ID: 1157328021

View in Genome Browser
Species Human (GRCh38)
Location 18:46682920-46682942
Sequence TGCAGAACTGCATTCCTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 857
Summary {0: 1, 1: 1, 2: 22, 3: 119, 4: 714}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157328021 Original CRISPR TGCAGAACTGCATTCCTTTC TGG (reversed) Intronic
900545147 1:3224630-3224652 TGCAGAACTGTGTTCCCCTCTGG + Intronic
900715677 1:4141954-4141976 CGCAGAGCTGCCTTCCTTTCTGG - Intergenic
901036815 1:6341183-6341205 TGCACCACTGCATTCCAGTCTGG - Intronic
902525809 1:17056534-17056556 TCTAGAAATACATTCCTTTCAGG - Intergenic
902540959 1:17154408-17154430 GGCAGGGCTGCATTCCTTTCAGG + Intergenic
902750560 1:18506631-18506653 GGCAGGACTGCTTTCTTTTCTGG + Intergenic
903510373 1:23870146-23870168 TGCAGCACTGCATTCCAGCCTGG - Intergenic
903624107 1:24719016-24719038 TGCACCACTGCATTCCATCCTGG - Intergenic
903629079 1:24752764-24752786 TGCACCACTGCATTCCAGTCTGG - Intronic
904083985 1:27890756-27890778 TGCACAACTGCATTCCAGCCTGG - Intergenic
904510199 1:30999042-30999064 TGCAGTACTGCATTCTAGTCAGG - Intronic
904965338 1:34368419-34368441 AGCAGGGCTGCATTTCTTTCTGG + Intergenic
905127820 1:35728125-35728147 TGCAGCATTGCATTCCAGTCTGG - Intronic
905156768 1:35990462-35990484 TGCACCACTGCATTCCAGTCTGG + Intronic
905331831 1:37208506-37208528 TGAGGAACTGCGTTCCTTTGGGG - Intergenic
905374629 1:37511200-37511222 TGGAGTACTCCATTGCTTTCTGG - Intronic
905973321 1:42156912-42156934 TGCAGCACTGCACTCCATCCTGG + Intergenic
906061114 1:42949202-42949224 TGCACGACTGCATTCCAGTCTGG + Intronic
906389343 1:45400328-45400350 AGCAGGGCTGCATTCCTCTCTGG - Intronic
907380025 1:54079459-54079481 GATAGGACTGCATTCCTTTCTGG + Intronic
907671695 1:56479530-56479552 TGCGCCACTGCATTCCTTCCTGG + Intergenic
907969341 1:59365526-59365548 TGCAGAAGTGCATTTCTTACTGG - Intronic
908786414 1:67738833-67738855 TGTATCACTGCATTCCATTCTGG + Intronic
909381341 1:75002389-75002411 AGCAGGGCTGCATTTCTTTCTGG + Intergenic
909441887 1:75705719-75705741 TGCACCACTGCATTCCAGTCTGG - Intergenic
909815172 1:79983853-79983875 TGCACCACTGCACTCCATTCTGG - Intergenic
909868990 1:80714776-80714798 GACAGGACTGAATTCCTTTCTGG + Intergenic
909903359 1:81165943-81165965 TGCTATACTGCTTTCCTTTCTGG - Intergenic
910053043 1:82998828-82998850 AGCAGGACTGTGTTCCTTTCTGG + Intergenic
910113030 1:83702152-83702174 GGCAGGGCTGCATTCCCTTCTGG + Intergenic
910332071 1:86085161-86085183 TGAAGAACTGCATACTTTTGGGG + Intronic
910576287 1:88768321-88768343 GGCAGGACTGCATTCCCTTCTGG + Intronic
910752801 1:90652744-90652766 TGCTGAAATGCAGTCCTTTCTGG + Intergenic
911127450 1:94353647-94353669 TGCAGCACTGCATTCCAGCCTGG - Intergenic
911640147 1:100279734-100279756 TGCACCACTGCATTCCAGTCTGG + Intronic
912058815 1:105638789-105638811 TGCAGTGCTGCGTTTCTTTCGGG - Intergenic
912639396 1:111330783-111330805 TGCTGAACTGCATCTCTTTGGGG - Intergenic
912718766 1:112002392-112002414 TGAAGATCTGCATTGCTCTCAGG - Intergenic
912794517 1:112683992-112684014 TGCAGATCTGCACTCCAGTCTGG - Intronic
914319771 1:146548016-146548038 AGCAGGGCTGCATTCCCTTCTGG + Intergenic
914331287 1:146673106-146673128 AGCCGAGCTGCATTCCTTTCGGG + Intergenic
914394032 1:147247735-147247757 AGCAGAGCTGCATTCCTTTCTGG + Intronic
915149987 1:153822854-153822876 TGCACCACTGCACTCCTTCCTGG - Intronic
916235726 1:162585992-162586014 TTAAGAACTGTGTTCCTTTCAGG + Intronic
916396555 1:164395198-164395220 TGCACCACTGCATTCCCTCCTGG + Intergenic
916949319 1:169762838-169762860 TACAGAGCTGTGTTCCTTTCTGG - Intronic
916964094 1:169917491-169917513 AGCAGAACTGCACTCCTATTTGG - Intergenic
917976364 1:180241859-180241881 TGCACTACTGCATTCCAGTCTGG - Intronic
918190940 1:182173972-182173994 TCCAGAACTTCTTTCTTTTCAGG + Intergenic
918397275 1:184126881-184126903 TGCACCACTGCATTCCAATCTGG - Intergenic
918548143 1:185708480-185708502 TGAGGAACTGCGTTCCTTTGGGG - Intergenic
918574066 1:186034260-186034282 AGCAGAGCTGAATTCCCTTCTGG - Intronic
919071046 1:192754996-192755018 TGCACGACTGCATTCCATCCTGG + Intergenic
919774589 1:201185756-201185778 TGCAGACCTGCCTCCCTTGCTGG + Intergenic
919868315 1:201800870-201800892 TGCATAACTACATTCCATCCAGG - Intronic
920285715 1:204877867-204877889 AGCAGAAATGCATTCCACTCCGG - Intronic
920447842 1:206033389-206033411 TGGTGAACTGCATTCCTTTCTGG + Intergenic
920662859 1:207932649-207932671 AGCAAAACTGCATTCATTTGGGG - Intergenic
921222743 1:212985063-212985085 TGCACAACTGCATTCCAGCCTGG - Intronic
921668955 1:217905526-217905548 AGCAAAGATGCATTCCTTTCTGG - Intergenic
921910918 1:220547976-220547998 TGCAGAATTGCTTACCTTGCTGG + Intronic
922320630 1:224483304-224483326 TGCAGCACTGCACTCCAGTCTGG + Intronic
922856002 1:228775141-228775163 AGCAGGACTGCATTCCTTTCTGG + Intergenic
922957224 1:229613284-229613306 TGCATCACTGCATTCCAGTCTGG + Intronic
923038150 1:230300085-230300107 TGTAGGGCTGCAGTCCTTTCTGG + Intergenic
923344004 1:233033801-233033823 GGGAGAACTGGATACCTTTCAGG + Intronic
923452814 1:234135761-234135783 TGAACACCTGCTTTCCTTTCAGG - Intronic
923812744 1:237337958-237337980 GGCAGCACTGCATTGCTTCCAGG + Intronic
923925424 1:238621563-238621585 TACAGAGCTGCATTCTTTTCTGG - Intergenic
1062928040 10:1332370-1332392 TGCACCACTGCATTCCAGTCTGG + Intronic
1062931911 10:1358968-1358990 TGCTGAAAAGCATTCCTTTATGG + Intronic
1063123550 10:3121863-3121885 TGCAGCACTGCATTCCAGCCTGG - Intronic
1063481324 10:6379183-6379205 TGCACAACTGCATTCCATCCTGG + Intergenic
1063782906 10:9347361-9347383 TGAAGAACTTCATTTCTTGCAGG + Intergenic
1063811862 10:9720324-9720346 AACAGGGCTGCATTCCTTTCTGG - Intergenic
1064598106 10:16966490-16966512 TGCACCACTGCACTCCATTCTGG - Intronic
1064961890 10:20974295-20974317 TGCACCACTGCATTCCAGTCTGG - Intronic
1065400909 10:25300191-25300213 AGCAGGGCTGCATTCCTTTTTGG + Intronic
1065428864 10:25633319-25633341 TGCACAACTGCACTCCAGTCTGG - Intergenic
1065685456 10:28280099-28280121 TGCTGAACTGAATTCCTGGCTGG - Exonic
1065753069 10:28906197-28906219 TTGATAACTGCCTTCCTTTCAGG - Intergenic
1065859628 10:29861129-29861151 AGCTGGGCTGCATTCCTTTCTGG - Intergenic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1066063353 10:31743989-31744011 TGCACCACTGCATTCCAGTCTGG - Intergenic
1066292909 10:34030050-34030072 TGCACCACTGCACTCCTGTCTGG - Intergenic
1067361547 10:45585006-45585028 AGTAGGACTGCATTCTTTTCTGG - Intronic
1067409282 10:46050653-46050675 TGCAGCACTGCACTCCATCCTGG - Intergenic
1067522827 10:47021062-47021084 GGTAGGACTGCATTCTTTTCTGG + Intergenic
1068554208 10:58439966-58439988 GGCACAGCTGCATTCCTTTCTGG + Intergenic
1068611457 10:59064995-59065017 TTCAAAGCTGCATTACTTTCAGG + Intergenic
1069098632 10:64290644-64290666 CTCAAGACTGCATTCCTTTCTGG + Intergenic
1069446235 10:68475525-68475547 TGCAGTACTGCATTCCAGTCTGG - Intergenic
1069546365 10:69332025-69332047 TGCACCACTGCACTCCATTCTGG + Intronic
1070165574 10:73895276-73895298 TGCACCACTGCATTCCAGTCTGG - Intergenic
1071013853 10:80971272-80971294 TGCAGCACTACACCCCTTTCTGG - Intergenic
1072167976 10:92832319-92832341 TGCACCACTGCATTCCTGCCTGG - Intergenic
1072201980 10:93168440-93168462 TGCACCACTGCACTCCATTCTGG - Intergenic
1072364656 10:94696581-94696603 TGAGGAGCTGCATTCCTTTGGGG - Intronic
1072568095 10:96634837-96634859 GTCAGGGCTGCATTCCTTTCTGG + Intronic
1072572989 10:96674934-96674956 TGCAGAACTGCATTCCAGCCTGG - Intronic
1073612587 10:104959061-104959083 TGCAGGGCTGTTTTCCTTTCTGG - Intronic
1075149831 10:119917420-119917442 TGCACCACTGCATTCCAGTCTGG - Intronic
1075210273 10:120485072-120485094 AGCAAAGCTGCATTCCTTTCTGG - Intronic
