ID: 1157328079

View in Genome Browser
Species Human (GRCh38)
Location 18:46683518-46683540
Sequence CTGAGGGCAGAGAGGGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1468
Summary {0: 1, 1: 1, 2: 18, 3: 158, 4: 1290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157328070_1157328079 16 Left 1157328070 18:46683479-46683501 CCGGTGACTGGAGCACAGGCAAG 0: 1
1: 0
2: 2
3: 35
4: 204
Right 1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG 0: 1
1: 1
2: 18
3: 158
4: 1290
1157328069_1157328079 17 Left 1157328069 18:46683478-46683500 CCCGGTGACTGGAGCACAGGCAA 0: 1
1: 0
2: 1
3: 26
4: 195
Right 1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG 0: 1
1: 1
2: 18
3: 158
4: 1290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157328079 Original CRISPR CTGAGGGCAGAGAGGGAAGA AGG Intronic
900482646 1:2906681-2906703 CTCAGGGGAGGGAGGGAGGAAGG + Intergenic
900681674 1:3920129-3920151 ATGGAGGGAGAGAGGGAAGAAGG - Intergenic
900740409 1:4327569-4327591 CTGTGGGCAGTGTGGGGAGAAGG - Intergenic
900763010 1:4485607-4485629 CTGACGGCTGAGAGGGAGGAAGG + Intergenic
900827371 1:4937580-4937602 CTAAGGACAGAAAGGGAACAAGG + Intergenic
900950264 1:5854656-5854678 CTGGGGGCTGTTAGGGAAGAAGG - Intergenic
901149869 1:7094104-7094126 CTAAAGGCAGAGGGTGAAGACGG + Intronic
901445567 1:9305937-9305959 ATGAGTGCAGAGAGGCAGGAGGG + Intronic
901454415 1:9354918-9354940 GTGAGGCCAGAGAGGGAACGAGG + Intronic
901726512 1:11247109-11247131 CTGAGGGCTATGATGGAAGAAGG + Intronic
901787105 1:11632016-11632038 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
901855038 1:12039139-12039161 CTGAGGACAGGGAGGGAGGAGGG + Intergenic
901909068 1:12439735-12439757 AGGAGGGAAGAAAGGGAAGAAGG + Intronic
902107056 1:14046707-14046729 CTGAGTGCAGGTAAGGAAGAGGG - Intergenic
902149952 1:14435118-14435140 TGGAGGGCAGACAGGGCAGAGGG - Intergenic
902393781 1:16121015-16121037 ATGATGGCAGAGAGGGGAGAGGG + Intergenic
902606804 1:17573563-17573585 CTGGGGGCTGGGAGGGAAGGAGG + Intronic
902873116 1:19326023-19326045 CTGAGGGCAGGGAGGTCAGGAGG - Intronic
902994042 1:20210059-20210081 GTGGGGGCAGAGAGGGGAGCTGG + Intergenic
903002398 1:20275569-20275591 CTGAGGGGAGGAGGGGAAGAGGG + Intergenic
903140783 1:21338050-21338072 GGGAGGGCAGAGGGGGCAGAAGG - Intronic
903216810 1:21847935-21847957 GTGAGAGCAGAGAGGGCAGGGGG - Intronic
903406336 1:23099927-23099949 GTGAGGGACCAGAGGGAAGAGGG - Intronic
903433955 1:23332123-23332145 CTGAATGGAGAGAGGGGAGAGGG + Intronic
903535820 1:24065550-24065572 CTGAGGTCAGAGAGCGACGGGGG + Intronic
903535869 1:24065937-24065959 CAGAGGGCAGAGATGCCAGATGG - Exonic
903583466 1:24390071-24390093 CAGATGGCAGAGAGGGAATGAGG - Intronic
903827856 1:26158352-26158374 GTGTGGGCAGAGAAGGAAGCGGG + Intergenic
903916980 1:26771826-26771848 GTGAGCCTAGAGAGGGAAGAAGG + Intronic
903993089 1:27288036-27288058 AGGAGGGCAAAGAGGGAGGAAGG - Intronic
904459538 1:30667970-30667992 CTAAAAGCAGAGAGGGCAGAAGG - Intergenic
904480732 1:30791713-30791735 GAGAAGGAAGAGAGGGAAGAAGG + Intergenic
904703343 1:32372251-32372273 CTGAAGGCACAGAGGGATGTAGG - Intronic
904793947 1:33044843-33044865 CTTAGGGAAGAGAGGGAAGAAGG + Intronic
905106350 1:35565690-35565712 GGGCGGGCAGAGAGGGAAGGAGG + Exonic
905276872 1:36824161-36824183 CTGGAGGCAGGGTGGGAAGAAGG + Intronic
905365022 1:37446213-37446235 GAGAGAGGAGAGAGGGAAGAGGG - Intergenic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905596721 1:39214087-39214109 CTGAAGGCAGGGAGGGAGGAGGG - Intronic
905874242 1:41422237-41422259 ATGAGGTCAGAGAGCGAAGGAGG + Intergenic
905932274 1:41797458-41797480 CTGAGAGGAGGGAGGAAAGACGG + Intronic
906033330 1:42736604-42736626 CTGAAGGCAGAGAAGGAACAGGG - Intronic
906537038 1:46556738-46556760 GGGATGGCAGAGAGGGGAGATGG - Intergenic
906662137 1:47590573-47590595 CTGAGGATAGAGAGGGAGGCTGG + Intergenic
907468324 1:54654219-54654241 CTTAGGGCAGGGAGAGGAGAAGG + Intronic
907827495 1:58032885-58032907 CTGAGGGCAGAGAAGTAGGCAGG - Intronic
907886300 1:58595019-58595041 TTGAGGGCAGAGGGGAGAGATGG + Intergenic
907937570 1:59056565-59056587 ATGAGGTCAGAGAGGTAACAGGG + Intergenic
907947446 1:59148231-59148253 ATGAGGCCAGAGAGGTAAAAGGG + Intergenic
908063131 1:60372995-60373017 CTCATGGCAGAAAGTGAAGAGGG - Intergenic
908080128 1:60568309-60568331 GAGAGGGGAGAGAGGGAGGAGGG - Intergenic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
908833514 1:68205523-68205545 CTCAGGGCAGTGCTGGAAGAAGG - Intronic
909278069 1:73714265-73714287 CAAAGGTGAGAGAGGGAAGAAGG + Intergenic
909440013 1:75686547-75686569 ATGAGGTCAAAGAGGTAAGAAGG + Intergenic
909461222 1:75916684-75916706 CAGAGGGTGGAGATGGAAGAGGG + Intergenic
909706919 1:78596517-78596539 CAGGAGGCAGAGTGGGAAGAGGG - Intergenic
909783488 1:79580208-79580230 CTGAGGGTAGAGAGAAATGAGGG - Intergenic
910474828 1:87595635-87595657 AGGAGGGAAGGGAGGGAAGAGGG - Intergenic
910489486 1:87753099-87753121 AGGAGGGAAGAGAGGGAGGAAGG - Intergenic
910855327 1:91689152-91689174 CTGAGGGGAGGGTGAGAAGAAGG - Intronic
911355157 1:96808379-96808401 ATGAGGACACAGGGGGAAGATGG - Intronic
912518564 1:110230566-110230588 GGGAGGGAAGAGAGGGAAGGAGG - Intronic
912600122 1:110922328-110922350 CTGATATGAGAGAGGGAAGAAGG - Intergenic
912630145 1:111239717-111239739 TGGAGGGCAGAGAGGAATGATGG - Intronic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912703454 1:111895207-111895229 GTGAGGACGGAGAGGGAGGAGGG + Intronic
912714830 1:111975712-111975734 ATGAGGCCAGAGAGGTAACAGGG - Intronic
912860760 1:113211768-113211790 CAGAGGACAGGGAGGGGAGATGG + Intergenic
912947110 1:114094479-114094501 CTCTGGGCTGAGAGGGAAGGGGG + Intronic
913320219 1:117582721-117582743 CTGTGGGCAGTGGGGGAGGATGG + Intergenic
913367369 1:118055115-118055137 CTGTGGGCAGAAGGGGAAGATGG - Intronic
913498479 1:119449500-119449522 CTGAGGGCAAAGAAGGAAGAAGG - Intergenic
913509512 1:119549153-119549175 CTGAGGGCAATGAAGGAAGCAGG - Intergenic
913516950 1:119612968-119612990 CTGAGGTCAGTGAAGGAAGCAGG - Intergenic
913960108 1:143332872-143332894 CTGAGAGCAGAGGGTGAGGAGGG - Intergenic
913963612 1:143357141-143357163 AAGAGAGGAGAGAGGGAAGAGGG - Intergenic
913996599 1:143655909-143655931 CTGAAGACACAGTGGGAAGACGG - Intergenic
914054464 1:144158445-144158467 CTGAGAGCAGAGGGTGAGGAGGG - Intergenic
914057972 1:144182730-144182752 AAGAGAGGAGAGAGGGAAGAGGG - Intergenic
914121174 1:144783635-144783657 AAGAGAGGAGAGAGGGAAGAGGG + Intergenic
914124682 1:144807916-144807938 CTGAGAGCAGAGGGTGAGGAGGG + Intergenic
915327531 1:155088363-155088385 GGGAGGGCAGAGAGGACAGAAGG + Intergenic
915334116 1:155130498-155130520 GAGAGGGGAGAGAGGGGAGAGGG + Intronic
915510705 1:156385532-156385554 CTCTGAGCAGAGAAGGAAGAGGG + Intergenic
915730810 1:158052882-158052904 CAGAAGGCAGAGAGGGGAGCTGG + Intronic
915732749 1:158065834-158065856 CTGAGGGGAAAGAGGGCAGGCGG - Intronic
915895343 1:159807576-159807598 CTGAGGGTAGAGATGGAGGCTGG + Intronic
916313079 1:163418222-163418244 GGGAGGGAAGACAGGGAAGATGG + Intergenic
916816317 1:168356622-168356644 CTCAAGGAAGGGAGGGAAGAAGG - Intergenic
917135718 1:171786441-171786463 CTGAGGGTATAAATGGAAGAGGG + Intronic
917231753 1:172845276-172845298 ATGAGTGCAGAGGGAGAAGAGGG - Intergenic
917468836 1:175308383-175308405 CTGAGAGCAGAAAGGGGACAAGG - Intergenic
917664358 1:177209368-177209390 ATTAGGGCAGAGAGTGAGGATGG + Intronic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
918522954 1:185434965-185434987 GAGAGGGAAGAGAGGGAAGAGGG - Intergenic
918742754 1:188156053-188156075 CATGGGGCAGTGAGGGAAGAAGG + Intergenic
919104419 1:193131193-193131215 GTGAGGGCAGAAGGGAAAGAGGG - Intronic
919118968 1:193315306-193315328 GTCAGGGAAGAGAAGGAAGAAGG - Intergenic
919394314 1:197025128-197025150 GGGAGGGGAGAAAGGGAAGAGGG - Intergenic
919470588 1:197974292-197974314 CTGAGGGCAGGGAAAGTAGAAGG + Intergenic
919825818 1:201502400-201502422 CTGAGGGCAGAGAGAGGAGGGGG + Intronic
919981416 1:202644559-202644581 CTGAGGGGAGAGGGCGAGGATGG - Intronic
919982483 1:202650962-202650984 CACTGGGCAGAGTGGGAAGAAGG + Intronic
920370943 1:205478955-205478977 GGGAGGGCAGGGAGGGAGGAGGG + Intergenic
920535173 1:206732436-206732458 GTGGGAGCAGAGAGAGAAGACGG - Intronic
920558008 1:206918353-206918375 GTGAGGGGAGAGAGGGAGGGAGG - Intronic
920961984 1:210671590-210671612 TTGAGAGGACAGAGGGAAGAAGG + Intronic
921258413 1:213363432-213363454 ATGATGGCAGAGTTGGAAGATGG - Intergenic
921308142 1:213817306-213817328 CAGAGGCCAGAGAAGGAAGGCGG + Intergenic
921325866 1:213985839-213985861 CGGAGAGCAGAGAAGGAGGAGGG - Intronic
921912729 1:220568477-220568499 ATGAGGGCAGAAAGGTAATAGGG + Intronic
922224240 1:223631490-223631512 AAGAGGTCAGAGAGGGATGAGGG - Intronic
922333696 1:224600902-224600924 GTGAAGGCACAGAGGGAAGGTGG + Intronic
