Intronic
1012628621 6:101434790-101434812 GAGAAGTGCCCCATTTACAGTGG - Intronic
1019540328 7:1548330-1548352 GAGAGGTCCCGCCAGCACGGGGG - Intronic
1020226616 7:6285310-6285332 TAGAAGCCCCAACTTCACAGGGG + Intergenic
1021511594 7:21439108-21439130 GAGCAGTCCCCCCTTATCAGAGG - Intronic
1023368267 7:39486943-39486965 GAGCAGTACCGCCTTCACCAGGG - Intronic
1023789182 7:43738116-43738138 GAGAAGACCTGCCTACAGAGAGG + Intergenic
1026420903 7:70235925-70235947 CAGATGTCCTGTCTTCACAGGGG + Intronic
1035743206 8:1944332-1944354 GAGGACTCCAGCCTACACAGGGG - Intronic
1037734897 8:21557926-21557948 TAGAAGTCCTTCCTGCACAGTGG - Intergenic
1037873360 8:22521228-22521250 AGGAAGTCCTGCCTTAACAGGGG - Intronic
1038003507 8:23410510-23410532 GAGAACTCCCGCCTCCTCCGAGG + Intronic
1039156496 8:34564488-34564510 GAGAAGACCCCCCTCCACATGGG + Intergenic
1045064716 8:98435157-98435179 CAGAAGTCCTGTCTTCACAAAGG - Intronic
1048447403 8:134502256-134502278 GAGAAGTCCCTTCTGCAGAGCGG + Intronic
1049885183 9:21888-21910 GCGAAGGCCGGCCTGCACAGGGG - Intergenic
1055332420 9:75197908-75197930 AAGACGTCCCTCCTACACAGTGG - Intergenic
1055620974 9:78124951-78124973 CAGTAGTTCCTCCTTCACAGTGG + Intergenic
1060113972 9:120926650-120926672 GAGAAGTCACTTCCTCACAGTGG + Exonic
1061867918 9:133504567-133504589 GAGACGGCAAGCCTTCACAGCGG - Intergenic
1185526092 X:781412-781434 GAGGAATCCGGCTTTCACAGGGG + Intergenic
1190939193 X:55024586-55024608 GAGAAGTCCAGTCTTTCCAGGGG - Intronic
1193468713 X:81875220-81875242 GAGATGACCTGCCTTCAGAGAGG - Intergenic
1201144211 Y:11054039-11054061 GAAAAGTCTGGACTTCACAGCGG + Intergenic