1075280632 10:121135351-121135373 TGCTGGGATGCATTCCTTTCTGG + Intergenic
1075557020 10:123440742-123440764 TGCAAAATTGCATTTCATTCAGG + Intergenic
1075656657 10:124166341-124166363 TGCACCACTGCATTCCTGCCTGG + Intergenic
1075771129 10:124937228-124937250 TGCAGCACTGCACTCCAGTCTGG - Intergenic
1076797062 10:132803457-132803479 TGCAGACCTGCCTGTCTTTCTGG - Intergenic
1078120743 11:8506485-8506507 AGCGGGGCTGCATTCCTTTCTGG + Intronic
1078303056 11:10153563-10153585 TGGAGACCTTTATTCCTTTCTGG - Intronic
1078437771 11:11339598-11339620 TGGGGAACTGCATTACCTTCTGG - Intronic
1078508894 11:11970810-11970832 GGCAGGGCTGCATTCCTCTCTGG - Intronic
1078930577 11:15909417-15909439 AGCAGGGCTACATTCCTTTCTGG - Intergenic
1079387016 11:19989421-19989443 TGCAGGGCTACATTCATTTCTGG - Intronic
1079429372 11:20374424-20374446 GACAGAGCTGCATTCCTTTCTGG + Intronic
1079986588 11:27206551-27206573 GGCAGGACTGAATTCCTTTCTGG - Intergenic
1080291061 11:30671795-30671817 GGCAGAATTACATTCCTTTCTGG - Intergenic
1080353846 11:31418198-31418220 TGAAAAACTACATGCCTTTCAGG - Intronic
1080391416 11:31850588-31850610 TGCATCACTGCACTCCATTCTGG + Intronic
1080769893 11:35330829-35330851 AGCAGGGCTGCATTCTTTTCTGG - Intronic
1081188314 11:40072483-40072505 GGCAGAGCTGCTTTGCTTTCTGG - Intergenic
1081375405 11:42352328-42352350 AGCAGGGCTGCATTCCTTTCTGG - Intergenic
1081499499 11:43652406-43652428 TGCAGAACTGCTTGCTTGTCTGG - Intronic
1081759009 11:45564074-45564096 GGCCGGATTGCATTCCTTTCTGG + Intergenic
1081834744 11:46144246-46144268 TGCACAACTGCATTCCAGCCTGG + Intergenic
1082751904 11:57028617-57028639 AGCAGAGCTGTGTTCCTTTCTGG + Intergenic
1082836912 11:57657747-57657769 TGCGGAACTGCGTTTGTTTCCGG + Exonic
1083087583 11:60166212-60166234 TACAGAACTACTTTCCTCTCTGG - Intergenic
1083947803 11:65934716-65934738 TGCACAACTGCACTCCAGTCTGG + Intergenic
1084905997 11:72348012-72348034 GACAGAACTGTCTTCCTTTCTGG - Intronic
1085372493 11:76022008-76022030 TGCAGCACTGCATTCCAGCCTGG + Intronic
1085629902 11:78106239-78106261 CGCACCACTGCATTCCATTCTGG - Intronic
1085719016 11:78897059-78897081 TGAATAACTGCTTTCCTTTGGGG + Intronic
1085884344 11:80505183-80505205 AGCAGGACTGCATTCCTTTCTGG - Intergenic
1085977305 11:81674253-81674275 TGCAAAACTGTATTCCTTCTTGG + Intergenic
1086058045 11:82671407-82671429 TGGGGAAATGCATTCATTTCTGG + Intergenic
1086575504 11:88335535-88335557 TGCACAACTGCATTCCAACCTGG + Intronic
1086603341 11:88662897-88662919 TGGCGAACTGCATTTCTTTTTGG - Intronic
1087399227 11:97643691-97643713 TGCACCACTGCATTCCCGTCTGG - Intergenic
1088322716 11:108570051-108570073 CTCAGATCTGCTTTCCTTTCTGG - Intronic
1088344203 11:108804453-108804475 TGCACAACTGCATTCCAGCCTGG + Intronic
1089915529 11:122152064-122152086 TGAAGAACCTCATTCATTTCAGG + Intergenic
1090574381 11:128085641-128085663 TCCAAGACTGCATTCCTTTTTGG + Intergenic
1090764563 11:129865375-129865397 TGCAGAAGTGCACACCTCTCTGG - Intronic
1091566549 12:1652972-1652994 TGCAGAACTGCAGACCAGTCTGG - Intergenic
1091957199 12:4656024-4656046 TGTATAACTCCATTCCTTACAGG - Intronic
1092128588 12:6092672-6092694 TGCTGACCAGCATTCCTTCCTGG + Intronic
1092775588 12:11942486-11942508 TGCACCACTGCATTCCACTCTGG + Intergenic
1092845340 12:12579794-12579816 AGCAGGGCTGCATTCTTTTCTGG + Intergenic
1092998711 12:13975835-13975857 TGTGGAATTGCCTTCCTTTCTGG - Intronic
1093003151 12:14022490-14022512 TGCACTACTGCATTCCATCCTGG - Intergenic
1093114995 12:15198262-15198284 TGCAGAACTCAACTCCATTCAGG + Intronic
1093616222 12:21228753-21228775 AGCAGGGCTGTATTCCTTTCTGG - Intronic
1093881583 12:24410039-24410061 TGCACAACTGCATTCCAACCTGG - Intergenic
1094105266 12:26804777-26804799 TGCAGCACTGCATTCCAGCCTGG - Intronic
1094112408 12:26875613-26875635 TGCACCACTGCATTCCAGTCTGG - Intergenic
1094329698 12:29277714-29277736 TGCAGGAGGGCATTTCTTTCAGG + Intronic
1094556933 12:31510270-31510292 GACAGGGCTGCATTCCTTTCTGG + Intronic
1094700490 12:32865640-32865662 TGCGCCACTGCATTCCTGTCTGG + Intronic
1094789127 12:33890210-33890232 TGCAGAACAGAATTTCTTTCAGG - Intergenic
1095107192 12:38248749-38248771 GGCAGAGCTGTGTTCCTTTCTGG - Intergenic
1095168634 12:39006192-39006214 GGCAGAACTGCCTTTCTTTCTGG - Intergenic
1095445689 12:42279850-42279872 GGCAGAACTGAATTCCTTGCAGG + Intronic
1095482147 12:42647873-42647895 TCAAGTGCTGCATTCCTTTCTGG + Intergenic
1095545453 12:43362930-43362952 AGCAGGGCTGCATTCCTTTCTGG - Intronic
1095615651 12:44184702-44184724 AGCAGAGCTGAGTTCCTTTCTGG - Intronic
1096034034 12:48448106-48448128 ATCAGGGCTGCATTCCTTTCTGG - Intergenic
1096327122 12:50673740-50673762 TGCACCACTGCATTCCTGGCTGG + Intronic
1096702823 12:53397506-53397528 TGCACCACTGCATTCCAGTCTGG - Intronic
1096714753 12:53484365-53484387 TTCCTAACTCCATTCCTTTCAGG - Exonic
1096823172 12:54253369-54253391 TGCACCACTGCATTCCAGTCTGG + Intronic
1096872427 12:54601743-54601765 GGCAGGGCTGCGTTCCTTTCTGG - Intergenic
1097027928 12:56071832-56071854 TGCACCACTGCATTCCATCCTGG + Intergenic
1097209853 12:57358959-57358981 TGCACCACTGCATTCCAGTCTGG - Intronic
1097309378 12:58101959-58101981 GGCAGGCCTGCTTTCCTTTCTGG + Intergenic
1097329958 12:58322375-58322397 TGCAGAAATGTCTTCATTTCAGG - Intergenic
1097630770 12:62059271-62059293 TGCACCACTGCATTCCATCCTGG + Intronic
1098279143 12:68845805-68845827 TGCAGCACTGCATTCCAGCCTGG - Exonic
1098285007 12:68897888-68897910 TGCACCACTGCATTCCTGCCTGG - Intronic
1098576753 12:72051440-72051462 AACAGGACTGCACTCCTTTCTGG + Intronic
1099764989 12:86971479-86971501 TGAGGAGCTGCATTCCTTTTGGG - Intergenic
1100108339 12:91205922-91205944 GGCAGGGCTGCATTCCTTTCTGG + Intergenic
1100181519 12:92091398-92091420 TGCACCACTGCATTCCATCCTGG - Intronic
1100306509 12:93354841-93354863 TGCACCACTGCATTCCAGTCTGG - Intergenic
1100966653 12:100020730-100020752 AGCAGGGCTGCACTCCTTTCTGG - Intergenic
1101339207 12:103826572-103826594 TGCAGGACTGCATTTCTTTCTGG - Intronic
1101853761 12:108425290-108425312 TGCAGCACTGCACTCCTGCCTGG - Intergenic
1102189302 12:110974538-110974560 TGCACCACTGCATTCCAGTCTGG + Intergenic
1102398166 12:112605329-112605351 TGCACCACTGCATTCCATCCTGG + Intronic
1102707392 12:114893998-114894020 TGCACCACTGCATTCCATCCTGG + Intergenic
1103112630 12:118294425-118294447 TGCAGTACTGCACTCCAGTCTGG - Intronic
1103157891 12:118702479-118702501 CGCAGAGCTGCATTCCATTCTGG - Intergenic
1103598562 12:122039440-122039462 TGCACCACTGCATTCCACTCTGG + Intronic
1104282092 12:127387667-127387689 GGCAGCACTGCACTCCATTCTGG - Intergenic
1104861125 12:131924321-131924343 TGCAGCACTGCACTCCAGTCTGG - Intergenic
1105513634 13:21072143-21072165 TGGAGAGCTGCATCCCTTCCTGG - Intergenic
1106036541 13:26050210-26050232 TGAGGAGCTGCCTTCCTTTCGGG + Intronic
1106062439 13:26307507-26307529 AGCAGGACTGCATTCTTCTCTGG - Intronic
1106387235 13:29299659-29299681 TGGGGAACTGCATTCCATTCAGG + Intronic
1106420169 13:29579402-29579424 TGCAACACTGCATTCCAGTCTGG - Intronic
1106767353 13:32926821-32926843 TGCACTACTGCATTCCATCCTGG + Intergenic
1106833123 13:33606791-33606813 GGCAGAGCTGCGCTCCTTTCTGG + Intergenic
1107036428 13:35907204-35907226 TGCAGCACTGCATTCCAGCCTGG - Intronic
1107649348 13:42528377-42528399 ATCAGGACTGCGTTCCTTTCTGG - Intergenic
1107702983 13:43067118-43067140 GGCAGAGCTGCATTCCATTTTGG + Intronic
1108033092 13:46257302-46257324 AGCAGGACTGCATTGCTATCTGG - Intronic
1108204676 13:48075483-48075505 AGCAGGGCTGCATTCCTTCCTGG - Intronic
1108235831 13:48403955-48403977 TGCACTACTGCATTCCAGTCTGG + Intronic
1108793152 13:53997123-53997145 AGCAGGACTGCATTTCTTTCTGG - Intergenic
1109929721 13:69198884-69198906 TGCTGGACTGCATTCCTATCTGG - Intergenic