922580733 1:226695881-226695903 ATGAGGGAAGAGAGGGAAGCGGG + Intronic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
923006221 1:230052186-230052208 GTGAGGACACAGAGAGAAGATGG + Intergenic
923035049 1:230279809-230279831 CTGAGGACAGGGCGGGAGGAGGG + Exonic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923374599 1:233348149-233348171 CCTAGGGCTGAGAGGGAAGGGGG - Intronic
923452866 1:234136175-234136197 AGGAGGGAAGGGAGGGAAGAAGG - Intronic
923783697 1:237048047-237048069 CTGGGGTCCGAGAGGCAAGAGGG - Intronic
923844431 1:237713165-237713187 CTGATGGAAAAGAGGGAAAAGGG - Intronic
924449624 1:244165786-244165808 CTGAGGGCAGAAAAAGATGAAGG + Intergenic
1062819709 10:525640-525662 CTGAGGACAGGGAGAGAACAGGG + Intronic
1062951214 10:1505333-1505355 ATGACAGCACAGAGGGAAGATGG + Intronic
1063038614 10:2314760-2314782 CTCAGGGGATAGAGAGAAGAGGG + Intergenic
1063343948 10:5294242-5294264 CTGAGAGCAGAAAGGGAAGCTGG - Intergenic
1063365188 10:5486336-5486358 CTGCGGGAAGAAAGGGAAGGAGG + Intergenic
1063566760 10:7177933-7177955 GTGAGGGCAGAGGGAGAAGGTGG + Intronic
1063588303 10:7372842-7372864 CTGAGGCCAGACAAGGAGGATGG - Intronic
1063614576 10:7590859-7590881 CTGAGGGCAGCGAGGGGCCATGG - Intronic
1064165304 10:12980522-12980544 CACAGGGCAGACAGGGAGGAGGG + Intronic
1064443739 10:15375271-15375293 CTAGGGGAAGAAAGGGAAGAAGG - Intergenic
1064804689 10:19117124-19117146 GTGAGAGGAGAGAGGGAAGAAGG + Intronic
1065524226 10:26602110-26602132 CTGAGGGCAGAGACGATAAAGGG + Intergenic
1065838047 10:29677165-29677187 CTGAAGGCAAAAAGGGAAGGGGG - Intronic
1066217015 10:33297784-33297806 CTGACGGCAGAGGGAGAAGGAGG + Intronic
1066504068 10:36023787-36023809 CTGAAGGAAGAGAAGGAAGAAGG - Intergenic
1066684097 10:37964065-37964087 CTTAGGGCAGAAAGTGAAGCAGG - Intronic
1067143778 10:43678801-43678823 TGGTGGGCAGACAGGGAAGATGG - Intergenic
1067456544 10:46423253-46423275 ATGAGGGCAGACAAGGAGGAAGG - Intergenic
1067514705 10:46928566-46928588 CTGGGGGCTCAGAGGGAAGCAGG - Intronic
1067630657 10:47961386-47961408 ATGAGGGCAGACAAGGAGGAAGG + Intergenic
1067647551 10:48123247-48123269 CTGGGGGCTCAGAGGGAAGCAGG + Intergenic
1067713862 10:48671943-48671965 CTGGGAGCAGCGCGGGAAGAGGG - Intergenic
1067820082 10:49520764-49520786 CTGAGGACAGGGAGGGCAGGTGG - Intronic
1067878376 10:50024017-50024039 CAGAGGGCAGAAAAGAAAGACGG - Intergenic
1067893346 10:50153911-50153933 CAGAGGGCAGAAAAGAAAGACGG + Intergenic
1068068873 10:52170186-52170208 CTGAGGACAAAGAAGAAAGAAGG + Intronic
1068106975 10:52630773-52630795 GTGAGGGCACAGTGGGAAGGCGG - Intergenic
1068124499 10:52822347-52822369 CTGAGTTCAGAGAAGGAAGATGG + Intergenic
1068659851 10:59612640-59612662 CAGAGGTAAGAGAGGGAAGGTGG - Intergenic
1068830250 10:61485817-61485839 GTGAGGGCATAGAGGGATGCTGG - Intergenic
1069136443 10:64772560-64772582 CTGAGGGCAGAAAGGAGAGCTGG + Intergenic
1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG + Intronic
1069574490 10:69517037-69517059 CAGAGGTCAGAGAGGGACAAAGG - Intergenic
1069577015 10:69538010-69538032 ATGAGGACAGAGTGAGAAGATGG - Intergenic
1070169209 10:73920094-73920116 CTGAGGTGGGAGAGGGCAGAGGG - Intronic
1070470284 10:76772598-76772620 CTGGGAGCAGAGAGGATAGAAGG + Intergenic
1070751368 10:78965808-78965830 CTGAGGCCAGAGAGGGTAAGTGG - Intergenic
1070916960 10:80161174-80161196 GTGAGGGCAGAGAGGGGAGAGGG - Intronic
1070979077 10:80630096-80630118 GTGGAGGGAGAGAGGGAAGAAGG + Intronic
1071017484 10:81015070-81015092 CAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1071229785 10:83572110-83572132 GAGAGGAAAGAGAGGGAAGAAGG + Intergenic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1072236753 10:93460300-93460322 CTGAGGGCAGAGAGGATCCATGG - Intronic
1072578777 10:96722266-96722288 CTTTGGGGAGAGAAGGAAGAGGG - Intergenic
1072804887 10:98418010-98418032 CTGTGTGCAGCGAGGGAGGACGG - Intronic
1072805070 10:98418948-98418970 CTGAGGGCACGGAGGAAAGCTGG + Intronic
1072909641 10:99488429-99488451 AGGAGGTCAGAGAAGGAAGAGGG + Intergenic
1073349721 10:102810961-102810983 ATGAAGGGAGGGAGGGAAGAAGG - Intronic
1073444855 10:103574560-103574582 CTGAGGTCAGTGGGGGAGGATGG + Intronic
1073476471 10:103756949-103756971 CTGAGGCTAGAGACAGAAGAAGG - Intronic
1074094715 10:110301229-110301251 CAGAAGGCAGAGAAGGAAAAAGG + Intronic
1074544702 10:114393579-114393601 CTGGGGACAGGGAGGGAAGTTGG + Intronic
1074720206 10:116257362-116257384 CCGAGGGCAGGGAGGATAGAGGG - Intronic
1074735641 10:116429803-116429825 CTGCAGGTAGAGAAGGAAGATGG + Intronic
1074813802 10:117130035-117130057 AGGAGGGGAGAAAGGGAAGAAGG + Intronic
1074871186 10:117577405-117577427 AGGAGGGAAGAGAGGGAGGAGGG - Intergenic
1074977947 10:118596099-118596121 CGGAGGGCAGAGACGCTAGAGGG + Intergenic
1075072326 10:119327371-119327393 CCCAGGGCACAGAGGGGAGAAGG - Intronic
1075278693 10:121119701-121119723 TTGTGGGGTGAGAGGGAAGAAGG - Intergenic
1075585641 10:123656112-123656134 CTCATGGCAGAGAGGTTAGAGGG - Intergenic
1075724954 10:124606374-124606396 CTGAGGGCACTGATGGGAGAGGG - Intronic
1075808782 10:125209229-125209251 CTCAGGCCAGAGAGGGAGAAAGG + Intergenic
1075935682 10:126339130-126339152 GTAAGGGTAGAAAGGGAAGATGG - Intronic
1076123989 10:127960478-127960500 CTGAGTGCTGAGGGGCAAGAAGG - Intronic
1076214245 10:128679969-128679991 CTGGAGGCAGAGAGGAAGGAAGG + Intergenic
1076310257 10:129501230-129501252 CCAAGCCCAGAGAGGGAAGAGGG - Intronic
1076446321 10:130516629-130516651 CAGAGGACAGAGTGGGGAGAAGG + Intergenic
1076474041 10:130740082-130740104 CCGAGAGCAGAGAGGGATAAGGG + Intergenic
1076911984 10:133394897-133394919 CTGGGGGCCGAGGGGGAAGAAGG + Intronic
1077017926 11:405087-405109 CTCAGGGCCGAGAGGGGACAGGG + Intergenic
1077198490 11:1293401-1293423 GTGTGGGCAGAGAGGGGAGGAGG + Intronic
1077253240 11:1569988-1570010 CTGAGGGGAGGCAGGGATGAGGG - Intronic
1077304856 11:1864444-1864466 CTGAGGGCAGAGGCGGAGGGAGG + Intronic
1077338408 11:2015576-2015598 GGGAGGGAAGAGGGGGAAGACGG - Intergenic
1077338411 11:2015585-2015607 CAGACAGCAGGGAGGGAAGAGGG - Intergenic
1077417527 11:2431699-2431721 CTGAGATCTGAGTGGGAAGAGGG - Intergenic
1077853194 11:6095794-6095816 CTGAGGGGCGAGTGGGAAGTGGG + Intergenic
1077888747 11:6404070-6404092 AGGAAGGCAGGGAGGGAAGAAGG + Intronic
1077890295 11:6413436-6413458 CTGAGAACACAGAGGGAAGGGGG - Intronic
1078106863 11:8363193-8363215 GCGAGGGAAGAGAGTGAAGAAGG + Intergenic
1078329295 11:10406080-10406102 ATGAGGGCAGAGAGGAGAGGTGG + Intronic
1078450334 11:11436214-11436236 CATAGAGCAGAGAGGGAAGGTGG - Intronic
1078513963 11:12007841-12007863 GTGGGGGCAGAGAGGGAAGATGG - Intronic
1079122445 11:17695701-17695723 CTGAGGACAGAGATGGAGGCCGG + Intergenic
1079244786 11:18744098-18744120 CTGAGGGCGGCGAGGGAGGAGGG + Exonic
1079968080 11:27003323-27003345 CTGGAGGCAGAGAGGGAAAGAGG - Intergenic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1080737731 11:35033337-35033359 TTGAGGGCAGAAAGGAAAGAGGG - Intergenic
1080867452 11:36207823-36207845 GCGAGGGCAGAGAGAGAACACGG + Intronic
1081477202 11:43446214-43446236 CAGAGGGCAGAGGGGGCACAGGG - Intronic
1081495126 11:43601528-43601550 CTGAGGGCAAAGGGAAAAGAAGG + Intronic
1081666370 11:44919191-44919213 CTGGGGGCAGAGGGAGAAGATGG - Intronic
1081684336 11:45031209-45031231 CTGAGAGCAGAGATGAGAGAAGG - Intergenic
1081734626 11:45394308-45394330 TTGTGGGCACAGAGGGTAGAGGG + Intergenic
1081758290 11:45559959-45559981 GTGAAGGAAGAGATGGAAGAAGG - Intergenic
1081975206 11:47229429-47229451 GGGAGTGGAGAGAGGGAAGAGGG + Intronic
1082160625 11:48884720-48884742 CTGACAGCAGGGAGAGAAGAAGG - Intergenic
1082161741 11:48895686-48895708 CTGACAGCAGGGAGAGAAGAAGG + Intergenic
1082167325 11:48964114-48964136 CTGACAGCAGGGAGAGAAGAAGG + Intergenic
1082609747 11:55282461-55282483 CTGACAGCAGGGAGAGAAGAAGG - Intergenic
1082656936 11:55868064-55868086 CTGACAGCAGGGAGAGAAGAAGG + Intergenic
1083163354 11:60868974-60868996 CTGAGAGCAGAGAGGGGAGGGGG + Intronic
1083269643 11:61565346-61565368 TTGAGGGGAGGGAGGGAAGCAGG - Intronic
1083288495 11:61676445-61676467 CTGAGGCCAGAGTGGGAACTTGG + Intergenic
1083319214 11:61834996-61835018 CTGGGGGCAGGCAGGGAGGAGGG - Intronic
1083514352 11:63242920-63242942 GTGAGGGCAGAGACAGAAGGTGG - Intronic
1083651596 11:64207704-64207726 CAGAAGGGAGGGAGGGAAGAGGG - Intronic
1083725024 11:64623416-64623438 CTGAGGGAAGAGGATGAAGAGGG - Intronic
1083735186 11:64676122-64676144 CAGCGGGCAGAGAGGGCAGGGGG + Intronic
1083815770 11:65131597-65131619 CTGAAGGGAGAGGGGGACGAGGG + Intronic
1083994854 11:66266850-66266872 CTGTGGGCAGAGGGGGCAGGTGG - Intronic
1083996290 11:66274718-66274740 AAGAGGGGAGAGGGGGAAGAGGG - Intronic
1084101870 11:66955205-66955227 CTGAGAGGACAGAGGGAAGAGGG + Intronic
1084110976 11:67014022-67014044 ATGAAGGCACAGAGAGAAGAAGG - Intronic