1110207620 13:72935027-72935049 TGCACAACTGCATTCCAGCCTGG - Intronic
1110219044 13:73053661-73053683 TGCACCACTGCATTCCATCCTGG - Intergenic
1110350206 13:74498315-74498337 GGCAGGGCTGCCTTCCTTTCTGG + Intergenic
1110729134 13:78859947-78859969 TGAGGAGCTGCATTCCTTTGGGG + Intergenic
1111624993 13:90773642-90773664 TGCAGAAAAGCATTGCTTTATGG - Intergenic
1111882718 13:93978225-93978247 GGCAGAGCTGCATTCCTCTCTGG - Intronic
1112825924 13:103392530-103392552 TTCAGAACTGCATTTCACTCTGG - Intergenic
1113057481 13:106285030-106285052 GGCAGGGCTGCATTCCTTTCTGG + Intergenic
1113320408 13:109227389-109227411 GGCAGGATTGCATTCCTTTTGGG + Intergenic
1113472434 13:110556425-110556447 TGCAGGATTGCATTCCTTTCTGG - Intronic
1113772449 13:112918722-112918744 TGCAGAGCAGCAGTGCTTTCTGG + Intronic
1114840172 14:26253859-26253881 TGCACCACTGCACTCCATTCTGG - Intergenic
1115401235 14:32963168-32963190 TTCAGAACTGCCTTCCTTTTTGG - Intronic
1116316906 14:43408642-43408664 TGCAAAATTGCATTCCTAACTGG - Intergenic
1117423177 14:55568414-55568436 TGCATCACTGCACTCCTGTCTGG - Intronic
1117489280 14:56229692-56229714 TGAGGAGCTGCATTCCTTTGGGG - Intronic
1118417187 14:65553515-65553537 TGCAGATCTGCATTTTTATCTGG + Intronic
1118580823 14:67295444-67295466 TGCACCACTGCATTCCAGTCTGG + Intronic
1118799709 14:69178461-69178483 TGCACCACTGCACTCCTTCCTGG - Intergenic
1118888818 14:69889732-69889754 AGCAGGACTGAGTTCCTTTCTGG + Intronic
1118985221 14:70748645-70748667 TGCCCAACTGCATTCTTCTCTGG + Intronic
1119179541 14:72596159-72596181 AGGAGGGCTGCATTCCTTTCAGG + Intergenic
1119588621 14:75862901-75862923 TGCACCACTGCACTCCATTCTGG + Intronic
1119867766 14:77988372-77988394 ACCAGGGCTGCATTCCTTTCTGG - Intergenic
1119995457 14:79248582-79248604 GCCATAACTGCATACCTTTCTGG + Intronic
1120196433 14:81488896-81488918 TGCATAACTGCCTTCCATTGAGG - Intronic
1120339138 14:83196582-83196604 TGGAGAAAAGCATGCCTTTCTGG - Intergenic
1120488255 14:85143096-85143118 TGCAGATGTGCTTTCCTTTATGG - Intergenic
1120851708 14:89177765-89177787 TGCAGAACTGTGTTCCCTTAGGG + Intronic
1121272071 14:92644439-92644461 GGAAGAACTGCATTCCTTTCTGG + Intronic
1122034129 14:98935237-98935259 TTCAGAGCTGTATCCCTTTCTGG - Intergenic
1122940670 14:104979618-104979640 TGCAGAACTCCACTCCTTCTGGG - Intergenic
1124184079 15:27506575-27506597 AGCAGGGCTGCATTCTTTTCTGG - Intronic
1124205062 15:27710943-27710965 GGCAGGGTTGCATTCCTTTCTGG - Intergenic
1124205263 15:27713108-27713130 GACAGAGCTGCCTTCCTTTCGGG - Intergenic
1124450653 15:29786541-29786563 TGCACCACTGCACTCCATTCTGG - Intronic
1124475048 15:30025900-30025922 TGCACGACTGCTGTCCTTTCAGG + Intergenic
1125425256 15:39542395-39542417 GGTAGAGCTGCATTCCTTTCTGG + Intergenic
1125546312 15:40508348-40508370 TGCACCACTGCATTCCTGCCTGG - Intergenic
1126277762 15:46904157-46904179 TGCTGAATTGTATTTCTTTCTGG + Intergenic
1126525864 15:49653401-49653423 AGCTGAACTGCATTCCTTTCTGG - Exonic
1127125082 15:55803782-55803804 TGCACCACTGCATTCCAGTCTGG - Intergenic
1127264917 15:57353417-57353439 AGCAGGGGTGCATTCCTTTCTGG - Intergenic
1127345327 15:58090588-58090610 TGCAGAAATTCATTACTCTCTGG - Intronic
1127562140 15:60150002-60150024 TGCACCACTGCATTCCATCCTGG - Intergenic
1129569967 15:76671287-76671309 TGCACCACTGCATTCCAGTCTGG + Intronic
1129605145 15:77021158-77021180 TGCAGAAATGCAGTACCTTCAGG - Intronic
1130180728 15:81625027-81625049 TGCACCACTGCATTCCAGTCTGG + Intergenic
1130250491 15:82297357-82297379 TGCACACCTGCACTCCTGTCTGG + Intergenic
1130606645 15:85323680-85323702 TGCACCACTGCACTCCATTCTGG - Intergenic
1130796362 15:87214116-87214138 TGCACTACTGCATTCCTGCCTGG - Intergenic
1131737208 15:95346528-95346550 AGTAGAACTTTATTCCTTTCTGG - Intergenic
1131796935 15:96028771-96028793 AGCAGAAATGCTTTCTTTTCTGG + Intergenic
1131940375 15:97558324-97558346 TAGAGGTCTGCATTCCTTTCTGG + Intergenic
1132301058 15:100775792-100775814 TGCAGAACTGGACACTTTTCAGG - Intergenic
1133261746 16:4555349-4555371 TGAAGAACTACATTCATTTCTGG - Intergenic
1133481250 16:6172888-6172910 GGCAGAGCTGCACTCCTTTCTGG + Intronic
1133899935 16:9964549-9964571 AGCAGGATTGCTTTCCTTTCCGG + Intronic
1133948308 16:10367843-10367865 TGCACAACTGCATTCCAGCCTGG + Intronic
1135051597 16:19197490-19197512 TGCACCACTGCACTCCATTCTGG - Intronic
1135627509 16:24009019-24009041 TGCAGAACTTCCTTCTTTTTGGG + Intronic
1135728090 16:24872584-24872606 TGCACCACTGCATTCCATCCTGG - Intronic
1137583298 16:49647705-49647727 GGCAGGGCCGCATTCCTTTCTGG - Intronic
1137651018 16:50120338-50120360 TGCACCACTGCATTCCAGTCTGG - Intergenic
1137880761 16:52046063-52046085 TGCAGATCTCCATTTCTTTGGGG + Intronic
1138019165 16:53461446-53461468 TGCATCACTGCATTCCATCCTGG + Intronic
1138073421 16:54016643-54016665 TGCAGAGCTGCCTTACTTTCGGG - Intronic
1138326411 16:56174655-56174677 TGCAAGGCTGCATTCCTTTCTGG + Intergenic
1138471346 16:57240263-57240285 TACAGAACTGATTTCCTTCCTGG + Intronic
1138718085 16:59046983-59047005 TGCACCACTGCACTCCTTTCTGG + Intergenic
1138876786 16:60961194-60961216 CACAGGGCTGCATTCCTTTCCGG + Intergenic
1138992988 16:62414331-62414353 TGCACCACTGCATTCCATCCTGG - Intergenic
1139353432 16:66352382-66352404 GGCAGGGCTGCATGCCTTTCAGG + Intergenic
1139635600 16:68256555-68256577 TGCACCACTGCATTCCAGTCTGG - Intronic
1140002269 16:71037795-71037817 AGCCGAGCTGCATTCCTTTCGGG - Intronic
1140013757 16:71162061-71162083 AGCAGGGCTGCATTCCCTTCTGG - Intronic
1140565059 16:76032053-76032075 TGCAGAGCTGCATTTGTTTCTGG - Intergenic
1140642340 16:76990880-76990902 GGCAGGGCTGGATTCCTTTCTGG + Intergenic
1140922523 16:79552255-79552277 TGCTGAACTGCACTCCAATCTGG - Intergenic
1141035875 16:80625193-80625215 AGCAAGACTGCATTCCTTTGTGG + Intronic
1142396376 16:89834022-89834044 TGCAGGACTGCCTTCCTGTGAGG - Intronic
1143139926 17:4736024-4736046 TGCACAACTGCATTCCAGCCTGG + Intronic
1143365264 17:6404161-6404183 GGCAGGGCTGCATTCCTTTCTGG + Intronic
1143525433 17:7469208-7469230 TGCACCACTGCATTCCAGTCTGG - Intronic
1143716567 17:8775665-8775687 TGCACCACTGCATTCCATCCTGG - Intergenic
1144701886 17:17345765-17345787 TGCACCACTGCATTCCAGTCTGG + Intronic
1145060281 17:19728845-19728867 TGCAGAACTTCATTCTTCCCTGG - Intergenic
1145284404 17:21494702-21494724 TGCAGGGCTGCGCTCCTTTCTGG + Intergenic
1145718571 17:27046890-27046912 TACACAACTGCATTCCAATCTGG + Intergenic
1145745608 17:27317561-27317583 TGCACCACTGCATTCCAGTCTGG - Intergenic
1146302335 17:31699107-31699129 TGCGCCACTGCATTCCATTCTGG + Intergenic
1146456191 17:33011649-33011671 AGCAGGGCTGCATTTCTTTCTGG - Intergenic
1146664715 17:34691355-34691377 TGCACCACTGCACTCCTGTCTGG + Intergenic
1147594479 17:41707912-41707934 GGCAGGGCTGCATTTCTTTCTGG + Intergenic
1147702910 17:42407070-42407092 ACCAGAACTGCTTTCCATTCCGG + Intronic
1148625340 17:49065086-49065108 GGTAGGACTGCATTCCTTTCTGG + Intergenic
1148877397 17:50698249-50698271 TGGAGCACTGCCTTACTTTCTGG - Intronic
1149656880 17:58314594-58314616 GGCAGAACTGCATCCCCTTGGGG - Intronic
1149743948 17:59076507-59076529 TGCACCACTGCAGTCCTTCCTGG + Intronic
1150900650 17:69273497-69273519 TGCACCACTGCATTCCAGTCTGG - Intronic
1150968901 17:70004269-70004291 GGCAGTGCTGCATTCTTTTCTGG + Intergenic
1150990671 17:70254619-70254641 AGCAGAGCTACATTCCTTTCTGG - Intergenic
1151754183 17:76062241-76062263 TGCACCACTGCATTCCAATCTGG + Intronic
1152670690 17:81603550-81603572 TGCACAACTGCACTCCAGTCTGG + Intronic
1152827284 17:82475144-82475166 TGCAGGAGTGCTTTCCTTTTGGG + Intronic
1153206434 18:2708312-2708334 TTCAGGACTGCATTTCTTCCTGG + Intronic
1153892563 18:9531892-9531914 CCTAGAACTTCATTCCTTTCTGG - Intronic