1084155241 11:67309603-67309625 CTGATGGCAGAGTGGGCAGGAGG - Intronic
1084224967 11:67710399-67710421 ATGAGGGCAGAGAGGAGAGATGG + Intergenic
1084262786 11:67990242-67990264 ATGAGGGCAGAGAGGAGAGATGG + Intergenic
1084665204 11:70572545-70572567 CTAAGGGAGGAGAGAGAAGAGGG + Intronic
1084810604 11:71608863-71608885 ATGAGGGCAGAGAGGAGAGATGG - Intergenic
1084859518 11:72009186-72009208 CTGTGGGCAGAGAGGGTGGGTGG + Intronic
1084902081 11:72317221-72317243 CTGTGGGGAGAGAGGGCAAATGG + Intronic
1084937369 11:72594324-72594346 CTGAGGGCAGAGGGTGCAGAAGG - Intronic
1084970344 11:72768126-72768148 CTGTGGGCTGTGAGGGTAGAGGG - Intronic
1085096409 11:73763994-73764016 GTGAGGGCACAGTGAGAAGATGG - Intergenic
1085127103 11:74009188-74009210 GTGAGGGCAGTGAGGTGAGAGGG + Exonic
1085456336 11:76667546-76667568 CTGAGGGGAGCCAGGGAATAGGG - Intronic
1085527941 11:77174923-77174945 CTGAGTGCACAGAGGGCAGGAGG + Intronic
1085750160 11:79154660-79154682 CTGAGAGCTGAAGGGGAAGAGGG - Intronic
1085751612 11:79167233-79167255 CTGAGTTCACAGTGGGAAGAAGG + Intronic
1085804119 11:79618940-79618962 CCAAGGGCAGACAGGGCAGAAGG - Intergenic
1085875496 11:80402382-80402404 ATGAGCTCAGAGAGGGAAGAGGG - Intergenic
1086124900 11:83340382-83340404 GTGAGGGCAAGGAGTGAAGAGGG - Intergenic
1086344512 11:85882567-85882589 CTGAGTGAAGAGAAGGCAGAGGG + Exonic
1086584888 11:88439287-88439309 ATGGGGGAAGAGAGGGATGAAGG + Intergenic
1086772533 11:90785515-90785537 CTGATGGCAGAGACACAAGAAGG - Intergenic
1087425919 11:97985242-97985264 CTGAGGGCAGGGAGGGAGACAGG + Intergenic
1087772548 11:102226323-102226345 ATGAGGGGAGAGAGAGAACAAGG + Intronic
1088299522 11:108341467-108341489 CTGAGAACAGAGTGGGAAAAAGG - Intronic
1088456070 11:110034279-110034301 ATGAGGTCAGAGAAGGAAGCAGG - Intergenic
1088853295 11:113723333-113723355 CTGAGGGCAGGGAGGCTAAATGG + Intergenic
1089150045 11:116357365-116357387 CTGATGGCTGAGAGGGAGCAGGG - Intergenic
1089223432 11:116895123-116895145 ATGAGGTCAGAGAGGTAAGAGGG - Intronic
1089592944 11:119556389-119556411 TTGGTGGCAGAGAGGGGAGAAGG + Intergenic
1089668094 11:120032991-120033013 CAGAGGGAAGAGATGGCAGAGGG - Intergenic
1089679335 11:120110642-120110664 ATGATGGTAGAGAGGGAAGAGGG - Intergenic
1089697485 11:120225108-120225130 GTGAGGGCAGAGTGGGAGGCTGG - Intronic
1090085375 11:123645747-123645769 CTGACTGCAGAGAGGACAGATGG + Exonic
1090244010 11:125202865-125202887 CTGGGGGTAGAGAGGAAAGGTGG - Intronic
1090287219 11:125510333-125510355 CTAAGGGAAAAGAGGGAAGGAGG + Intergenic
1090392746 11:126400007-126400029 GAGAGAGCAGAGAGGAAAGAAGG - Intronic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1090623585 11:128585298-128585320 GGGAGGGAAGGGAGGGAAGAAGG + Intronic
1090846825 11:130536481-130536503 ATGAGATCAGAGAGGGAACAGGG + Intergenic
1091280908 11:134380899-134380921 GTGAGGGCAGTGAGGGCAGGAGG + Intronic
1091311004 11:134575140-134575162 CTGAGGACACAGCGAGAAGACGG + Intergenic
1202821392 11_KI270721v1_random:70758-70780 GGGAGGGAAGAGGGGGAAGACGG - Intergenic
1202821395 11_KI270721v1_random:70767-70789 CAGACAGCAGGGAGGGAAGAGGG - Intergenic
1091383154 12:75999-76021 CTGGGGGCAGAGGGAGTAGAGGG - Intronic
1091405837 12:209025-209047 GTGAGGGCAGAGAGGTCACAGGG - Intronic
1091418959 12:318041-318063 CAGAAGGTAGAGTGGGAAGAAGG - Intronic
1091508775 12:1100315-1100337 ATGAGGCCAGAGAGGTAACAGGG + Intronic
1091783102 12:3226134-3226156 CTGAGTGCAGAGGGAGGAGATGG + Intronic
1091916376 12:4273879-4273901 GTGAGGGCAGAGAGAGAAGGTGG - Exonic
1092050691 12:5467838-5467860 CTGATGGCACAAAGGGAAGGAGG - Intronic
1092354699 12:7784846-7784868 CTGAGGGTAGGGTGGGAAGGAGG + Intergenic
1092416357 12:8293184-8293206 ATCAGGGCACAGAGGTAAGAGGG + Intergenic
1093084919 12:14856282-14856304 CAAAGGGCAGGGATGGAAGAAGG - Intronic
1093778983 12:23112089-23112111 AAGAGAGCAGAGAGGAAAGAAGG - Intergenic
1093958824 12:25251045-25251067 CTGAGGGCGGTGTGGGAAGAGGG + Intergenic
1094058060 12:26286309-26286331 CTGAGAGCAGGGATGGCAGATGG + Intronic
1094065518 12:26357431-26357453 GTGAGGTCTGAGAGGGAACATGG - Intronic
1094166669 12:27450287-27450309 GTGGGGGCAGGGAGGGAGGAGGG - Intergenic
1094488668 12:30945105-30945127 CTGAGGGCAGAAAAGGAGGAGGG - Intronic
1095237214 12:39812176-39812198 GTGAGGGCACAGATGAAAGATGG - Intronic
1095791234 12:46169575-46169597 CTGAGGGGAGGGAGGGAAATGGG + Intergenic
1096406433 12:51347302-51347324 CTGAGGGCTATGAGGGTAGATGG + Intergenic
1096861684 12:54533296-54533318 GTAGGGGCAGAGAGGGAGGATGG + Intronic
1096995356 12:55834819-55834841 CACAGGGCAGAGAGGGAGTAAGG - Intergenic
1097178569 12:57157848-57157870 GTGAGGGCAGAGAAGGAGGCAGG + Intronic
1097238497 12:57556479-57556501 AAAAGAGCAGAGAGGGAAGAAGG - Intronic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1098167784 12:67715809-67715831 GTGATGGCAAAGAGGGAAGAGGG + Intergenic
1098541725 12:71664369-71664391 GTGAGAGCGGAGTGGGAAGAAGG - Exonic
1099626764 12:85085582-85085604 CAGAGGGGAGAGAGTGAAGCAGG - Intronic
1100413236 12:94344012-94344034 GTGAGGACAAAGTGGGAAGAAGG + Intronic
1100715974 12:97306121-97306143 ATGATGGCAGAGAGGAAAGAAGG - Intergenic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1101693559 12:107103401-107103423 CTGAGGGCAATGAGGGAGGGAGG - Intergenic
1102012174 12:109625596-109625618 CTGAGGACAGAGAGGGCTTAGGG - Intergenic
1102347624 12:112169783-112169805 CTGAGGGCAGAGAAGGCACAGGG - Intronic
1102728262 12:115084913-115084935 CTGGGGGGAGGGAGGGAAAAGGG + Intergenic
1102819365 12:115894848-115894870 CTGAGCAAAGAGAGGGAAGCAGG + Intergenic
1103187456 12:118971857-118971879 CTGAGGAGAGGGAGGGAATAGGG + Intergenic
1103239785 12:119403599-119403621 CAGAGGGCACAGGGGGAAGATGG - Intronic
1103938611 12:124489806-124489828 CTGGGGGCAGAGAGGAGAAAGGG + Intronic
1103965751 12:124638313-124638335 GTGAGGACACAGTGGGAAGACGG + Intergenic
1104088444 12:125494930-125494952 TTCAGGGAAGAGGGGGAAGAGGG - Intronic
1104415342 12:128593136-128593158 GAGAGAGGAGAGAGGGAAGAAGG - Intronic
1104415361 12:128593312-128593334 GAGAGAGGAGAGAGGGAAGAGGG - Intronic
1104803285 12:131569347-131569369 CTGAGGAGAGGGAGGGAGGAGGG - Intergenic
1105237597 13:18572970-18572992 ATGAGGCCAGAGAAGAAAGAGGG + Intergenic
1105424498 13:20282963-20282985 AAGAGGGCAGAGAGAGATGATGG + Intergenic
1105612094 13:21977629-21977651 TTGAGGGCATAGCGGAAAGAGGG + Intergenic
1105722916 13:23134665-23134687 GTGAGGGCACAGGTGGAAGATGG - Intergenic
1106321359 13:28642473-28642495 GTAAGTGCAGAGAGGGAGGAAGG - Intergenic
1106402028 13:29440644-29440666 CAGATGGTCGAGAGGGAAGATGG - Intronic
1106768940 13:32943523-32943545 TTGAGGGCAGAGATGGAAGTGGG - Intergenic
1107290598 13:38848889-38848911 CTGAGGGCTGTCAGGGAAGGAGG + Intronic
1107630020 13:42333728-42333750 ATGAGGGAAGAGATGGAGGAGGG + Intergenic
1107697455 13:43014031-43014053 TTTAGGACAGAGAGAGAAGAGGG + Intergenic
1107710102 13:43142939-43142961 CTGAAGGCAGAGATGTAGGAAGG + Intergenic
1107711344 13:43153284-43153306 AGGAAGGCACAGAGGGAAGAAGG - Intergenic
1107727960 13:43318966-43318988 CTGGAGGGAGAGAGGGAGGAAGG + Intronic
1107788483 13:43977786-43977808 GAGAGGGGAGAGAGGGAGGAAGG - Intergenic
1108068979 13:46607949-46607971 CTGAGGGCAGGGAGGGATGTGGG + Intronic
1108447800 13:50526847-50526869 CTGAGAGGGGAGAGGGGAGAGGG + Intronic
1109242936 13:59913386-59913408 CTGTGGGCTGTGAGGGAAGCTGG - Intronic
1110508133 13:76314392-76314414 ATATGGGCAGAGAGGGAAAAGGG + Intergenic
1110801543 13:79702548-79702570 CAGAGGGCAGTGAGCTAAGATGG + Intergenic
1111681164 13:91443347-91443369 GTGAGGGCACAGAGAGAAGATGG + Intronic
1111829712 13:93311876-93311898 CTGAGGGTACAAAGGCAAGATGG + Intronic
1111893001 13:94106520-94106542 GTGAGGGAAGTGAGGGAGGATGG + Intronic
1112369830 13:98784832-98784854 CTGAGAGCAGCGTAGGAAGAGGG + Intergenic
1112781073 13:102901993-102902015 GTGAGGGCAGAGAGGAGAGACGG + Intergenic
1113108040 13:106792173-106792195 CTCAGGACAGAGAATGAAGATGG - Intergenic
1113148904 13:107240213-107240235 ATGAGGACACAGAGAGAAGATGG + Intronic
1113251548 13:108458555-108458577 GGGAGGGGAGAGAGGGAAGGGGG - Intergenic
1113504514 13:110806013-110806035 TTGTGGGCAGAGAGGGAAAGTGG + Intergenic
1113600285 13:111563475-111563497 GTGAGGGGAGAGAGGGAAACAGG - Intergenic
1113618067 13:111695046-111695068 CAGAGAGCAGAGAGAGGAGAGGG - Intergenic
1113623600 13:111780307-111780329 CAGAGAGCAGAGAGAGGAGAGGG - Intergenic
1113673956 13:112195734-112195756 AGGAGGGGAGAGAGGGAGGAAGG - Intergenic
1113698791 13:112367126-112367148 ATGAGGGCAGAGAGGGAAGCTGG + Intergenic
1113743256 13:112725353-112725375 CTGAGAGCAGAGAGAGTGGAGGG - Intronic
1113801278 13:113087684-113087706 CTGCGAGCAGAGAGTGGAGATGG - Intronic
1114192074 14:20447326-20447348 ATGAGGGCAGAGAAGAATGAAGG - Intronic
1114454504 14:22846247-22846269 CTGAGGGCTGAGTGGGAGGGCGG + Exonic