1153902020 18:9625703-9625725 AGCAGGGCTGCATTCCTTTCTGG + Intergenic
1153902217 18:9627771-9627793 AGCAGGGCTGCATTCTTTTCTGG + Intergenic
1153923559 18:9812739-9812761 TGCAAAACTGCACTCCTGCCTGG - Intronic
1153961546 18:10144232-10144254 TGCAGCACAGCATCCCTTCCTGG - Intergenic
1154149076 18:11891860-11891882 TGCACCACTGCATTCCATCCTGG - Intronic
1154227391 18:12518446-12518468 TGCATCACTGCATTCCAGTCTGG + Intronic
1154495716 18:14958955-14958977 TTCTAAACTGCATGCCTTTCTGG - Intergenic
1155101238 18:22612416-22612438 TGCAGCACTGCATTCCAGCCTGG - Intergenic
1155339580 18:24800270-24800292 TGCAGAAATGCATTACCTGCAGG + Intergenic
1155541361 18:26871683-26871705 TGCACCACTGCATTCCAATCTGG + Intergenic
1155557659 18:27038554-27038576 TGCAGAACTGAAGCCCTTGCTGG - Intronic
1155605379 18:27599903-27599925 TACAGTAGTGCATTTCTTTCTGG - Intergenic
1155912564 18:31521375-31521397 TTCAGAACTGCTTTCCTTATAGG + Intronic
1156255556 18:35392462-35392484 AGCAGTGTTGCATTCCTTTCTGG - Intergenic
1156728518 18:40160395-40160417 TGCAGTATTTCTTTCCTTTCTGG - Intergenic
1156792572 18:40993767-40993789 TGCAGCACTGCACTCCTGCCTGG - Intergenic
1157328021 18:46682920-46682942 TGCAGAACTGCATTCCTTTCTGG - Intronic
1157687920 18:49657683-49657705 TGCACCACTGCATTCCAGTCTGG + Intergenic
1158051417 18:53225430-53225452 TGCAGGAATGCAATCCTTTGAGG + Intronic
1158189176 18:54806272-54806294 TGCAGAACTGCCCTCCTCTTAGG + Intronic
1158521565 18:58175511-58175533 TGCAGAGCTACATTTCTCTCTGG + Intronic
1158591111 18:58779597-58779619 TTCACAACTGTATTCCTTGCCGG + Intergenic
1158734583 18:60065086-60065108 TGCAGTACTGCACTCCTGCCTGG + Intergenic
1158973190 18:62687296-62687318 GGCAGGGCTGCATTCATTTCTGG + Intergenic
1158977525 18:62725314-62725336 TGCACCACTGCATTCCCGTCTGG + Intronic
1159687680 18:71443766-71443788 AGCAAATCTGCATTCCTTTCTGG + Intergenic
1159754623 18:72348995-72349017 GGCAGGACTGCTGTCCTTTCTGG - Intergenic
1159825307 18:73201734-73201756 TGCACAACTGCACTCCATCCTGG - Intronic
1160977334 19:1799718-1799740 TGCACCACTGCATTCCTGCCTGG + Intronic
1161925523 19:7296065-7296087 TGCACCACTGCATTCCTGCCTGG - Intergenic
1163459594 19:17428910-17428932 TGCATAACTGCACTCCTGGCTGG + Intronic
1163574756 19:18104134-18104156 TGCACCACTGCATTCCAGTCTGG + Intronic
1163802520 19:19375178-19375200 TTCAGAAATGCATTCCTTCCTGG + Intergenic
1164797784 19:31048331-31048353 AGCAGGGCTGCATTCCTCTCTGG - Intergenic
1165055182 19:33171644-33171666 AACAGGACTGCATTCCTTTCAGG + Intronic
1165248855 19:34513971-34513993 TGCAGCACAGGATTCCTGTCTGG - Intergenic
1165319935 19:35079022-35079044 TGCACTACTGCATTCCATCCTGG - Intergenic
1165320537 19:35082369-35082391 TGCAGGAGTGCATTTCTTTCTGG + Intergenic
1165695991 19:37901385-37901407 TGCAGCACTGCATTCCAGCCTGG + Intronic
1166757282 19:45201157-45201179 TGCAGCACTGCATTCCAGCCTGG + Intronic
1167129983 19:47578688-47578710 CTCAGGACTGCATTCCTATCTGG + Intergenic
1167356555 19:49007746-49007768 TGCACCACTGCATTCCAGTCTGG - Intronic
1167778488 19:51578721-51578743 TGCACCACTGCATTCCATCCTGG + Intronic
925021844 2:576002-576024 TGCATCACTGCATTCCTGCCTGG - Intergenic
926436127 2:12839839-12839861 AGCAGGACTGTACTCCTTTCTGG - Intergenic
926889172 2:17624722-17624744 GGCAGAGCTACATTCCCTTCTGG - Intronic
927099626 2:19778027-19778049 TAAAGAACTGAATTTCTTTCGGG + Intergenic
927362158 2:22248653-22248675 GTCAGGACTGCATTCCTTTTGGG - Intergenic
927536766 2:23868342-23868364 TGCACCACTGCATTCCATCCTGG - Intronic
927710278 2:25321218-25321240 GGCAGGGCTGCATTCTTTTCTGG + Intronic
928201637 2:29251130-29251152 TCCAGATCTGGATGCCTTTCAGG + Exonic
928462115 2:31484929-31484951 TGCTGAACTGCATTTCCTTGGGG - Intergenic
928807051 2:35171453-35171475 AGCAGGAATGCATTCTTTTCTGG - Intergenic
928996297 2:37295029-37295051 TGCACAACTGCACTCCAGTCTGG + Intronic
930967612 2:57350260-57350282 TAGAGAACTTCCTTCCTTTCTGG - Intergenic
930990988 2:57654638-57654660 AGCAGGACTGACTTCCTTTCTGG - Intergenic
931268855 2:60684275-60684297 TGCAGCACTGCATTCCAGCCTGG + Intergenic
931279635 2:60778188-60778210 TGCACCACTGCATTCCGGTCTGG - Intronic
931335210 2:61334828-61334850 TGGAGAAAAGCATTCCTTTAGGG - Intronic
931528754 2:63188779-63188801 TACAGATCTGCATTTCTTTAAGG + Intronic
933128618 2:78643813-78643835 TGAAGACCTGCATTGCCTTCAGG + Intergenic
933244362 2:79958596-79958618 AGGAGACCGGCATTCCTTTCTGG - Intronic
933648003 2:84827901-84827923 GGCAGGGCTGCATTCCCTTCTGG - Intronic
934063384 2:88317835-88317857 GGCAGAGCTGCTTTCCTTTCTGG - Intergenic
935026873 2:99285335-99285357 TGCACCACTGCATTCCATCCTGG + Intronic
935386868 2:102509163-102509185 TGCAGGGCTGCGCTCCTTTCTGG + Intronic
935825868 2:106948660-106948682 TGCAAAAGTGCATTCCTGGCTGG - Intergenic
935999991 2:108817729-108817751 TACAGAGCTGTGTTCCTTTCTGG - Intronic
936103764 2:109606369-109606391 TGCACCACTGCATTCCAGTCTGG + Intronic
936620810 2:114095411-114095433 AGCAGAACTGCATATTTTTCTGG + Intergenic
936997228 2:118428210-118428232 AGCAGGGTTGCATTCCTTTCTGG + Intergenic
937696916 2:124818486-124818508 TGCACTACTGCACTCCATTCTGG + Intronic
937776636 2:125785586-125785608 TGCATCACTGCACTCCATTCTGG - Intergenic
938388543 2:130885611-130885633 TGCACAACTGCATTCCAGACTGG - Intronic
938551539 2:132386779-132386801 TCCAGAACTGCCTTCCTGCCAGG - Intergenic
938576941 2:132613569-132613591 TGCTGAACTGCAAGCCCTTCAGG + Intronic
938738362 2:134207046-134207068 AGCAGGACTGTGTTCCTTTCAGG + Intronic
938998482 2:136706048-136706070 AGCAGAGCTGCATGCCATTCTGG - Intergenic
939379245 2:141413477-141413499 GGCCGGGCTGCATTCCTTTCTGG - Intronic
939633226 2:144550566-144550588 TGCACAACTGCACTCCATCCTGG + Intergenic
940002439 2:148979821-148979843 TGAAGAACTGAATGCCTTTGGGG - Intronic
940223799 2:151381442-151381464 TGCATCACTGCATTCCAGTCTGG + Intergenic
940861431 2:158774146-158774168 TGCAGAACTGCAACCCTGTGGGG + Intergenic
941196476 2:162458961-162458983 TGCACCACTGCATTCCAGTCTGG + Intronic
941550243 2:166906874-166906896 TGCACCACTGCATTCCATCCTGG + Intronic
941646945 2:168050685-168050707 TATAGGGCTGCATTCCTTTCTGG - Intronic
941816765 2:169803679-169803701 TGCACCACTGCATTCCAGTCTGG + Intronic
942204662 2:173608320-173608342 TGCCAAATTGCTTTCCTTTCTGG + Intergenic
942359454 2:175156720-175156742 GGCAGAGCTGCATTCCTTTTTGG - Intronic
942798718 2:179851404-179851426 TGCACCACTGCATTCCAGTCTGG + Intronic
943026000 2:182629191-182629213 GGCAGGACTGAATTCCCTTCTGG - Intergenic
943070966 2:183140195-183140217 AGCAGGACTGCATTCCTTTCTGG + Intronic
943108840 2:183581367-183581389 TGCAGGGATGCATTTCTTTCTGG + Intergenic
943538693 2:189184474-189184496 AGCAGGGCTGCATTCCTTTTTGG + Intergenic
943653293 2:190480117-190480139 TGCAGCACTGCATTCCAGCCTGG + Intronic
945061781 2:205915722-205915744 AGCAGGGCTGCATTCCTTTCTGG + Intergenic
945227560 2:207547976-207547998 TGCACCACTGCACTCCTTCCTGG - Intronic
945230942 2:207589217-207589239 AGCAGGACTGCATTCCTTCCTGG + Intronic
945322041 2:208435724-208435746 GGCAGGGCTGCATTCCTCTCTGG - Intronic
945859304 2:215102553-215102575 TGCACCACTGCATTCCAGTCTGG + Intronic
945915289 2:215697217-215697239 TGCAGAACTGCATTCTGGTTTGG + Intergenic
946150962 2:217770227-217770249 AGCAGGGCTGCATTTCTTTCTGG + Intergenic
946723789 2:222640710-222640732 TGCACCACTGCATTCCAGTCTGG + Intronic
946787806 2:223266195-223266217 AGCAGGATTGCGTTCCTTTCTGG - Intergenic
946805254 2:223464827-223464849 GGCAGAGCTGCATTGCATTCTGG + Intergenic
946840900 2:223818594-223818616 TGCACCACTGCATTCCTGCCTGG - Intronic
947256696 2:228173660-228173682 GCCAGGGCTGCATTCCTTTCTGG - Intronic
947283606 2:228484169-228484191 TGAACAACTGCTTTCCTTTAGGG - Intergenic