1114491099 14:23102486-23102508 CTAACTGCAGAAAGGGAAGAAGG + Intergenic
1115378249 14:32703159-32703181 TTGGAGGCAGAGTGGGAAGAAGG + Intronic
1115386000 14:32797619-32797641 CAGAGGGCAGTGAGAGGAGAGGG + Intronic
1115569840 14:34656048-34656070 CTGTGGCCAGAGAGTGAGGATGG + Intergenic
1116416627 14:44685350-44685372 CTGAGGGAAGAAGGGAAAGAAGG + Intergenic
1116652189 14:47607608-47607630 TTGAGGGCATAGAGGGCAGGGGG + Intronic
1116770188 14:49118480-49118502 ATGAAGGCAGAGAGGAAAGAGGG - Intergenic
1116785540 14:49284414-49284436 CTGAGGCCAGAGAGGTAGAAGGG - Intergenic
1117458426 14:55920693-55920715 CTGAGGCCAGAGGAAGAAGATGG + Intergenic
1118008413 14:61586066-61586088 CAGAAGGCAGAGAGGGAGGAAGG - Intronic
1118367820 14:65110643-65110665 CTGAGGTCAGAGAGGTAGGCAGG - Intergenic
1118401250 14:65381574-65381596 CTGAGAGCAAAGAAGGTAGAAGG - Intergenic
1118482343 14:66179835-66179857 GTGAGTACAAAGAGGGAAGATGG - Intergenic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119614652 14:76091184-76091206 CGGAGGCCGGAGAAGGAAGAAGG - Intergenic
1119660256 14:76446039-76446061 GGGAGGGAAGAGGGGGAAGATGG + Intronic
1119829381 14:77687549-77687571 GTGAGGGGAGAGAGTGAGGAAGG - Intronic
1119891367 14:78184986-78185008 CTGAGGAGTGAGAGAGAAGAAGG + Intergenic
1119941943 14:78650345-78650367 CAGAGGGCAGAGAGAAACGATGG - Intronic
1120824904 14:88946271-88946293 GAGAGGGAAGAGAGAGAAGAAGG + Intergenic
1120849386 14:89155642-89155664 CTGATGGGAGAGAGGGGAGTGGG - Intronic
1121185580 14:91964875-91964897 CAGATTGCAGAGGGGGAAGAGGG - Intergenic
1121234118 14:92379901-92379923 GTGAGGGTGGAGAGGGGAGAGGG - Intronic
1121238880 14:92413607-92413629 CTGAGGGCTGCAAGGGAATATGG - Intronic
1121249803 14:92490905-92490927 CCAAGGGCAGAGAGGCAAGAGGG - Intronic
1121317289 14:92969882-92969904 GGAAAGGCAGAGAGGGAAGACGG - Intronic
1121330162 14:93044711-93044733 AACACGGCAGAGAGGGAAGAAGG + Intronic
1121600383 14:95198993-95199015 CTGGGGGAAGAGGGGGAAGATGG + Intronic
1121709464 14:96026843-96026865 CTGAGGGTGCAGAGGGAACATGG + Intergenic
1121817500 14:96939874-96939896 CTCGGGCCAGAGAGAGAAGAAGG - Intergenic
1121853911 14:97248981-97249003 CTGAGGGCAGACAGAGCAAATGG - Intergenic
1121878643 14:97478945-97478967 CCCAGGGCAGAAAGGGCAGAAGG + Intergenic
1121895102 14:97639662-97639684 GTGAGGGAAGGGAGGCAAGAAGG - Intergenic
1121930308 14:97966255-97966277 CTGAGACCAGAAAGGGCAGAAGG + Intronic
1122029336 14:98901210-98901232 ATAAGGGCTGGGAGGGAAGAGGG - Intergenic
1122113657 14:99517404-99517426 CTGATAGCACAGAGGCAAGAGGG + Intronic
1122147480 14:99700214-99700236 CTGAAGGGAGAGAGGAAAAAGGG + Intronic
1122375527 14:101254499-101254521 GTGAGGACACAGAGAGAAGACGG - Intergenic
1122407779 14:101510423-101510445 CTGAAACAAGAGAGGGAAGAGGG + Intergenic
1122485807 14:102078913-102078935 GTGACTGCAGAGAGGCAAGAAGG - Intergenic
1123159092 14:106260250-106260272 CTGAGGGAAGAGAGAGGAGGTGG - Intergenic
1123160211 14:106271088-106271110 CTGAGGGAAGAGAGAGGAGGTGG - Intergenic
1123207839 14:106730626-106730648 CTGAGGGAAGAGAGAGGAGGTGG - Intergenic
1124653981 15:31493970-31493992 CTCAAAGCAGAGAGGGAGGAGGG + Intronic
1124787016 15:32690946-32690968 CTGAAGGCAGAAAGGGAGAAGGG - Intronic
1124949498 15:34303755-34303777 CAGAGGGCAGAGAGGGTAAGAGG - Intronic
1125124992 15:36209776-36209798 GTGAAGATAGAGAGGGAAGAAGG + Intergenic
1125447898 15:39777260-39777282 ATCAGAGCTGAGAGGGAAGAAGG - Intronic
1125542250 15:40476346-40476368 CAGAGGCGAGAGTGGGAAGAGGG - Intergenic
1125781523 15:42273455-42273477 CTTAGAGCAGAGCCGGAAGAAGG - Exonic
1125909399 15:43422533-43422555 CTGAGAGAAGACAGGGAAGGAGG + Intronic
1125933403 15:43615816-43615838 GTGGTGGCAGAGAGGGCAGAAGG + Exonic
1125946501 15:43715278-43715300 GTGGTGGCAGAGAGGGCAGAAGG + Intergenic
1126540516 15:49817293-49817315 CTGAGGTCAAGGAGGGGAGAGGG + Intergenic
1126663352 15:51053585-51053607 CTGAGGGCAAGGTGGGGAGAAGG - Intergenic
1126757150 15:51935955-51935977 CTGAGGGAACATAGGGACGAGGG + Intronic
1126796392 15:52263536-52263558 ATGAGGCCAGAGAGGGGAGGGGG - Intronic
1127164425 15:56229975-56229997 GTGAGGGCAGATAAGGAAGGAGG - Intronic
1127455093 15:59149730-59149752 CTGAGGGATGAGAGAGAGGAAGG + Intronic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1127873310 15:63091068-63091090 CTGGGAGCAGAGAGGCCAGACGG + Intergenic
1128155901 15:65391857-65391879 GTGAGGGCGGTGGGGGAAGAAGG - Intronic
1128158033 15:65404029-65404051 CCAAGGTCAGAGAGGGAAGGGGG + Intronic
1128250806 15:66163146-66163168 CAGAGGGCAGAGGGGGAATCTGG + Intronic
1128480289 15:68031551-68031573 CTGGAGGCAGAGAGGGAAGTTGG - Intergenic
1128524304 15:68402085-68402107 CAGGGGCCAGAGTGGGAAGAGGG + Intronic
1128645559 15:69376398-69376420 CTAAGGCTAGAGTGGGAAGACGG + Intronic
1128919058 15:71593980-71594002 CTGATGAGAAAGAGGGAAGAGGG + Intronic
1128947925 15:71842985-71843007 CTCAGAGCAGAGAGGGGAAAAGG - Intronic
1129514516 15:76148853-76148875 TTGCGGGAAGAGAGGGAGGAGGG - Intronic
1129709698 15:77814314-77814336 CTGAGGGCACGGTGGGAAGTGGG - Intronic
1129914987 15:79260908-79260930 ATGAGGGCAGGGAGAGAAAAAGG + Intergenic
1129930610 15:79407507-79407529 CTGGAGGCAATGAGGGAAGACGG + Intronic
1130077854 15:80705108-80705130 AAGAGGCAAGAGAGGGAAGATGG + Intronic
1130102802 15:80906641-80906663 CCTAGGGCAGAAAGGGAGGACGG - Exonic
1130671662 15:85918267-85918289 CAGAAGGCAGAGGGGTAAGAGGG - Intergenic
1130721006 15:86386056-86386078 GGGAGGGGAGAGAGGGAGGAGGG - Intronic
1131152195 15:90054179-90054201 ATGAGGGGAGAGATGAAAGAGGG + Intronic
1131227604 15:90638466-90638488 CTGTGGGCAGAAAGGAAAGTTGG - Exonic
1131379903 15:91954917-91954939 CTCAGGGCACAGAGCCAAGAAGG - Intronic
1131699564 15:94919456-94919478 ATCAGGCAAGAGAGGGAAGATGG - Intergenic
1131863038 15:96674972-96674994 CTGAAGGAACAGAGGGAAGGAGG + Intergenic
1131998042 15:98151725-98151747 CTGAGACCAGAGAGAGAACAGGG + Intergenic
1132029291 15:98427301-98427323 AAGAGGGAAGAGAGGGAACAAGG - Intergenic
1132038192 15:98503704-98503726 CTGAGAAGAGAGAGAGAAGAAGG + Intronic
1132105932 15:99062571-99062593 TTGAAGGCAGAGGGGGATGAGGG + Intergenic
1132156133 15:99496361-99496383 GTGTGGGCAGGGAGGGCAGAAGG + Intergenic
1132206187 15:99987756-99987778 GAGAAGGCAGAGAGGGAAAACGG + Intronic
1132242667 15:100270912-100270934 CAGATGGCTGAGAGGGAGGAGGG - Intronic
1132482817 16:175083-175105 CTGTGGGCAGAGTCAGAAGAGGG + Intergenic
1132527176 16:423038-423060 GTGAGGACAGAGTGAGAAGATGG + Intergenic
1132585144 16:702896-702918 CTGAGCCAAGAGAGGGAAGGGGG + Intronic
1132629257 16:908914-908936 CAGAGGGCAGAGAGGAAAGCTGG + Intronic
1132935181 16:2476229-2476251 CTGAGGACAGACTGTGAAGACGG - Intronic
1132943081 16:2518116-2518138 CTGTGGGCAGAGAGGGGGCAGGG + Intronic
1133518280 16:6531161-6531183 CCGGGGGCAGAGTGGGAATAAGG - Intronic
1133791575 16:9013282-9013304 GTGCTGGCAGAGAGGGGAGAGGG - Intergenic
1133883801 16:9807320-9807342 GTGGGGGGAGAGAGGGAGGAAGG + Intronic
1134504001 16:14790798-14790820 CTGAGGTCAGGGAGGGAGGCAGG + Intronic
1134576571 16:15338110-15338132 CTGAGGTCAGGGAGGGAGGCAGG - Intergenic
1134634813 16:15784242-15784264 ATGATGGCAGGGAGAGAAGAGGG + Intronic
1134682362 16:16135096-16135118 CTGGCAGCAGAGAGAGAAGACGG - Intronic
1134692038 16:16197493-16197515 CAGAGGGAAGAGAGGGAGGACGG + Intronic
1134725868 16:16418389-16418411 CTGAGGTCAGGGAGGGAGGCAGG + Intergenic
1134784835 16:16932655-16932677 TTGAGGGGATAGAGGGAACATGG - Intergenic
1134841561 16:17405828-17405850 CTGAGGGCAGGGAGGGGAAATGG - Intronic
1134941565 16:18293470-18293492 CTGAGGTCAGGGAGGGAGGCAGG - Intergenic
1135035650 16:19074781-19074803 GGGAGGCCAGAGAGGGAAGATGG - Intronic
1135171417 16:20187275-20187297 CTTAGGGCTGAGAGGGTGGAGGG - Intergenic
1135181842 16:20281592-20281614 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1135640275 16:24113813-24113835 CTGAATGCAGACAGGGAAGCAGG - Intronic
1135861957 16:26064344-26064366 CTTAGGGTATAGAGGGTAGAAGG + Intronic
1135910890 16:26559611-26559633 CTGAGGGGGGATAGGGAAGAGGG - Intergenic
1136499071 16:30660543-30660565 CTAAGGGCAAAGAGGCAAGCAGG + Intronic
1136534060 16:30888842-30888864 CTGAGGTGAGAGAGGCCAGAAGG - Exonic
1137365101 16:47853444-47853466 CTTAGGGCTGAGATGGAACAGGG - Intergenic
1137443879 16:48520193-48520215 CTGAGTGCTGGGAGGCAAGAAGG - Intergenic
1137692686 16:50440630-50440652 CAGAAGCCAGCGAGGGAAGATGG + Intergenic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1137800970 16:51261947-51261969 AAGAAGGGAGAGAGGGAAGAAGG - Intergenic
1137850452 16:51736819-51736841 CTGATGGCAGATACGGAAGTGGG + Intergenic
1138247259 16:55477295-55477317 CTGAGAGCTGAGAGTGAAAATGG - Intronic
1138273007 16:55709737-55709759 CTGAGGGCTTACAGGGAAGCCGG - Intergenic
1138375458 16:56560704-56560726 CCAAAGGCAGAGAGGGAACAGGG + Intergenic
1138849939 16:60615610-60615632 CTGAGGACAGAGAGTACAGAGGG - Intergenic
1139337038 16:66240000-66240022 CTGAGGCCAGAGAGGCCAAATGG - Intergenic
1139476050 16:67203096-67203118 CTGCGTGGAGAAAGGGAAGAGGG - Intronic
1139532457 16:67549057-67549079 CTGAGGGGACAGATGGAAGTGGG + Intergenic
1139592240 16:67939776-67939798 CTGTGTGCAGTGAGGCAAGATGG - Exonic
1139662436 16:68430205-68430227 GAGGGGGCATAGAGGGAAGAGGG - Intronic
1139691672 16:68645607-68645629 CCGAGGGCAGAGAGTGAAGGAGG - Intronic
1139875056 16:70139306-70139328 CTCAAGGCAGACCGGGAAGAAGG - Intronic
1140360727 16:74341825-74341847 CTCAAGGCAGACCGGGAAGAAGG + Intergenic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140720000 16:77763194-77763216 CTGGGGTAAGAGAGGGAAGGAGG - Intergenic
1141475124 16:84267756-84267778 CTGAGGTCAGGGAGGGAACCTGG + Intergenic
1141620148 16:85232990-85233012 CTGAGGTCAGAGATGGCAGTCGG + Intergenic
1141665211 16:85462348-85462370 CTGAGGGTAGGGAGGGTGGAGGG - Intergenic
1141693288 16:85608244-85608266 CTGAGGGCAGATGGGGTAGCTGG + Intergenic
1142323303 16:89398961-89398983 CTGATGGGAGAGAGGGATGATGG - Intronic
1142325438 16:89411886-89411908 CTGAGGGGAGGGATGGAACATGG - Intronic
1142753976 17:2004670-2004692 CCCTGGGCAGAGAGGGCAGAGGG + Intronic
1142912129 17:3103131-3103153 CTGATGGGAGGGAGGGTAGAGGG + Intergenic
1143029781 17:3961496-3961518 CTGTGTGCAGTGAGGGAGGAGGG + Intronic
1143123144 17:4622148-4622170 GTGAGGTCAGAGAGACAAGAAGG - Intergenic
1143495670 17:7311327-7311349 CTGGGGGCAGATAGGGAAGGAGG - Intronic
1143614595 17:8042345-8042367 TGGAGGGTAGAGAGGGAAGGTGG - Intronic
1143677637 17:8447490-8447512 TTAAGAGCACAGAGGGAAGATGG - Intronic
1143702212 17:8669284-8669306 CTGAGGGCAGAGCTGTAGGACGG - Intergenic
1143901207 17:10176114-10176136 CTGAAGGCAGGGAAGGATGAAGG + Intronic
1144136273 17:12297994-12298016 CTGAGGACAGAGAGGAAATCTGG - Intergenic
1144321184 17:14121894-14121916 CTGAGCCCAGAGAGGGAAGCTGG + Intronic
1144421462 17:15102773-15102795 GTGAGGGCAGAAGGGGAGGAGGG + Intergenic
1144688677 17:17244333-17244355 AGGAGGGCACAGTGGGAAGATGG + Intergenic
1144878013 17:18412353-18412375 CTGCGGGGAGAGGGGGAGGAGGG + Intergenic
1145065651 17:19759740-19759762 CAGGGGGCAGGGAGGGCAGAGGG - Intergenic
1145115210 17:20203908-20203930 CAGATGGCAGAGAAGGAAGAAGG - Intronic
1145154217 17:20532072-20532094 CTGCGGGGAGAGGGGGAGGAGGG - Intergenic
1145314832 17:21723411-21723433 CTGAGGGCAGAGGCGGCAGCAGG - Intergenic
1145713273 17:26995348-26995370 CTGAGGGCAGAGGCGGCAGCAGG - Intergenic
1145759754 17:27419417-27419439 CTGAGGGCAGTGGTGGAAGGGGG + Intergenic
1145856087 17:28159189-28159211 AAGAGGTCAGAGAAGGAAGAAGG + Intronic
1145877830 17:28333243-28333265 CTGGGGGCAGTGGGGGCAGAGGG - Intronic
1146085916 17:29829503-29829525 GAGAGAGGAGAGAGGGAAGAAGG + Intronic
1146135777 17:30319670-30319692 GTGAGGGAAGAGAGGGAGGAAGG + Intronic
1146178058 17:30679467-30679489 GTGAGGACAGAGGGGGAGGATGG + Intergenic
1146441295 17:32897326-32897348 GAGAGGGGAGGGAGGGAAGAAGG - Intergenic
1146485772 17:33241402-33241424 GTGAGAGCAGAGAAGGAAGGGGG - Intronic
1146569899 17:33943296-33943318 ATGAGGGCAGATGGGGAAGTGGG - Intronic
1146730989 17:35193858-35193880 CTCAAGGCAGAGAGTGAGGACGG + Exonic
1146736152 17:35241067-35241089 TGGAAGGCTGAGAGGGAAGACGG - Intergenic
1146941275 17:36845984-36846006 GTGGGGACAGAGAGGGGAGAGGG + Intergenic
1146945239 17:36869158-36869180 CAGAGGTCACAGAGGGAGGAGGG + Intergenic
1147156786 17:38548025-38548047 ATGAGGGCAGAGAGGGCTGGCGG - Intronic
1147167908 17:38603159-38603181 CTGGCGAGAGAGAGGGAAGAGGG + Intronic
1147178128 17:38669417-38669439 CTGCGGGCAGATAGGGTGGAGGG + Intergenic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1147793787 17:43028689-43028711 GAGAGGGCAGAGTGTGAAGAGGG + Exonic
1147878639 17:43639571-43639593 GTGAGGGGAGAGAGGGAGGCAGG - Intergenic
1147917932 17:43899887-43899909 CTGGGGGCAGAGATGGGCGAAGG + Intronic
1147925416 17:43942606-43942628 CTGAGGCCAGAGACGGGAGGGGG + Intergenic
1147989583 17:44324667-44324689 CTGGGGGCGGAGACGGAAGCGGG - Intronic
1148048291 17:44757409-44757431 TGGAGGGCAGAGATGGAAGTAGG + Intergenic
1148382504 17:47210062-47210084 GTGAGGGCAGGGTGGGAAGGAGG + Intronic
1148781396 17:50123996-50124018 ACCAGGGGAGAGAGGGAAGAAGG + Intronic
1149206809 17:54257331-54257353 AAAAGTGCAGAGAGGGAAGAAGG + Intergenic
1149432510 17:56605636-56605658 CTGAGGGCGAGGATGGAAGATGG - Intergenic
1149515813 17:57280125-57280147 CTGAGGGAAGAGAGGGTGGCTGG + Intronic
1149535702 17:57431817-57431839 CTGGGGGCAGAGAGTGAAGTGGG - Intronic
1149564872 17:57634000-57634022 AAGAGGGAAGAGAGGGAAGGAGG - Intronic
1150175406 17:63049590-63049612 ATGAGGTCAGAGAGGTAATAGGG + Intronic
1150654383 17:67030450-67030472 CTGAGGCCTGAAAGGGAAGCGGG - Exonic
1150731078 17:67694458-67694480 CTGAGCACTGAGAGGGAAGCAGG - Intronic
1151095424 17:71492175-71492197 CTGAGGTAAGAGAGGAGAGAAGG + Intergenic
1151411447 17:73932982-73933004 GAGAGGGGGGAGAGGGAAGAGGG - Intergenic
1152189008 17:78876857-78876879 CTCCAGGCAGAGAGGGGAGATGG - Intronic
1152201200 17:78947395-78947417 CCGAGGGCAGAGTGGGGAGGAGG + Intergenic
1152218701 17:79049150-79049172 ATGAGGGCAGTGGGGGCAGAAGG - Exonic
1152296021 17:79467349-79467371 ATGAGGGCAGAGCGGGGAGGAGG + Intronic
1152430526 17:80246220-80246242 CTGCGGGCACAAGGGGAAGATGG - Intronic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152477047 17:80525387-80525409 TGGAGGGCAGAAAGGCAAGAGGG - Intergenic
1152524456 17:80879510-80879532 TCCAGGGCAGTGAGGGAAGAAGG - Intronic
1152703486 17:81831382-81831404 TTGAGGGCAGAGAGCAGAGATGG - Intronic
1152814314 17:82398320-82398342 CTGAGGGCAGAGCCGGGAGGAGG + Intronic
1152888003 17:82863836-82863858 ATGGGGGCAGAGAGGGTAGCAGG + Intronic
1152987826 18:335590-335612 TTGAGGGCACAGGGAGAAGATGG + Intronic
1153087757 18:1307924-1307946 CTGATGGCAGAAGGTGAAGAAGG + Intergenic
1153539561 18:6139622-6139644 CTGAGAGCTGGGAGGGGAGAAGG - Intronic
1153963125 18:10156999-10157021 CAGAGGGCAGAAGGGCAAGAGGG - Intergenic
1153981652 18:10315503-10315525 CTCAGAGCAGAGATGGATGAAGG - Intergenic
1154313801 18:13287598-13287620 CTGAGGGCAGACAGTGGAGAAGG - Intronic
1154982014 18:21510357-21510379 CTGAGGGGAGGGAGGGAATGGGG - Intronic
1155108364 18:22689254-22689276 CTGGAGGCAGAGAGGGAAGCTGG + Intergenic
1155541036 18:26868522-26868544 CTGAGGGCAAGGATGGGAGAAGG - Intergenic
1156370178 18:36466022-36466044 GAGAGGGCAGAGAGGGGAAAAGG - Intronic
1156376534 18:36519708-36519730 CTGAGGTAAGAGAGGGAAGCTGG + Intronic
1156409294 18:36812350-36812372 CTGACCTCAGGGAGGGAAGAGGG + Intronic
1156542255 18:37925753-37925775 CAGAAGACAGACAGGGAAGAAGG + Intergenic
1156547368 18:37978141-37978163 CTCATGGCAGAAAGGGAAGTTGG + Intergenic
1156625303 18:38901070-38901092 GTGTGGGGAGAGAGAGAAGAAGG + Intergenic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157464184 18:47930505-47930527 CTGGGGGCGGGGCGGGAAGACGG - Exonic
1157502017 18:48197671-48197693 GTGAGGGCACAGTGAGAAGATGG - Intronic
1157729844 18:49994000-49994022 GTGAGGGCAGAGAGAGCATAGGG - Intronic
1157856608 18:51110407-51110429 AGGAGGGAGGAGAGGGAAGAGGG + Intergenic
1158149297 18:54349448-54349470 ATGAGGTCAGAGAGGTAAGTGGG + Intronic
1158585160 18:58726443-58726465 TTGAGGGCTGTGGGGGAAGATGG + Intronic
1158644997 18:59237976-59237998 CTGCTGGCAGAGTGGGAAAATGG - Intergenic
1158933239 18:62341499-62341521 CTGAGGGGAGAGAGGGAAAAGGG - Intronic
1158937011 18:62373829-62373851 CTGAGGACAGAGGAGGATGAGGG - Intronic
1159210812 18:65318938-65318960 CATAGGGTAGATAGGGAAGATGG - Intergenic
1159371468 18:67532440-67532462 CAGAAGGCAGAGAGGAAACAAGG + Intergenic
1159548570 18:69871195-69871217 CTGGGGGCAGAGATGGCAGAGGG - Intronic
1159579427 18:70218612-70218634 CTGAGGACACAGAGAGAAGATGG - Intergenic
1159879409 18:73844562-73844584 GTGAGGACACAGAGAGAAGATGG - Intergenic
1160013624 18:75125082-75125104 CTGAGTGCAGAGGGGAAAGCTGG - Intergenic
1160118961 18:76109816-76109838 GTGAGGGCACAGTGGGAAAATGG - Intergenic
1160383642 18:78479720-78479742 CCGAGGGCACAGTGGGCAGAGGG - Intergenic
1160570803 18:79816398-79816420 CAGAGGGCAGAGAAGGGGGAGGG - Intergenic
1160613987 18:80109774-80109796 CTGAGGGGAGAGTAGGAATAGGG + Intronic
1160837986 19:1133402-1133424 CTGAGGGGAGAGTGGGACCAGGG + Intronic
1161041618 19:2113497-2113519 CTGGGGGCAGCGAGGGCAGCTGG - Intronic
1161093872 19:2377548-2377570 GAGAGGGGAGAGAGGGGAGAGGG - Intergenic
1161204436 19:3033721-3033743 CTGTGCTTAGAGAGGGAAGAGGG - Intronic
1161215397 19:3092674-3092696 AGGAGGCCAGAGAGGGAAAAGGG + Intergenic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1161399917 19:4062655-4062677 CTGGGGGCTGAGAGGAAGGACGG + Intronic
1161503820 19:4633221-4633243 CTAGGGGTAGAGAGGGAGGAGGG + Intergenic