947400617 2:229728044-229728066 TGCACCACTGCATTCCAATCTGG + Intergenic
947468093 2:230372099-230372121 TGTAGGCCTTCATTCCTTTCTGG - Intronic
948114320 2:235482906-235482928 GGCAGGGCTGCATTCCTTTCTGG - Intergenic
1168765030 20:376158-376180 TGCAGAAATGTACTCTTTTCTGG - Intronic
1169524998 20:6414802-6414824 AACAGGGCTGCATTCCTTTCTGG - Intergenic
1169775543 20:9248927-9248949 GGCAGAGCTGCTTTCCTTTCTGG + Intronic
1171509652 20:25671139-25671161 TGTAGGACTGCATTCCTGCCTGG + Intergenic
1172139567 20:32712793-32712815 TGCACCACTGCATTCCAGTCTGG - Intronic
1172319848 20:33987727-33987749 TGCAGCACTGCACTCCATACTGG + Intergenic
1172556212 20:35843624-35843646 TGCACCACTGCATTCCCGTCTGG - Intronic
1172886645 20:38235648-38235670 TGCAGAGCTGCATTCTTTCCTGG - Intronic
1173492719 20:43496245-43496267 AGCAGAGCTGCATTCCTTTCTGG - Intergenic
1173679994 20:44871894-44871916 AGCTGGGCTGCATTCCTTTCTGG - Intergenic
1173795964 20:45860185-45860207 TGCAGGGCTGTATTTCTTTCTGG + Intronic
1173819867 20:46013045-46013067 TGCACCACTGCATTCCATCCTGG + Intronic
1174895632 20:54446673-54446695 TGCACCACTGCATTCCCGTCTGG + Intergenic
1175176433 20:57115139-57115161 GGGAGAGCTGCATTCCTTTATGG + Intergenic
1175274653 20:57759951-57759973 AGCAGGGCTGCATTCCTTTCTGG + Intergenic
1175711179 20:61222247-61222269 CGAAGGGCTGCATTCCTTTCTGG - Intergenic
1176896535 21:14384907-14384929 AGCAAAGCTGCATTCCTTTCTGG + Intergenic
1177067022 21:16451674-16451696 AACACAACTGCATTCATTTCAGG + Intergenic
1177653196 21:23983973-23983995 TCCAGGACTGTATTTCTTTCTGG + Intergenic
1178046948 21:28705731-28705753 TGCAGGACTGTGTTCCTTTCTGG + Intergenic
1178205030 21:30455090-30455112 TGCACAACTGCATTCCAGCCTGG + Intergenic
1178283973 21:31309412-31309434 TGCACCACTGCATTCCATCCTGG + Intronic
1178683720 21:34695126-34695148 AGCAGGGCTGCATTTCTTTCTGG + Intronic
1178792499 21:35713226-35713248 ATCAGGGCTGCATTCCTTTCTGG + Intronic
1179008553 21:37535132-37535154 GGCAGGACGGCATTTCTTTCTGG - Intergenic
1179147266 21:38779022-38779044 GGCAGGGTTGCATTCCTTTCTGG - Intergenic
1179252580 21:39684887-39684909 GGCAGGGCTGCATTCCTTTCTGG + Intergenic
1180032469 21:45221912-45221934 TTCAGAACTGCATTGGCTTCTGG - Intronic
1181142329 22:20815335-20815357 TGCACCACTGCACTCCATTCTGG + Intronic
1181914089 22:26265300-26265322 GGCAGATCTGAATTCCTATCAGG - Intronic
1182397684 22:30048066-30048088 AGCAGGACTGTGTTCCTTTCTGG - Intergenic
1182456691 22:30456253-30456275 TGCACCACTGCATTCCTGCCTGG + Intronic
1182507374 22:30793796-30793818 TGCACCACTGCATTCCAGTCTGG + Intronic
1182591850 22:31387172-31387194 TGCATCACTGCATTCCTGTCTGG - Intergenic
1183580033 22:38719047-38719069 TGCACAACTGCACTCCAGTCTGG - Intronic
1183844873 22:40534496-40534518 TGCACCACTGCATTCCAGTCTGG - Intronic
1183878557 22:40805731-40805753 AGCAGAGCTGTATTCCTTTTTGG - Intronic
1184319308 22:43727382-43727404 TGCACCACTGCATTCCTGCCTGG + Intronic
1184889850 22:47373008-47373030 TGCTGAACTGTATTCCATGCTGG - Intergenic
949357493 3:3197536-3197558 AGCAGGTCTGCATTCCATTCTGG + Intergenic
949800927 3:7903436-7903458 TGCACAACTGCACTCCAGTCTGG + Intergenic
949952331 3:9239334-9239356 TGCACCACTGCATTCCAGTCTGG + Intronic
950067495 3:10124672-10124694 AGCAGGACTGCCTTCCTTTCTGG + Intronic
950844946 3:16006169-16006191 TGCACCACTGCATTCCATCCTGG + Intergenic
951546856 3:23834683-23834705 TGCATCACTGCACTCCTTCCTGG + Intronic
951704555 3:25530459-25530481 GGCAGCGCTGCATTCCTTTTTGG + Intronic
952258085 3:31712627-31712649 GGCAGGGCTGCATTGCTTTCTGG - Intronic
952303773 3:32127415-32127437 TGCAGACCTGCACTGCTGTCGGG + Intronic
952780633 3:37093715-37093737 GGTAAAACTGAATTCCTTTCAGG + Intronic
953099723 3:39812079-39812101 TTCAGAACTGCATTATTTTCTGG - Intronic
953349108 3:42201415-42201437 TGCACCACTGCACTCCTGTCTGG + Intronic
954170842 3:48801023-48801045 TGCGCCACTGCATTCCATTCTGG - Intronic
954831995 3:53428870-53428892 ATCAGTACTTCATTCCTTTCGGG + Intergenic
954977702 3:54712307-54712329 AGCTGAACTGTATTCCTTTCTGG + Intronic
955162781 3:56481122-56481144 TGCAGAACTTGATTCAATTCTGG - Intergenic
955413162 3:58668901-58668923 GGCAGGCTTGCATTCCTTTCTGG + Intergenic
955463221 3:59208462-59208484 AGCAGGACTGCATTCCTTTCTGG - Intergenic
955598566 3:60618953-60618975 AGCCGTACTGCATTCCTTTTTGG - Intronic
956040171 3:65137227-65137249 TGCACCACTGCATTCCTGCCTGG - Intergenic
956043361 3:65169848-65169870 TGCAGAACTGCACTCCAGCCTGG - Intergenic
956310006 3:67868745-67868767 TGGAGAACTCCCTTGCTTTCTGG + Intergenic
956336610 3:68171337-68171359 AGAAGGACTGCATTTCTTTCTGG - Intronic
956434856 3:69224539-69224561 TTCAGAACTACATGCTTTTCAGG - Intronic
956764315 3:72471532-72471554 AGCAGGGCTGCATTCCTTTCTGG + Intergenic
956764317 3:72471559-72471581 TCCAGCACTGAATTGCTTTCAGG + Intergenic
956834009 3:73080946-73080968 TGCACCACTGCATTCCATCCTGG - Intergenic
956928400 3:74014721-74014743 CGCAGGGCTTCATTCCTTTCTGG - Intergenic
957118774 3:76061810-76061832 AGCAGGACTGAATTCCTTTCTGG + Intronic
957875712 3:86143791-86143813 TGCAGGACTGTGTTTCTTTCTGG + Intergenic
957946493 3:87069736-87069758 GGCAGGGCTGCATTCCTTTCTGG - Intergenic
958711786 3:97725454-97725476 AGCACAACTGCATTGCTTTGGGG - Intronic
958997580 3:100922712-100922734 GGCAGGGCTGCATTCCTTTCTGG - Intronic
959016843 3:101144308-101144330 AGCAGGGCTGCATTCCTTTCTGG - Intergenic
959520150 3:107316355-107316377 TGCCGAACTGCATCCCTCTGGGG - Intergenic
960723382 3:120646348-120646370 TGCTGAACCGCATTCCTCTCTGG + Exonic
960748504 3:120917991-120918013 CACAGAACTGCATTCCTTTCTGG + Intronic
960875146 3:122288308-122288330 GGCAGGGCTGCATTCCTTTCTGG - Intergenic
961552074 3:127675123-127675145 TGCAGAACGGCAGTCCATGCAGG - Intronic
961580425 3:127876164-127876186 GGCAGGACTGCATTCCTCTCTGG - Intergenic
961744982 3:129058945-129058967 GGCAGGGCTGCATTCCTCTCTGG + Intergenic
963033915 3:141008177-141008199 AGCCAACCTGCATTCCTTTCTGG - Intergenic
963204481 3:142618494-142618516 AGCAGGACTGCGTTCCTTTCTGG + Intronic
963220425 3:142804061-142804083 AGAAGAACTGCAGTCCTTTGTGG + Exonic
963339597 3:144019002-144019024 TGCACAACTGCATTCCAGCCTGG - Intronic
963565089 3:146919422-146919444 TTAAGGACTGCCTTCCTTTCAGG + Intergenic
963826321 3:149958263-149958285 AGCAGGACTGTGTTCCTTTCTGG + Intronic
963933483 3:151028315-151028337 TGCACTACTGCATTCCAGTCTGG - Intergenic
964071993 3:152646423-152646445 TGCATTACTGTCTTCCTTTCTGG - Intergenic
964181514 3:153893290-153893312 TGCACCACTGCATTCCAGTCTGG - Intergenic
964561013 3:157996697-157996719 TGCAGAGCTGCATTCCTTTCTGG + Intergenic
964813532 3:160692047-160692069 AGCAGAGCTGCATTTCTTTTTGG - Intergenic
964827603 3:160847469-160847491 TGAAGTCTTGCATTCCTTTCAGG - Intronic
965081952 3:164045128-164045150 AGCAGGACTGCATTCCTTTCTGG + Intergenic
965273019 3:166642748-166642770 TGGAGAACTGTGTTCCTTACTGG - Intergenic
965294544 3:166926879-166926901 TGAAGAACTGTATTCCTTTCAGG + Intergenic
965701959 3:171467250-171467272 ATCAGGGCTGCATTCCTTTCTGG - Intergenic
965837807 3:172870404-172870426 GGCAGGGCTGCATTCCCTTCTGG + Intergenic
966389532 3:179437520-179437542 TGCACAACTGCACTCCTGACTGG + Intronic
967346940 3:188467825-188467847 GGCAGGGCAGCATTCCTTTCTGG - Intronic
967354467 3:188552571-188552593 AGCAGAGCTTCGTTCCTTTCTGG + Intronic
967763357 3:193250628-193250650 TGCAGATCTGGATTTCTTGCTGG + Intronic
968024416 3:195427242-195427264 GGCAGGGCTGCATTCTTTTCTGG - Intronic
968210561 3:196845205-196845227 TGCAGTACTGCACTCCAGTCTGG + Intergenic
968674205 4:1868790-1868812 TGCACCACTGCATTCCAATCTGG - Intergenic
969268032 4:6078535-6078557 TGCAGAACTGTAGTCTTTTTTGG - Intronic