1161534739 19:4812007-4812029 CGACGGGCAGAGAGGGAGGAGGG - Intergenic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161954171 19:7483550-7483572 CAGAGGGCATAGAGGAACGAGGG + Intronic
1162054431 19:8054192-8054214 GTGGGGGCAGACAGGGAAGGAGG - Intronic
1162059429 19:8085841-8085863 CAGAAGGGACAGAGGGAAGAGGG + Intronic
1162171182 19:8790248-8790270 CTGAGGGGAGGGAGGGAGGGAGG + Intergenic
1162283493 19:9719520-9719542 CTGAGGGAAGAGAGAGTGGAAGG - Intergenic
1162333055 19:10042224-10042246 CTGAGAGTGGAGAGGGAAGGAGG - Intergenic
1162446792 19:10728307-10728329 CTGAGGCCAGAGAGGGAGACTGG + Intronic
1162947788 19:14054278-14054300 CTGGGAACAGAGAGGGAAGGAGG - Exonic
1163223067 19:15935493-15935515 AGGAGGACAGAGAGGGGAGATGG + Intergenic
1163327613 19:16615200-16615222 CTGAGACCAGAGAGGCAAGGAGG + Intronic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1163387183 19:17007008-17007030 AAGAAGGCAGACAGGGAAGATGG + Intronic
1163469376 19:17487633-17487655 CTGGGGACAGAGAGGGCAGCTGG + Intronic
1163566472 19:18054869-18054891 CAGAGGGCAGAGTTGGAAGAAGG + Intergenic
1163627978 19:18401859-18401881 CTGAGGACACAGTGAGAAGACGG - Intergenic
1164441874 19:28285046-28285068 AGGAGGGCAGAGAGGAAGGAGGG + Intergenic
1164526711 19:29018342-29018364 TCAAGGGCAGAGAGGGGAGAGGG + Intergenic
1164628867 19:29747830-29747852 CTGAGGGCAGAGATTGAGCATGG + Intergenic
1164659523 19:29950260-29950282 CTGGGGGGAAAGGGGGAAGAAGG + Intronic
1164727515 19:30476184-30476206 CTGGGGCCACAGAGGGAAGAAGG - Intronic
1164859344 19:31550450-31550472 CAGAGTGAAGAGAGTGAAGATGG + Intergenic
1164916774 19:32058315-32058337 AGGAAGGGAGAGAGGGAAGAAGG - Intergenic
1165327302 19:35121606-35121628 GTGAGGGCAGAGCGGGGAGTAGG - Intronic
1165486764 19:36101180-36101202 GTGGGGGCAGAGAGGGAACAAGG - Intronic
1165539805 19:36483435-36483457 CTGAGCCCAGAGATGGAAGAGGG + Intronic
1165793913 19:38507527-38507549 GTGGGGCCAGAGAGGGGAGAAGG + Intronic
1165843262 19:38802158-38802180 CTGGGGACAGAGAGGGATGGGGG + Intronic
1165895818 19:39140251-39140273 CTGAAGCCACAGAGGGGAGATGG + Intronic
1166012284 19:39951359-39951381 CTAAGGGCAGGGTGGGAAGCAGG - Intergenic
1166040369 19:40198610-40198632 GTGAGGGCAGAGTGGGAGGGAGG + Intronic
1166283813 19:41811362-41811384 CTGGGGGCAGGGAGGGATGGGGG + Exonic
1166395032 19:42433407-42433429 CTGAAAGCAGAGAGGCAAAATGG - Intronic
1166875357 19:45893633-45893655 CTGGGGGAAGACAGGGAAGATGG + Intronic
1166965292 19:46526230-46526252 CTGCCGGCAGAGAGGGAGGGAGG + Intronic
1166985723 19:46659285-46659307 CAGAGGGCTGAGGGGGAGGAGGG + Intronic
1167531886 19:50022937-50022959 GAGAGGTCAGAGAGGGAACAGGG - Intronic
1167587031 19:50381040-50381062 CTGAGGGCAGAGAGTGAGCGAGG - Intronic
1167603757 19:50469137-50469159 GTGAGGGCAGAGAGGGAGCAAGG - Intronic
1167631024 19:50626246-50626268 GTGAGGGGAGAGAGAGAGGAGGG + Intronic
1167656445 19:50767434-50767456 GTGAAGGCAGAGAGGGAAGCGGG - Intergenic
1168059711 19:53883982-53884004 CGGAGGCCAGAGAGAGAAGCAGG - Intronic
1168083784 19:54029964-54029986 GGGAGGGGAGAGAGGGGAGAGGG + Intergenic
1168433849 19:56302488-56302510 AGAAGGGCAGAGAGGGAAGAAGG - Intronic
1168460042 19:56547209-56547231 GTGAGGACACAGAGAGAAGACGG - Intronic
1168666605 19:58209539-58209561 GTGGGAGGAGAGAGGGAAGAAGG + Intronic
1202693943 1_KI270712v1_random:111123-111145 CTGAGAGCAGAGGGTGAGGAGGG - Intergenic
1202697455 1_KI270712v1_random:135398-135420 AAGAGAGGAGAGAGGGAAGAGGG - Intergenic
925221392 2:2144217-2144239 CTGAGGGCAGAGCAGGAGGGAGG - Intronic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925472774 2:4180718-4180740 CTGAGGGCATCCAGTGAAGAAGG - Intergenic
925516987 2:4693501-4693523 CTGCGTGGGGAGAGGGAAGACGG + Intergenic
925832474 2:7909917-7909939 CTGAGGGCAAACTAGGAAGAGGG + Intergenic
926137061 2:10343821-10343843 ATGAGGGCAGAAAGAGAAGAGGG + Intronic
926227610 2:10979338-10979360 GTGAGGGAAGAGGGTGAAGATGG + Intergenic
926269352 2:11353539-11353561 CTGAGGCCACAGAGGTAAAAAGG - Intergenic
926671296 2:15579325-15579347 CTGAGGCCTGAGAGTGAACAAGG - Intergenic
927375271 2:22405939-22405961 CTGAGGGAAGAGAAGCAATAGGG - Intergenic
927521978 2:23704344-23704366 CTGCAGGCAGAGAAGGTAGAGGG + Intronic
927578883 2:24223767-24223789 GGGAGGGGAGTGAGGGAAGAAGG + Intronic
927658846 2:24974583-24974605 CTGTTTGTAGAGAGGGAAGAGGG - Intergenic
927865736 2:26586111-26586133 CCGGGGGCAGAGAGAGAGGAGGG - Intronic
927920241 2:26966755-26966777 CTGAAGGCAGAGAGAGCAGGCGG + Intergenic
928188869 2:29143087-29143109 CTGAGGTCACAGAGCCAAGAGGG + Intronic
928386500 2:30872901-30872923 ATGAGGTCAGAGAGGGACCAAGG - Intergenic
928903334 2:36344627-36344649 CGGAGGGGAGGGAGGGGAGAAGG + Intergenic
929093754 2:38244899-38244921 CTGAGAGAGGAGAGGGCAGAAGG + Intergenic
929211910 2:39366539-39366561 CTGAATTCAGAAAGGGAAGAGGG + Intronic
929457638 2:42077416-42077438 CTGAGGAGAGAGAGAGAATAGGG - Intergenic
929779570 2:44949191-44949213 CTAGGGGCAGGGACGGAAGAGGG - Intergenic
929918480 2:46155475-46155497 CTGAGTGCAGGGTGGGAAGTGGG - Intronic
929954084 2:46442312-46442334 CTATGGGGAGAAAGGGAAGAGGG - Intronic
929999264 2:46849926-46849948 CTGAGCCCAGAGAGGAAAGTGGG + Intronic
930110630 2:47675796-47675818 GTGAGGGCAGATGGGGAAGAAGG + Intergenic
930309908 2:49727008-49727030 GGGAGGGCAGAGAGGGGAAATGG - Intergenic
930367527 2:50459455-50459477 TTGAGGGTGGAGTGGGAAGAGGG - Intronic
930494793 2:52127493-52127515 CAGATGGCAAAGGGGGAAGAAGG - Intergenic
930627615 2:53716197-53716219 CTGGGGTCAGAGAGGTAACATGG + Intronic
930751984 2:54943242-54943264 CTCTGAGAAGAGAGGGAAGAAGG - Intronic
930919036 2:56728805-56728827 GTGAGGGGAGAGAAGGAGGAGGG - Intergenic
931000174 2:57770884-57770906 CTGAGGAAGGAAAGGGAAGAAGG - Intergenic
931464845 2:62477015-62477037 CTGGGGAGAGAGAGGGAAGGAGG + Intergenic
931958382 2:67453556-67453578 ATGAGTGCAGAAAGAGAAGAGGG - Intergenic
932421602 2:71604523-71604545 CAGGGGGCAGTGAGGGAAGATGG + Intronic
932605452 2:73162868-73162890 GTGGGGCCAGAGAGGGAAGAAGG + Intergenic
932747934 2:74350012-74350034 CAAAGGGCAGAGAGCCAAGATGG + Intronic
932833373 2:75011635-75011657 ACAAGGGCAGAGAGAGAAGATGG + Intergenic
933144057 2:78829482-78829504 CTCAGGACAGAGTGGGAAGTAGG - Intergenic
933952618 2:87343452-87343474 CTGAGAGCAGAGGGTGAGGAGGG + Intergenic
934108818 2:88722886-88722908 CAGATGGCAAAGGGGGAAGAAGG + Intronic
934236863 2:90239798-90239820 CTGAGAGCAGAGGGTGAGGAGGG + Intergenic
934278625 2:91592422-91592444 AAGAGAGGAGAGAGGGAAGAGGG - Intergenic
934744670 2:96751305-96751327 TTGAGGAAAGAGAGAGAAGAAGG - Intergenic
934761607 2:96859883-96859905 GTGAGGGGAGAGAAGGGAGAGGG - Exonic
934767042 2:96885476-96885498 CTGAGGACAGGGAGGGAATGTGG + Intronic
934861137 2:97764450-97764472 GTGAGGGCAGAGAGGTCACAGGG + Intronic
934887288 2:98035967-98035989 CTGACTGCAGAGAGGCTAGAGGG + Intergenic
935240777 2:101176017-101176039 GTGAGGACAGAGGGAGAAGATGG + Intronic
935530717 2:104229719-104229741 GGGAGGCCAGAGAGGGAATAGGG - Intergenic
935552698 2:104475227-104475249 CTGTGGGGACAGAGGGAATATGG - Intergenic
935673779 2:105576894-105576916 CTGAGGCCAGTGAGGAAAGAAGG + Intergenic
936017282 2:108969225-108969247 CTGAGGGCAGAGAGAAGAGCAGG - Intronic
936065936 2:109332220-109332242 CTGAACTCAGAGAGGCAAGAAGG - Intronic
936102089 2:109590956-109590978 CCCAGAGCAGAGAAGGAAGATGG + Intronic
936616734 2:114055740-114055762 CTGAGGACACAGGGAGAAGATGG + Intergenic
936631954 2:114213179-114213201 CTCAGGGAAGAGAGATAAGAAGG - Intergenic
936808741 2:116370246-116370268 ATGAGGGCAGAGTGTGAAGGGGG + Intergenic
936846789 2:116844279-116844301 GAGAGGGGAGAGAGGAAAGAAGG - Intergenic
937085095 2:119166394-119166416 ATGAAGGCAGAGAAGGAAGTTGG - Intergenic
937293769 2:120797719-120797741 GGGAGGGGAGAGAGGGAGGAGGG + Intronic
937293775 2:120797735-120797757 AGGAGGGGAGAGAGGGAGGAGGG + Intronic
937324418 2:120981785-120981807 AGGTGGGGAGAGAGGGAAGAAGG - Intronic
937976815 2:127587487-127587509 ATGAGGACACAGAGAGAAGACGG - Intronic
937985587 2:127636771-127636793 CTGGGGGCAGAGAGGGTGGGTGG - Intronic
938320035 2:130356374-130356396 CGGGGGGCAGAGAGTGAAGACGG - Intronic
938512177 2:131961529-131961551 ATGAGGCCAGAGAAGAAAGAGGG - Intergenic
938639730 2:133266344-133266366 CAGAGGGCAGAGAGGGGTCAAGG + Intronic
938691083 2:133790040-133790062 GTTAGGGCTGAGAGGGAAGCAGG - Intergenic
938904539 2:135825816-135825838 CTGTGGGCTGCGAGGGAAGAGGG - Intronic
938955032 2:136289341-136289363 GTGAGGTCAGAGGGAGAAGATGG - Intergenic
939192104 2:138929193-138929215 ATGAAGGAAGAGAGGGAGGAAGG - Intergenic
939430590 2:142100915-142100937 ATGAAGGGAGAGAGGGAAGGAGG + Intronic
939546973 2:143566569-143566591 GTGAGGTCAGAGAGAGAGGAGGG - Intronic
940652843 2:156454681-156454703 CAGAGGGCAGAGTGGGAGGGAGG + Intronic
941273244 2:163457150-163457172 CTGAGGGTAAAGAGAGAAGAGGG - Intergenic
942197536 2:173536588-173536610 CTGAGAGCAAAGAGGGAATTTGG - Intergenic
942817839 2:180073337-180073359 CTGAGGCCAGAATGGGAATATGG + Intergenic
943211034 2:184966422-184966444 TTGAGTGCGGAGGGGGAAGAGGG - Intergenic
943255040 2:185583782-185583804 GTGGGGGAAGAGTGGGAAGAGGG + Intergenic
943387146 2:187216071-187216093 TTGTGGGCAGAGTGGGAGGAGGG + Intergenic
943499199 2:188666032-188666054 ATGAGGGAAGGGAGGAAAGAAGG - Intergenic
943499228 2:188666112-188666134 ATGAGGGAAGGGAGGAAAGAAGG - Intergenic
944073280 2:195697058-195697080 CTGAGGACAGAGGTGGAAGAGGG + Intronic
944224855 2:197339488-197339510 CAGAGAGCAGAGAGGGACAAAGG + Intergenic
945139330 2:206667209-206667231 ATGAGGTCAGAGAGGGAAGGGGG - Intronic
945239401 2:207662377-207662399 CAGAGGGCAGAAAGGGAAAAGGG - Intergenic
945432892 2:209785479-209785501 CTCGGGGCTGAGAGGGAAGGAGG + Intronic
946109737 2:217404111-217404133 GGGAGGGGAGGGAGGGAAGAAGG - Intronic
946345554 2:219107638-219107660 CTGAAGACAGAGAGAGAAGTGGG - Intronic
946372973 2:219291629-219291651 CCCGGGGCAGAGAGGGAAGATGG + Intronic
946975808 2:225148907-225148929 ATGGGGTCAGAGGGGGAAGAGGG - Intergenic
947071031 2:226288050-226288072 CTTAAGGAAGAGAGTGAAGAAGG - Intergenic
947428887 2:230008234-230008256 CTGAGAGAAGAGAAGGGAGAAGG - Intronic
947464349 2:230327692-230327714 GTGAAGGTAGAGAGGGCAGAGGG - Intronic
947830773 2:233139996-233140018 CTGAGGGCTCAGGAGGAAGAGGG + Intronic
948138787 2:235657922-235657944 GTGAGGACACAGGGGGAAGACGG + Intronic
948185100 2:236014775-236014797 CCGAGAGCAGAAAGGGGAGAGGG - Intronic
948668074 2:239548657-239548679 CTGAGGGTGGAGAGGCAGGAGGG + Intergenic
948729123 2:239952284-239952306 CTGAAGGCAGAGTGGGGAGGGGG + Intronic
948783435 2:240338863-240338885 CAGAAGGCGAAGAGGGAAGAGGG - Intergenic
948907276 2:240985906-240985928 GTGAGGGCAGAGTGGGCACATGG + Intronic
948989492 2:241545622-241545644 AGGAGGACAGAGAGGGAGGAGGG + Intergenic
1169132352 20:3172897-3172919 CTTAGGCCACCGAGGGAAGACGG - Intronic
1169207661 20:3749297-3749319 CTGTGGGCAGAGATGCAAGCAGG + Exonic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1169593516 20:7171943-7171965 TGAAGTGCAGAGAGGGAAGAAGG + Intergenic
1169805922 20:9559012-9559034 GTGAGGGCAGTGTGGGAAAATGG - Intronic
1169854166 20:10085319-10085341 AGGAGGGCAGAGTAGGAAGATGG + Intergenic
1169876032 20:10297827-10297849 CTGAGAGCACAGAGCAAAGAAGG + Intronic
1169998139 20:11582615-11582637 CTGACAACTGAGAGGGAAGAAGG - Intergenic
1170276250 20:14593382-14593404 GTGAGGTGAGGGAGGGAAGAAGG + Intronic
1170409517 20:16073591-16073613 ATGAGGGATGAGAGAGAAGAAGG + Intergenic
1170501800 20:16982390-16982412 ATGAAGGAAGAGAGGGAGGAAGG - Intergenic
1170663263 20:18363123-18363145 CTGAGACCAGTGAGGGCAGATGG + Intergenic
1171190275 20:23154036-23154058 GTGAGGACACAGAGAGAAGATGG - Intergenic
1171390223 20:24796582-24796604 CTGAGGGCAGTGGGGGTACAGGG + Intergenic
1171862435 20:30413062-30413084 AGGAAGGCAGAGAGGGAAGGAGG + Intergenic
1171893720 20:30741705-30741727 CTGAGGGAAGCGATGGAAAACGG + Intergenic
1172042046 20:32052587-32052609 CTGGGGGCAGCGAGGGGAGACGG + Intronic
1172241005 20:33412457-33412479 GTGGGGGAAGAGAGGGCAGAGGG + Intronic
1172481777 20:35275809-35275831 CTAAGAGCAGTGTGGGAAGATGG - Exonic
1172518360 20:35551568-35551590 GTGAGGGCAGATGGAGAAGAAGG + Intronic
1173155281 20:40603252-40603274 ATGAGGGAAGGGAGGGAGGAGGG + Intergenic
1173184611 20:40831024-40831046 GGGAAGGCTGAGAGGGAAGAAGG - Intergenic
1173502077 20:43561288-43561310 CTGAGGGCAGTCAGGAAGGAGGG + Intronic
1173524385 20:43720874-43720896 GTGAGTGCTGGGAGGGAAGATGG + Intergenic
1173575874 20:44112775-44112797 CAGGGGGCAGGGTGGGAAGAGGG - Exonic
1173595057 20:44253669-44253691 CAGGGGGCAGAGATGGCAGATGG + Intronic
1173609872 20:44359238-44359260 AGGAGGGCAGAGAGGAAGGAAGG - Intronic
1173614661 20:44394903-44394925 CTAAGGACAGGGAGGGAGGAAGG + Intronic
1173730480 20:45325127-45325149 GTGGGGGCAGAGAGGTAAGAAGG - Intergenic
1173872524 20:46350891-46350913 CTGGGGGCAGAGAAGCAGGAGGG + Intronic
1173873841 20:46357583-46357605 GTGAGGGCAGAGCAGGAAGAGGG - Intronic
1173904177 20:46613793-46613815 CTCAGGGCAGAGGGGGAAGGAGG + Intronic
1173904190 20:46613822-46613844 CTGGGGGCAGAGGGGGAAGGAGG + Intronic
1173983312 20:47241544-47241566 GTGAGGGCAGGCAGGGAGGAGGG + Intronic
1174057901 20:47811099-47811121 CTGAGAGCAGAAAGGGCTGAGGG + Intergenic
1174160378 20:48546215-48546237 CTGAGAGCAGAAAGGGCTGAAGG - Intergenic
1174560574 20:51428091-51428113 AGGAAGGGAGAGAGGGAAGAAGG + Intronic
1174669590 20:52294099-52294121 GGGAGGTCAGAGAGGGAGGATGG - Intergenic
1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG + Intronic
1175222775 20:57426868-57426890 GTGAGAGCATAGTGGGAAGAGGG - Intergenic
1175224815 20:57439073-57439095 CAGAGGGCAGCTAGGGAAGCCGG - Intergenic
1175345748 20:58273451-58273473 TTGAGGGCAGCAAGGGAAGGAGG + Intergenic
1175466862 20:59195220-59195242 CTGGGGGCAGAGAGAAAAGGGGG + Intronic
1175487291 20:59355448-59355470 GAGAGGGGAGAGAGGGGAGATGG - Intergenic
1175487488 20:59356063-59356085 CAGATGGGAGAGAGGGGAGAGGG - Intergenic
1175699835 20:61128934-61128956 TTGATGGCAGAGATGGAAGAGGG + Intergenic
1175751266 20:61499579-61499601 CTGAGGTCACACAGGGAGGAGGG + Intronic
1176107363 20:63395728-63395750 AAGAGAGTAGAGAGGGAAGAAGG + Intergenic
1176282028 20:64318760-64318782 CTGGGGGCAGAGGGAGTAGAGGG + Intergenic
1176781586 21:13201247-13201269 ATGAGGCCAGAGAAGAAAGAGGG + Intergenic
1177746380 21:25219504-25219526 AGGAAGGCAGAGAGGGAAGCAGG + Intergenic
1177979287 21:27890396-27890418 ATGAGGCCAGAGAAGAAAGAGGG + Intergenic
1178981294 21:37267382-37267404 CTGCCGGCAGAGAGGGAAAGGGG - Exonic
1179008578 21:37535400-37535422 ATGAGGGCAGAGAGGGGATCAGG + Intergenic
1179475407 21:41640034-41640056 CTGAGGCCTGAGAGGGACCAGGG - Intergenic
1180004602 21:45014540-45014562 CAGAGGGGAGAGAGACAAGAGGG + Intergenic
1180033503 21:45229013-45229035 CTGAGGGCATAGCGGGAGGTGGG - Intergenic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180107371 21:45629033-45629055 CTGAGGCAAGAAAGGGAGGAAGG + Intergenic
1180222575 21:46368610-46368632 CTGAGGGCAGAGAAAGCACAAGG - Intronic
1180785887 22:18547564-18547586 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1180829004 22:18888244-18888266 GAGAGGGCAGAGCGGGGAGATGG + Intergenic
1180874951 22:19170935-19170957 CTGAAGGAAGAAAGGGAGGAAGG - Intergenic
1180935167 22:19620670-19620692 CTGAGGGCATGGCGAGAAGACGG + Intergenic
1181033769 22:20160320-20160342 CTGAGGCCAGAGAGGGCTGAAGG - Intergenic
1181042356 22:20198137-20198159 CTGAGGCCAGAGCGGGGAGATGG - Intergenic
1181131173 22:20733289-20733311 CTGTGGGCAGTGAGGGAGGAGGG - Intronic
1181242812 22:21487118-21487140 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181308868 22:21932948-21932970 CAGAGAGAAGAGAGGGAAGCTGG - Intronic
1181509587 22:23383087-23383109 CTGAGGCCAGAGAGGAATGGAGG + Intergenic
1181525686 22:23484397-23484419 GAGAGGGCAGAGCGGGGAGATGG + Intergenic
1181654653 22:24287021-24287043 CTGTGGCCAGAAAGGTAAGAGGG + Intronic
1181771809 22:25131265-25131287 ATGGGGGCAGGGAGGGAAAAGGG - Intronic
1181907415 22:26210322-26210344 CTGGGGGCAGAGAAGGAAACAGG - Intronic
1181928946 22:26383801-26383823 CTGAGCTAAGAGAGGGAGGATGG - Intergenic
1181945046 22:26510008-26510030 TTTAGGGAAGAGGGGGAAGATGG - Intronic
1182056494 22:27359524-27359546 CTGAGGGCAGTGAGAGGAGATGG + Intergenic
1182120925 22:27786187-27786209 CTGAAGGCAGAGAGACAGGAAGG + Intronic
1182150855 22:28026176-28026198 TTGAGGGCAGAGGGGGAAGGGGG + Intronic
1182200164 22:28560482-28560504 ATGAGGTCAGAGAGGTAGGAGGG - Intronic
1182676562 22:32043657-32043679 CTGTGAGCAGAGAAGGAAGGTGG + Intronic
1182738238 22:32546577-32546599 CTCAGGCCAGAGAGGGTAGTTGG + Intronic
1182868807 22:33627983-33628005 CTGAGAGCAGAGTGGGGTGATGG - Intronic
1182989380 22:34752311-34752333 ATGAGGTCAGAGAGGTAAGCAGG - Intergenic
1183136023 22:35888625-35888647 CTCATGGCAGAAAGGGAAGAGGG + Intronic
1183354545 22:37351162-37351184 CTGGGAGGAGAGAGGGGAGAAGG - Intergenic
1183730905 22:39617837-39617859 CAGAGAGCAGGGAGGGAGGAGGG - Intronic
1183738506 22:39657139-39657161 CTGGGGGCAGTGGGGGAAGTTGG - Intronic
1184291153 22:43498780-43498802 GTGGGGGCAGAGAGGAGAGATGG - Intronic
1184515792 22:44961409-44961431 CCTAGAGCAGAGAGGGAAGGAGG - Intronic
1184645985 22:45895776-45895798 CTGAGGTCAGGCAGGGAAGGTGG + Intergenic
1185051669 22:48557325-48557347 GTGAGGACACAGAGAGAAGACGG + Intronic
1185092959 22:48786213-48786235 CAGACAGCAGAGAGGAAAGAAGG - Intronic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
1203279095 22_KI270734v1_random:114232-114254 GAGAGGGCAGAGCGGGGAGATGG + Intergenic