970268871 4:14321352-14321374 AGCAGGGCTGAATTCCTTTCTGG + Intergenic
970360705 4:15306012-15306034 GGCAGAGCTGCATTTCATTCTGG - Intergenic
970453660 4:16199633-16199655 TGCACCACTGCATTCCATCCTGG - Intronic
970493362 4:16599227-16599249 AGCAGGGCTGAATTCCTTTCTGG + Intronic
970858760 4:20677936-20677958 GGCAGGGCTGCATTCCTTTCTGG - Intergenic
971188701 4:24406118-24406140 TGCAGCACTGCAGTCATTGCTGG - Intergenic
971285197 4:25282224-25282246 AGTAGGGCTGCATTCCTTTCTGG + Intergenic
971397886 4:26247014-26247036 TGCACCACTGCATTCCTGCCTGG - Intronic
971518467 4:27518348-27518370 TGCAGTGTTGCAGTCCTTTCTGG + Intergenic
971795326 4:31219586-31219608 GGCAGGGCTGCATTCTTTTCTGG + Intergenic
972039887 4:34579763-34579785 GGCAGGAGTGCATTCCTTTCTGG - Intergenic
972721160 4:41700453-41700475 TGCACCACTGCACTCCATTCTGG - Intergenic
973000499 4:44942734-44942756 GGCAGTGCTGCATTCCTCTCTGG - Intergenic
973196851 4:47454568-47454590 TGAAGAACTGCAATTCTGTCAGG + Intronic
973979944 4:56299624-56299646 TGCACCACTGCATGCCTTCCTGG + Intronic
974094747 4:57351091-57351113 TGCAGATCTGCATTTCTCTGGGG - Intergenic
974119582 4:57622854-57622876 TGCAGAGCTGAATTCAATTCTGG + Intergenic
974214202 4:58824010-58824032 GGCAGATCTTCATTCCCTTCTGG + Intergenic
975062524 4:70020073-70020095 AGCAGGACTGAATTCTTTTCTGG + Intergenic
975289349 4:72658703-72658725 TGAGGAACTGCATGGCTTTCTGG - Intergenic
975535838 4:75449141-75449163 TGCACAACTGCACTCCAGTCTGG - Intergenic
975548369 4:75584447-75584469 TGCAGGGCTGCATTATTTTCTGG - Intronic
975694499 4:76998406-76998428 CGCAGGGCTGCATTCCTTCCTGG + Intronic
976035072 4:80808741-80808763 TTCAGGACTGCATTCTTTTGAGG + Intronic
976044325 4:80927580-80927602 GGCAGAGCTGCATTTCTTTCCGG + Intronic
976508845 4:85883509-85883531 TGCAGAACTGGATGACTCTCTGG - Intronic
976621475 4:87132732-87132754 TGCAGCACTGCATTCCAGCCTGG - Intronic
976650653 4:87430262-87430284 AGCAGGGCTGCATTCCTCTCTGG - Intronic
976838899 4:89408037-89408059 GGCAGGGCTGCATTGCTTTCTGG - Intergenic
977382861 4:96298834-96298856 AGCAAAGCTGCATTCTTTTCTGG - Intergenic
977494736 4:97760848-97760870 TGCAAGGCTGCATTTCTTTCAGG + Intronic
977576942 4:98684966-98684988 AGCAGGGCTGCACTCCTTTCTGG + Intergenic
978355654 4:107869952-107869974 TGCAGCACTCCCTTCCTCTCTGG - Intronic
978362479 4:107946194-107946216 GACAGGGCTGCATTCCTTTCTGG + Intronic
978457560 4:108910904-108910926 TGAGAAACTGAATTCCTTTCAGG - Intronic
978997834 4:115178146-115178168 TGTAGAATTCCTTTCCTTTCTGG - Intergenic
979640662 4:123009986-123010008 TGCACAACTTCATATCTTTCTGG + Intronic
981969824 4:150654228-150654250 TGCACCACTGCACTCCATTCTGG - Intronic
982276918 4:153645328-153645350 GGCAGGGCTGCATTCCTTTCTGG + Intergenic
982673596 4:158350339-158350361 TGCCAGGCTGCATTCCTTTCTGG + Intronic
983302571 4:165946212-165946234 AGCAGAGCTGCATTCCATTCTGG - Intronic
983423473 4:167551202-167551224 TGCAGGACTGGGTTCCTTTCTGG - Intergenic
983591485 4:169416859-169416881 TGCACCACTGCACTCCATTCTGG + Intronic
984155398 4:176190518-176190540 GGCAGGGCTGCATTCCTTTCTGG + Intronic
984259590 4:177428381-177428403 TGCACCACTGCATTCCATTCTGG + Intergenic
985202677 4:187500303-187500325 TGCATAACTGCATAGCTTTAAGG + Intergenic
985241154 4:187932217-187932239 AGCATAACTGCAGTCCTTGCAGG - Intergenic
985535800 5:465166-465188 TGCAGAAGCGCATTTCCTTCCGG + Exonic
986650983 5:9963171-9963193 TGAAGAGCTGAATTCCCTTCAGG - Intergenic
986833296 5:11606253-11606275 TTCAGGCCTGCATTTCTTTCTGG - Intronic
987228483 5:15868299-15868321 AGGAGAGCTGCATTCTTTTCTGG - Intronic
987914101 5:24189351-24189373 GGTAGAGCTGCATCCCTTTCTGG + Intergenic
988139897 5:27223544-27223566 TGCAGGACTGAATACCATTCAGG - Intergenic
988183440 5:27828551-27828573 GGCAAAGCTGCATTCCTTGCTGG - Intergenic
988576699 5:32432770-32432792 TGCACCACTGCACTCCTTCCTGG - Intronic
988995050 5:36706659-36706681 GGCAGAGCTGAGTTCCTTTCTGG - Intergenic
989114515 5:37939452-37939474 GGCTGAACAGAATTCCTTTCTGG + Intergenic
989388290 5:40874712-40874734 TGCACCACTGCATTCCAGTCAGG + Intergenic
989397976 5:40978921-40978943 TGCACTACTGCATTCCAGTCTGG - Intronic
990271866 5:54150752-54150774 TGCACCACTGCATTCCATCCTGG + Intronic
990460340 5:56025736-56025758 TGCACCACTGCATTCCAGTCTGG - Intergenic
990930120 5:61079707-61079729 TGCAGAACTTCTTTCCTTGATGG + Intronic
991603229 5:68374114-68374136 AGAAGGGCTGCATTCCTTTCTGG - Intergenic
992809687 5:80374278-80374300 TGCACCACTGCATTCCACTCTGG - Intergenic
992815065 5:80428557-80428579 TGAGGAACTGCGTTCCTTTGGGG - Intronic
993161729 5:84300122-84300144 AGCAGGGCTGCATTCCCTTCTGG + Intronic
993166057 5:84356386-84356408 TCCAGAACTGCACTCCTTTCTGG + Intronic
993380838 5:87205427-87205449 TGCACCACTGCACTCCTGTCTGG - Intergenic
993917661 5:93762152-93762174 TGAGGAGCTGCATTCCTTTGAGG - Intronic
995328732 5:110922257-110922279 TTCAGCACTGCTTTACTTTCTGG + Intergenic
995404140 5:111774764-111774786 AGCAGGGCTGCATTCCTTTCTGG - Intronic
995774401 5:115710285-115710307 TGCAGGTCTGCATTTCTTTCTGG + Intergenic
995937330 5:117532639-117532661 TGAGGAACTGCGTTCCTTTGGGG + Intergenic
996271290 5:121607559-121607581 TGCACAACTGCACTCCATTCTGG + Intergenic
996407587 5:123121424-123121446 TGCACCACTGCACTCCTGTCTGG - Intronic
997007120 5:129831090-129831112 ATCAGAACTTCATTCCTTTCTGG - Intergenic
997261566 5:132469332-132469354 AGCAGGGCTGCATTCCTTCCTGG - Intronic
998305075 5:141068059-141068081 TGCAATACTACATTCCTTTCTGG + Intergenic
998634734 5:143940795-143940817 GGCAGGCCTGTATTCCTTTCTGG - Intergenic
999063159 5:148656486-148656508 TGTGGAGCTGCCTTCCTTTCTGG - Intronic
999147014 5:149403126-149403148 TGCATCACTGCATTCCAGTCTGG - Intronic
999218211 5:149954018-149954040 AGCAGAACTGCTGGCCTTTCCGG - Intergenic
999403513 5:151285899-151285921 GGCAGAGCAGCATTCCTTTCTGG - Intronic
999788157 5:154911093-154911115 TTGAGTACTGCCTTCCTTTCTGG + Intronic
1000136232 5:158354055-158354077 TGAAGAACTGCAATACTTTCTGG - Intergenic
1000792777 5:165627531-165627553 GGCAGAGCGGCATTTCTTTCTGG + Intergenic
1000793142 5:165631446-165631468 TGCACAACTGCATTCCAGCCTGG + Intergenic
1001104757 5:168843697-168843719 TGCTGTACTGCCTTCCTCTCTGG + Intronic
1001649386 5:173304595-173304617 TGCAGAACGACTTTCCCTTCTGG + Intergenic
1001886971 5:175301444-175301466 TCCAGCACTGCAGACCTTTCTGG + Intergenic
1001960796 5:175879349-175879371 TTCAGAACTGCACTCATTTTTGG - Intronic
1002444895 5:179284283-179284305 TGCATCACTGCACTCCATTCTGG + Intronic
1002756388 6:164527-164549 TGCAGAGCAGCATTCCCATCAGG - Intergenic
1003277338 6:4663968-4663990 TGCACCACTGCATTCCTGCCTGG + Intergenic
1003651097 6:7961193-7961215 TGCAGCACTGCATTCCAGCCTGG - Intronic
1003820499 6:9891236-9891258 TGAGAAACTGCATTGCTTTCAGG - Intronic
1004134877 6:12956980-12957002 TGCAAAAATGCAGTCCTTCCAGG + Intronic
1004187338 6:13432255-13432277 TGCACAACTGCATTCCAGCCTGG - Intronic
1004228362 6:13808982-13809004 TGCACCACTGCATTCCATCCTGG - Intronic
1004372383 6:15063652-15063674 TGCAGCACTGCATTCCAGTCTGG - Intergenic
1004557232 6:16710931-16710953 TGCAGCATTGCATTCCATCCTGG - Intronic
1005234021 6:23738840-23738862 TGCACCACTGCATTCCAGTCTGG + Intergenic
1005309903 6:24549280-24549302 TGCACCACTGCATTCCAGTCTGG + Intronic
1006355146 6:33551706-33551728 TGCACCACTGCATTCCTGCCTGG - Intergenic
1007246245 6:40465230-40465252 GGCAGAGCTACATTCCTTTCAGG - Intronic
1007774704 6:44218603-44218625 TGCAGAAATGCATCCCCTTGAGG + Intergenic
1008349279 6:50470927-50470949 TCCTGAACTGCAATACTTTCAGG + Intergenic
1008416709 6:51249207-51249229 AGCAAAGCTGCATTCCTTTCAGG + Intergenic
1008881553 6:56385354-56385376 GGCAGAGCTGCATTCCTTTCTGG + Intronic
1009996026 6:70896019-70896041 TGAACAACTGCTTTCCTTTCAGG + Intronic
1010162486 6:72873415-72873437 TGCAGAACTGCTTTACTTACTGG - Intronic
1010365666 6:75048844-75048866 TGCAGGGCTTCATTACTTTCTGG + Intergenic
1010646071 6:78389105-78389127 AGCAGGACTACATTCCTTTCTGG + Intergenic
1010812622 6:80317347-80317369 AACAGAGCCGCATTCCTTTCTGG + Intronic
1011146975 6:84228230-84228252 TTCAAAACTGCATTCTTTACTGG + Intergenic
1011413407 6:87090679-87090701 TGCATGACTGCATTCCATCCTGG - Intronic
1011427746 6:87249168-87249190 TGCAGCACTGCACTCCAGTCTGG - Intronic
1011823953 6:91284532-91284554 TGCAGGGCTGCATTTCTTTCTGG - Intergenic
1012037118 6:94156419-94156441 AACAGAGCTGCATTCCCTTCAGG + Intergenic
1012076864 6:94698935-94698957 GGCAGAACTGAATGCCTTCCAGG - Intergenic
1012291064 6:97456302-97456324 TGCACAACTGCCTTACTTGCTGG + Intergenic
1012382964 6:98642143-98642165 TCCAGGACTGAATTCCTTTCTGG + Intergenic
1012435560 6:99211653-99211675 GGCAGGGCTGCATTCCTTTCTGG + Intergenic
1012466500 6:99521906-99521928 TGCAGCACTGCATTCCAGCCTGG - Intergenic
1012738759 6:102985685-102985707 AGAAGAACTGCATTTCTTTCTGG - Intergenic
1012780655 6:103552755-103552777 TGCAGACCTGTGTTTCTTTCTGG - Intergenic
1013027950 6:106298006-106298028 CGCACAACTGCATTCCATCCTGG - Intronic
1013128366 6:107207653-107207675 TGCACAACTGCACTCCATCCTGG - Intronic
1013220370 6:108072799-108072821 TGCACTACTGCACTCCTTCCTGG - Intronic
1013525327 6:110968791-110968813 GGCAGGAATGCATTCCTTTATGG + Intergenic
1013564798 6:111347223-111347245 TGCACCACTGCACTCCATTCTGG + Intronic
1013945580 6:115718366-115718388 AGCAGGGCTGTATTCCTTTCTGG - Intergenic
1014391776 6:120873119-120873141 AGAAGAGCTGCATTCCTTTGGGG + Intergenic
1014592470 6:123291111-123291133 TGCACAACTGCACTCTTGTCTGG + Intronic
1014617231 6:123618258-123618280 TTCAGGGCTACATTCCTTTCTGG + Intronic
1014884267 6:126760506-126760528 TGCAGATCTACACTCCTTTGAGG - Intergenic
1016824614 6:148376822-148376844 TGCAGCACTGCATTCCAGCCTGG + Intronic
1017533575 6:155322315-155322337 AGCAGGGCTGCCTTCCTTTCTGG - Intergenic
1017692688 6:156983049-156983071 TGCACAACTGCACTCCAGTCCGG + Intronic
1017815224 6:158011334-158011356 AGCAGAACTTCATTCTCTTCTGG - Intronic
1018888706 6:167965237-167965259 TGCAGAAGAGCAGTCCTTCCTGG - Intronic
1019156747 6:170044423-170044445 GGCAGCACTGCCTTCATTTCAGG + Intergenic
1019964462 7:4487381-4487403 TGCATCACTGCATTCCAGTCTGG - Intergenic
1020613667 7:10432096-10432118 TACAGGGCTGCATTCCTTCCAGG + Intergenic
1020744481 7:12064669-12064691 AGCAGGGTTGCATTCCTTTCTGG - Intergenic
1021160316 7:17264518-17264540 AGCAGAGCTGCATTCCTTTTTGG - Intergenic
1021421108 7:20445584-20445606 GACAGAGGTGCATTCCTTTCCGG + Intergenic
1021620276 7:22544435-22544457 AGCAGGACTGCATTCCTTTCTGG + Intronic
1021969837 7:25954607-25954629 AGCAGGGGTGCATTCCTTTCTGG + Intergenic
1021996551 7:26183502-26183524 TGCACCACTGCACTCCATTCTGG + Intronic
1022287569 7:28968753-28968775 GGCAGGATTGCATTTCTTTCCGG - Intergenic
1022349321 7:29552554-29552576 GGCAGGACTGCATTCCTTTATGG + Intergenic
1022407550 7:30105438-30105460 TGCACTACTGCATTCCTTTCTGG + Intronic
1023067946 7:36397865-36397887 TGCACCACTGCATTCCATCCTGG + Intronic
1023427898 7:40058488-40058510 TGCACCACTGAATTCCATTCAGG + Intronic
1023726719 7:43150420-43150442 TGCACCACTGCACTCCTGTCTGG - Intronic
1024284132 7:47742696-47742718 TGCACCACTGCATTCCAGTCTGG - Intronic
1024445165 7:49469248-49469270 TGCAGAGCTGCCTGCCATTCTGG - Intergenic
1024559619 7:50632121-50632143 GGCAGAATTACATTCCTTTTTGG - Intronic
1025631445 7:63276394-63276416 TGCACAACTGCACTCCAGTCCGG + Intergenic
1026012904 7:66650750-66650772 TGCACAACTGCATTCCAGCCTGG + Intronic
1026173907 7:67978711-67978733 GGCAGAGCTGCATCCCTTTCTGG - Intergenic
1026241363 7:68578219-68578241 AGCACCACTGCACTCCTTTCTGG + Intergenic
1026577760 7:71587923-71587945 TGCAGAACATCCTTGCTTTCTGG + Intronic
1026695084 7:72584088-72584110 TGCACAACTGCACTCCAGTCTGG - Intronic
1026974972 7:74492045-74492067 TGCACCACTGCATTCCAGTCTGG - Intronic
1027233183 7:76283414-76283436 TGCAGAGCTGAATTCCATGCCGG - Intronic
1027464817 7:78502417-78502439 GGCAGAGCTGTGTTCCTTTCCGG - Intronic
1028495715 7:91457463-91457485 GGCAGCACTGTGTTCCTTTCTGG - Intergenic
1028527643 7:91803030-91803052 GGCACAGCTGCATTCCTTTCTGG + Intronic
1028534164 7:91873233-91873255 AGCAAGGCTGCATTCCTTTCTGG + Exonic
1028577468 7:92368110-92368132 TGCACCACTGCATTCCAGTCTGG + Intronic
1028720754 7:94028047-94028069 AGCAGGACTGCATTCCTTCCTGG - Intergenic
1028729839 7:94133590-94133612 TGCAGAACCACACTCATTTCTGG - Intergenic
1029484991 7:100834822-100834844 TGCACCACTGCATTCCAGTCTGG + Intronic
1030548402 7:110927684-110927706 AGCAAAGCTGCATTCTTTTCTGG - Intronic
1030924106 7:115430377-115430399 TGCACCACTGCATTCCTATCTGG - Intergenic
1030979272 7:116167054-116167076 GGCAGGGCTGTATTCCTTTCTGG - Intergenic
1032064499 7:128755950-128755972 TACAGGACTGCATGCATTTCTGG + Intronic
1032921518 7:136554086-136554108 TGCACAATTGCATTTCATTCTGG - Intergenic
1033183581 7:139204286-139204308 GGCAGGACTGCATTCCTTTCTGG - Intergenic
1033652051 7:143351169-143351191 TGGAGAATTCCATTCCCTTCAGG - Intronic
1033982135 7:147178410-147178432 GGCAGGACTACATTCCTTTCTGG - Intronic
1034644372 7:152631847-152631869 TGCAGCACTGCATTCCAGCCTGG + Intergenic
1034923366 7:155101713-155101735 TGCAGGGCTGCATGCCTTTCTGG + Intergenic
1035159308 7:156939495-156939517 TCCAGAAATGCATATCTTTCTGG - Intergenic
1036527266 8:9546819-9546841 TGCACAACTGCATTCCAACCTGG + Intergenic
1037072070 8:14663040-14663062 GGCAGAACTGCATTTCTTTCTGG - Intronic
1037379268 8:18266910-18266932 GGCAGAACTGAATTCCTCACAGG - Intergenic
1037964813 8:23125930-23125952 TGCAGCACTGCATTCCAGCCAGG + Intergenic
1038292462 8:26262163-26262185 TGCAGGCCTGAATTGCTTTCAGG + Intergenic
1038344637 8:26720800-26720822 TGCAGCACTGCACTCCAGTCTGG + Intergenic
1038932867 8:32214597-32214619 TGCACCACTGCATTCCATCCTGG + Intronic
1039039391 8:33392935-33392957 TGCACCACTGCATTCCCTCCTGG + Intronic
1039101469 8:33946527-33946549 AGCAGGACTGCATTCCCTTCTGG + Intergenic
1039146244 8:34450789-34450811 TGAGGAGCTGCATTCCTTTGGGG + Intergenic
1039714640 8:40094111-40094133 TGGAGAACTTCCTTGCTTTCTGG + Intergenic
1039855694 8:41411142-41411164 GGCATAACTGCATACCTATCTGG - Intergenic
1039915181 8:41854902-41854924 TGCATCACTGCATTCCATCCTGG + Intronic
1040072941 8:43203006-43203028 TGCACAACTGCATTCCAGCCTGG + Intergenic
1041636075 8:60146521-60146543 AGCTGGGCTGCATTCCTTTCTGG + Intergenic
1042440295 8:68818273-68818295 TGAATAACTGCATTTCTTTAAGG - Exonic
1042556830 8:70040743-70040765 TGAAAAGCTGCATTCTTTTCAGG - Intergenic
1043669574 8:82865202-82865224 TGCCGGACTGCATTCCTTTTAGG + Intergenic
1044270705 8:90239810-90239832 GGCAGGGCTGCATTCCTTACTGG - Intergenic
1044501241 8:92960760-92960782 GACAGGGCTGCATTCCTTTCTGG - Intronic
1044796188 8:95900539-95900561 GACAGAGCTGCATTCTTTTCTGG + Intergenic
1044875240 8:96658868-96658890 GGCAGGACTGCATCCCTTTCTGG - Intronic
1045280749 8:100747545-100747567 GGCACCACTGCATTCCATTCCGG + Intergenic
1045352158 8:101351565-101351587 TGCACCACTGCACTCCATTCTGG + Intergenic
1045635200 8:104178184-104178206 GGCAGGACTACATTCCTTTCTGG + Intronic
1045840648 8:106577252-106577274 TGCACCACTGCATTCCAGTCTGG - Intronic
1045939033 8:107716967-107716989 TGAGGAGCTGCATTCCTTTGGGG + Intergenic
1046358751 8:113122712-113122734 ATCAGAGCTGCATTCCTTTCTGG - Intronic
1046803173 8:118451146-118451168 TTCAGAACTGCATTCAGTCCAGG + Intronic
1046966429 8:120172192-120172214 TGCACTACTGCACTCCTGTCTGG - Intronic
1047301238 8:123615092-123615114 TGCAGCACTGCATTCCAGCCTGG + Intergenic
1047436154 8:124836858-124836880 GGCAGGGCTGCATTCCTCTCTGG + Intergenic
1047809712 8:128395386-128395408 TAATGAACTGCATTTCTTTCTGG - Intergenic
1047919316 8:129617529-129617551 AGCAGGGCTGCATTCCTTTCTGG - Intergenic
1048347836 8:133591044-133591066 TGCACCACTGCACTCCATTCTGG + Intergenic
1048519077 8:135137265-135137287 GGCAGGGCTGCACTCCTTTCTGG - Intergenic
1049690440 8:143956522-143956544 TGCGCCACTGCATTCCTGTCTGG + Intronic
1050982233 9:12035227-12035249 ATCAGGGCTGCATTCCTTTCTGG - Intergenic
1051160015 9:14197159-14197181 TCAAGCTCTGCATTCCTTTCTGG - Intronic
1051303752 9:15684687-15684709 TGCTGAACTGAATGCATTTCTGG - Intronic
1051542987 9:18241462-18241484 TGCAGTAGAGCCTTCCTTTCAGG + Intergenic
1051599425 9:18857895-18857917 TTAAGAACTTCATTACTTTCTGG + Intronic
1051880441 9:21834505-21834527 AGCACGGCTGCATTCCTTTCTGG + Intronic
1052016860 9:23479101-23479123 TGCAGAACTGTGTTCCTTACTGG + Intergenic
1053401709 9:37829957-37829979 TGCACCACTGCATTCCAGTCTGG + Intronic
1054712794 9:68528286-68528308 TGCATAACTGCATTCCAACCTGG - Intronic
1054742553 9:68822916-68822938 TGCAGAGCTGTATTCCTTCCTGG + Intronic
1054840140 9:69729726-69729748 TGCAGACCTGCTTTGCATTCTGG - Intronic
1054972400 9:71103956-71103978 TGCACCATTGCATTCCATTCTGG - Intronic
1055490195 9:76796852-76796874 TGCAGAACTTCAGTCTTTTCTGG + Intronic
1055737150 9:79342721-79342743 TGCACCACTGCAGTCCTGTCTGG + Intergenic
1055955342 9:81768212-81768234 GGCACAGCTACATTCCTTTCTGG + Intergenic
1056479075 9:86982593-86982615 GGCAGAGTTGCATTCCTTTCTGG - Intergenic
1056914747 9:90736205-90736227 GGCAGAGATGCATTCCTCTCTGG - Intergenic
1057074170 9:92126761-92126783 TGCACCACTGCATTCCATCCTGG + Intergenic
1057525770 9:95799189-95799211 TGCAGAACTGCACTCCAGCCTGG + Intergenic
1057625315 9:96671252-96671274 TGCAGCACTGCACTCCAGTCTGG - Intergenic
1058860918 9:109117151-109117173 TGCACCACTGCACTCCATTCTGG - Intronic
1058962447 9:110005066-110005088 TGGTGAGCTGCATTCCTTTGGGG + Intronic
1059231677 9:112726593-112726615 TGCAGCAGAGCATTCATTTCAGG - Intergenic
1059710003 9:116858982-116859004 GGCAGGGTTGCATTCCTTTCTGG + Intronic
1059724146 9:116989625-116989647 TGCACAATTGCATTCCAATCTGG - Intronic
1059765004 9:117375819-117375841 AGCAGGGCTGCATTCCCTTCTGG + Intronic
1059894176 9:118841910-118841932 GGTAGAACTTGATTCCTTTCTGG + Intergenic
1060014506 9:120075038-120075060 TGCATCACTGCATTCCAGTCTGG - Intergenic
1060501625 9:124161629-124161651 TGCACCACTGCATTCCATCCTGG - Intergenic
1060950035 9:127595644-127595666 TGCAGCACTGCACTTCATTCTGG + Intergenic
1061166906 9:128928237-128928259 TGCACAGCTGCCTTCCATTCGGG + Intronic
1062112838 9:134791465-134791487 TGCAGCACTGCCTGGCTTTCTGG + Intronic
1062438557 9:136558200-136558222 TGCACCACTGCATTCCAGTCTGG - Intergenic
1185867026 X:3633207-3633229 TGCACCACTGCATTCCAATCTGG + Intronic
1186081192 X:5934569-5934591 GGCAGGGCTGCATTCCTTTCTGG - Intronic
1186322688 X:8446967-8446989 TTCAGAAATGGATTCCTTTCGGG - Intergenic
1186489329 X:9959343-9959365 AGCAGAGCTGTGTTCCTTTCTGG + Intergenic
1186554085 X:10538655-10538677 AGCAAAACTGGATTCCTTTTTGG + Intronic
1186650345 X:11553283-11553305 TGCAGCACTGCATTCCAGCCTGG - Intronic
1186676059 X:11818577-11818599 AGCAGGGCTGCATTCCTTTCTGG - Intergenic
1186965710 X:14784313-14784335 AGCAGAGCTGCATTCCTTTCTGG + Intergenic
1187077331 X:15948116-15948138 TGCAGGGCTGCATTCCTTCTGGG + Intergenic
1187091411 X:16100904-16100926 TGCAGAACTGAATTGGCTTCTGG + Intergenic
1187213907 X:17255861-17255883 CGCAGAACTCCATTTCATTCAGG - Intergenic
1187800668 X:23059277-23059299 AGCAGGGCTGCATTCCTTTTTGG + Intergenic
1188138481 X:26519168-26519190 AGCAGGGCTACATTCCTTTCTGG - Intergenic
1188200327 X:27288251-27288273 TGAAGAACTTCTTTACTTTCTGG - Intergenic
1188400209 X:29735121-29735143 GGCAGGGCTGCATCCCTTTCTGG + Intronic
1188480414 X:30631202-30631224 GGCAAGGCTGCATTCCTTTCTGG - Intergenic
1188518376 X:31011699-31011721 ATCAGAACTTCATTCCTTTATGG - Intergenic
1188551243 X:31367123-31367145 TGTAGAACGGTATTCCATTCTGG + Intronic
1188830284 X:34888188-34888210 TGGAACACTGCATTACTTTCTGG + Intergenic
1188915928 X:35910936-35910958 CGCAGAGCTACACTCCTTTCTGG + Intergenic
1189517658 X:41731374-41731396 TGCACCACTGCATTCCTGCCTGG + Intronic
1190190084 X:48269753-48269775 TGCAGAACTGCACTCCAACCTGG - Intronic
1190257524 X:48774664-48774686 TGCACCACTGCACTCCTTCCTGG + Intergenic
1192591148 X:72360309-72360331 TGCACCACTGCATTCCAATCTGG + Intronic
1192827429 X:74712500-74712522 TGCACCACTGCATTCCAGTCTGG + Intergenic
1192851748 X:74963841-74963863 GGCTGAGGTGCATTCCTTTCTGG + Intergenic
1193079979 X:77397290-77397312 AGCAGGGCTGCATTCATTTCTGG + Intergenic
1193090796 X:77492305-77492327 AGCAGAACTGTGTTCCTTTTTGG + Intergenic
1193095951 X:77549339-77549361 TGCAGCACTGCACTCCATCCTGG + Intronic
1193141109 X:78028064-78028086 TGCACCACTGCATTCCTGCCTGG - Intronic
1193150052 X:78115608-78115630 TGCAGCACTGCATTCCAGCCTGG + Intronic
1193700431 X:84753952-84753974 TGCACTACTGCATTCCATCCTGG + Intergenic
1194129242 X:90059707-90059729 GGCAGAGTTGCATTCTTTTCTGG - Intergenic
1194354972 X:92871695-92871717 TGCAGGAGTGCATTTCTTTCTGG + Intergenic
1194581980 X:95684595-95684617 GGCAGAGCTGCATTCCTTTCTGG - Intergenic
1194754931 X:97727710-97727732 GTCATAGCTGCATTCCTTTCTGG - Intergenic
1195026527 X:100883060-100883082 GACAGGGCTGCATTCCTTTCTGG - Intergenic
1195426534 X:104738894-104738916 TGCACCACTGCATTCCATCCTGG + Intronic
1195433459 X:104815314-104815336 GGCAGGGCTGCATTCTTTTCTGG + Intronic
1195491399 X:105474300-105474322 AGCAGGGCTGCATACCTTTCTGG - Intronic
1195622764 X:106973854-106973876 GGCAGGGCTGCATTCCTTTCTGG - Intronic
1195637328 X:107132972-107132994 GGCAGGAATGCATTCCTTTATGG + Intronic
1196057336 X:111369812-111369834 TGCTGAAGGGCATTCTTTTCTGG + Intronic
1196123545 X:112075917-112075939 AGCAGGACTGCCTTCCCTTCTGG - Intronic
1196127881 X:112118926-112118948 TGCACAACTGCACTCCAGTCTGG - Intergenic
1196579740 X:117364756-117364778 AGCAGGGCTGCATTCCTTTCTGG + Intergenic
1196583566 X:117403703-117403725 TTAAGAACTGCTTTACTTTCTGG + Intergenic
1196595430 X:117540615-117540637 AGCAGAGCTGTATTCCTTTTTGG + Intergenic
1196596429 X:117551100-117551122 GACAGGACTGCATTCCCTTCTGG - Intergenic
1196873558 X:120136207-120136229 TGCCGAAATGCTTTCTTTTCAGG - Intergenic
1197704239 X:129622573-129622595 CGCACTACTGCATTCCATTCTGG + Intergenic
1198194647 X:134347877-134347899 TGAAGAACTCCATTCAGTTCAGG - Intergenic
1198508879 X:137328961-137328983 TGCACCACTGCATTCCAGTCTGG + Intergenic
1198540089 X:137628857-137628879 TGCACCACTGCATTCCATCCTGG - Intergenic
1198549155 X:137726535-137726557 TGCACAACTGCATTCCAGCCTGG - Intergenic
1198651767 X:138870945-138870967 GGCAGGGCTGCATTCCTTTTTGG - Intronic
1199046197 X:143176602-143176624 TGAAAAACTGCATGCTTTTCTGG + Intergenic
1199108399 X:143900197-143900219 TGCACACCTGCATTCCCTTTTGG - Intergenic
1199389940 X:147267698-147267720 TGCACCACTGCATTCCATCCTGG + Intergenic
1200184443 X:154173018-154173040 TGCACCACTGCACTCCATTCTGG - Intergenic
1200190095 X:154210156-154210178 TGCACCACTGCACTCCATTCTGG - Intergenic
1200195848 X:154247958-154247980 TGCACCACTGCACTCCATTCTGG - Intergenic
1200201502 X:154285076-154285098 TGCACCACTGCACTCCATTCTGG - Intronic
1200404781 Y:2798690-2798712 TGCACCACTGCATTCCAGTCTGG + Intergenic
1200663331 Y:5988710-5988732 TGCAGGAGTGCATTTCTTTCTGG + Intergenic
1201262314 Y:12171620-12171642 TGCAGAACTGAATTCAATTCCGG - Intergenic
1201358744 Y:13123432-13123454 TGCACAACTGCATTCCGGCCTGG - Intergenic
1201665109 Y:16442728-16442750 TGCACAACTGCACTCCTGCCTGG + Intergenic