949188965 3:1228354-1228376 CTGAGGGCAGAGAGGTCATCTGG + Intronic
949483736 3:4518133-4518155 CTGCGGGCAGACAAGGAAGCTGG - Intronic
949539298 3:5019939-5019961 CTGTGGCCAGAGAGGAAAGGGGG - Intergenic
949694646 3:6680662-6680684 CTGTGGCCAGAGAGAGAAAATGG + Intergenic
949852448 3:8432905-8432927 AAGAAGGCAGGGAGGGAAGAAGG + Intergenic
949918923 3:8986247-8986269 CTGGGGGCTCAGAGGGATGAGGG - Intronic
949986159 3:9542907-9542929 CTTAGGGCTGAGAAGGAAGGAGG + Intronic
950100777 3:10355435-10355457 CTGAAGGAAGTGAGGGAAGATGG + Intronic
950118559 3:10467009-10467031 CTGAGGCCAAAAAGAGAAGAAGG - Intronic
950173618 3:10856290-10856312 CTGCGGGTTGAGAGGGAAGCAGG + Intronic
950408457 3:12819094-12819116 CTGAAGGCAGGGAGGTGAGAAGG - Intronic
950426557 3:12927630-12927652 CTCAGAGCACAGAGGGAAGAGGG + Intronic
950484480 3:13264989-13265011 CTGAGGGCAGAAGGATAAGAAGG + Intergenic
950494241 3:13324235-13324257 CTGAGGGTGGACAGGGAGGAAGG - Intronic
950542067 3:13618696-13618718 CTGGGGGCAGAGGGGGTAGAAGG - Intronic
951724609 3:25743312-25743334 TTGAGGTCAGAGAGGGAAGAGGG - Intronic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952255302 3:31690000-31690022 AGGTTGGCAGAGAGGGAAGAAGG + Intronic
952277568 3:31892206-31892228 CTGAGGACGGAGTGGGGAGAGGG + Intronic
952364392 3:32662066-32662088 CTGAGGGGAGGGAGTGGAGAGGG + Intergenic
953477862 3:43221266-43221288 CTGAGGCCAGAGAGGTCAGCAGG + Intergenic
953636618 3:44670161-44670183 CTGAGGGCAGGTGGGGAAGAGGG + Intergenic
953931673 3:47008894-47008916 ATGAGGACAGAGAGGGTATATGG + Intronic
954139198 3:48596181-48596203 ATGAGGGCAGTGAGGAAAGGAGG - Intergenic
954349096 3:50027498-50027520 CTGGGGGTAGAGAAGGAAGTAGG - Intronic
954441346 3:50523956-50523978 CTGATGGCAGAGAGGGAGACAGG - Intergenic
954587847 3:51752193-51752215 CAGATGGCAAAGGGGGAAGAAGG + Intergenic
954658549 3:52213217-52213239 CTAAAGGCAGAGATGGAAGGGGG + Intronic
954697916 3:52437276-52437298 GTGATGGAAGAGAGAGAAGAGGG - Intronic
954914328 3:54135927-54135949 TTGAGGCCACAGATGGAAGAAGG + Intronic
955536078 3:59925106-59925128 CTGTGGGGAGAGAGAAAAGAAGG - Intronic
956013741 3:64859130-64859152 CTGAGGGATGAGAGGGCAAAGGG + Intergenic
956289673 3:67648289-67648311 CTGAAGCCAGAGAGAGAGGAAGG + Intronic
956427511 3:69152108-69152130 CTCAGGGAAGAGAGAGAATAGGG - Intergenic
956455362 3:69415459-69415481 TAGAGGGCAGAGGGGGAAGAGGG - Intronic
956593317 3:70939669-70939691 AAGAAGGCAGGGAGGGAAGAAGG - Intergenic
956651582 3:71509347-71509369 GTGATGACACAGAGGGAAGATGG - Intronic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
957078224 3:75618184-75618206 ATGAGGGCAGAGAGGAGAGATGG + Intergenic
957175401 3:76801938-76801960 CTGAGGAGAGAGAGAGATGAGGG + Intronic
957586941 3:82144916-82144938 CAGAGAGCAGACTGGGAAGAGGG + Intergenic
957790868 3:84939672-84939694 CACAGGGCAGAGAGGGAAGAAGG + Intergenic
957979871 3:87494716-87494738 ATGGGGGAAGGGAGGGAAGAAGG + Intergenic
958018084 3:87966153-87966175 CTGAGGTTAGAGTGAGAAGACGG - Intergenic
958786115 3:98597949-98597971 ATGAGGCCAGAAAGGGATGAGGG + Intergenic
959256846 3:104025832-104025854 CAGGGGGCAGGGAGGGAAGGAGG + Intergenic
959537641 3:107504740-107504762 CATGGGGCAGAGAGGGAAAATGG + Intergenic
959672918 3:108999337-108999359 ATGGGGGCAGGGAGGGAATATGG + Intronic
959700533 3:109294650-109294672 CTCTGTGCAGAAAGGGAAGAAGG - Intronic
960609838 3:119545499-119545521 CTGAGGGGAGAGGGGGAAAGGGG - Intronic
960692507 3:120361548-120361570 ATGAGGCCAGAGAGGGAGGCTGG + Intergenic
960812349 3:121636965-121636987 GTGAGGGGAGAGAGGAGAGATGG - Intronic
960934890 3:122892758-122892780 AAGAGGGAAGGGAGGGAAGAAGG - Intergenic
961014072 3:123454036-123454058 CTGGGGGCAGAGGAGGAGGAGGG - Intergenic
961014286 3:123455497-123455519 CTGAGGCACGAGGGGGAAGATGG - Intergenic
961021131 3:123508064-123508086 TTTAGGGCAAAGAGGGAAAAGGG + Intronic
961086088 3:124068603-124068625 ATGAAGGCAGATGGGGAAGAGGG - Intergenic
961088377 3:124089731-124089753 GTCAGGGCAGTGAGGGAGGATGG + Intronic
961312427 3:126012027-126012049 CTGAGGCCAGAGAGGCCGGAAGG - Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961543720 3:127617875-127617897 CTGATGGCAGAAGGGGATGAGGG - Intronic
961566058 3:127763978-127764000 CTGAGAGCCGGGAGGGAGGAGGG - Intronic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
961635794 3:128331507-128331529 TTGAGGAAGGAGAGGGAAGAGGG - Intronic
962126626 3:132626212-132626234 CTGAGAGTAGAGAGGCAATATGG - Intronic
962161618 3:133006535-133006557 CAGAGGGCAGACAGGCAAGGGGG + Intergenic
962391285 3:134974917-134974939 AGGAGAGCAGAGAAGGAAGAAGG - Intronic
962433678 3:135345375-135345397 CTGAGAGCAGAGAAGGAGGATGG + Intergenic
962756117 3:138466819-138466841 CTCAGGGCAGAAGGTGAAGAGGG + Intronic
962903477 3:139780719-139780741 CTGAGGGCAGCCAGGGGACAAGG - Intergenic
963613715 3:147507493-147507515 TTGGGGGGAGGGAGGGAAGAAGG - Intronic
963673870 3:148284204-148284226 ATGAGGACATAGAGAGAAGATGG - Intergenic
963692884 3:148526649-148526671 CTGGGGGCTGTGAGGGAAGTGGG + Intergenic
963721217 3:148864419-148864441 CTGAGGACAGAGAGAAGAGAAGG + Intergenic
963979806 3:151524882-151524904 ATGATGGAAGAGAAGGAAGAAGG - Intergenic
964488837 3:157213292-157213314 AGGAGGGCACAGAAGGAAGATGG + Intergenic
964645631 3:158956162-158956184 CTGAGGGCAGAGGGAAAAGAGGG + Intergenic
964820003 3:160757815-160757837 CAGAGGGCAGAGAAGAAAGTTGG - Intronic
965137958 3:164798651-164798673 ATGAGGTCAGAGAGGTAGGAAGG - Intergenic
965928692 3:174015326-174015348 CTGAGGTCAGAGAGGCAGAATGG + Intronic
966318743 3:178677517-178677539 CTGAGGGCAGCAGGGGAAGGTGG - Intronic
966366905 3:179198251-179198273 TTGAGGGCAGGGAGTGAAAAAGG + Intronic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
966889389 3:184395606-184395628 CTGAGGGAAGGTGGGGAAGAGGG + Intronic
966892502 3:184417451-184417473 CGGGGGGCGGAGAGGGAGGAGGG + Intronic
967048908 3:185763976-185763998 GTGAGGGCAGAGAGAGAAGAGGG + Intronic
967182717 3:186920275-186920297 TTGAAGGCAGAGAGAGATGAAGG + Intergenic
967248398 3:187512522-187512544 CAGAGGGCAGAGAGGGAAAGAGG + Intergenic
967774910 3:193376319-193376341 GTGAGGGCACAGAGAAAAGATGG - Intronic
968339260 3:197941323-197941345 CAGAGGGGAGAGAGAGAGGAAGG - Intronic
968339268 3:197941366-197941388 GGGAGGGGAGAGAGGGAGGAAGG - Intronic
968974750 4:3816189-3816211 CAGAGGGCACAGAGGTCAGAGGG - Intergenic
969021296 4:4142157-4142179 ATGAGGGCAGAGAGGAGAGATGG + Intergenic
969070759 4:4536663-4536685 GTGAGGCCAGAGAGGGAGCAGGG + Intronic
969228996 4:5816691-5816713 GGGAGGGGAGAGAGGGGAGAAGG - Intronic
969409996 4:7021876-7021898 CTGAGGGCAGCAGGGGAAGGTGG + Intronic
969566523 4:7982011-7982033 CTGGGGCCAGAGAGGGGAGAAGG - Intronic
969643453 4:8412798-8412820 CGCAGGGCAGCGAGGGAGGATGG - Intronic
969732569 4:8965259-8965281 ATGAGGGCAGAGAGGAGAGATGG - Intergenic
969792148 4:9499342-9499364 ATGAGGGCAGAGAGGAGAGATGG - Intergenic
970011784 4:11467634-11467656 CTGAGGGGTGAAAGGGAAGAAGG + Intergenic
970030830 4:11672738-11672760 ATGAGAGCAGAGAGGAAATAAGG - Intergenic
970436928 4:16044827-16044849 CTGAGGGGACAGGGGGAAGTAGG + Intronic
970444520 4:16112703-16112725 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970444529 4:16112724-16112746 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970444538 4:16112745-16112767 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
970701504 4:18745969-18745991 CCAGGGGCTGAGAGGGAAGAAGG - Intergenic
970955393 4:21805063-21805085 CAGAGGGCTGAGAAGGCAGAAGG + Intronic
971144040 4:23957200-23957222 CTGACTGCTGAGAGGGGAGAAGG - Intergenic
971144093 4:23957686-23957708 CTGATGGGAGAGAGAGAACAAGG + Intergenic
971345738 4:25810270-25810292 ATGAAGGCAGAGAGGGGAGGGGG - Intronic
971366824 4:25984355-25984377 GTGAGGGCACAGGGAGAAGAGGG - Intergenic
971583529 4:28374903-28374925 CTGAGGGCAGAGTGGAATGTTGG + Intronic
971734383 4:30427450-30427472 CAGAAGGCAAAGAGGGAACAAGG + Intergenic
973027883 4:45295479-45295501 CTGAGGTCAGAGAGGTCAGGAGG - Intergenic
973562175 4:52148354-52148376 AGGAGAGAAGAGAGGGAAGATGG + Intergenic
973723707 4:53751107-53751129 CTGCAGGCTGGGAGGGAAGAAGG - Intronic
974471200 4:62320077-62320099 CAGAGGACATAGAGGAAAGAAGG + Intergenic
974925180 4:68289387-68289409 CTGAGGGTAAAGACAGAAGATGG + Intergenic
975323600 4:73035915-73035937 CAGAGGACACACAGGGAAGAAGG - Intergenic
975612975 4:76219611-76219633 CTGAGGGGAGAAAGGGGGGATGG + Intronic
975756607 4:77577918-77577940 GTGAGGACAGAGGAGGAAGAAGG - Intronic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976609587 4:87016191-87016213 TTGTGGGGAAAGAGGGAAGAGGG + Intronic
977055606 4:92186841-92186863 CTGAGGGCTGTGAAAGAAGAAGG + Intergenic
977711033 4:100125834-100125856 CATAGGGAAGAGAGGGGAGAAGG + Intergenic
978066395 4:104408448-104408470 TGGATGGCAGAGAGGGAAGAAGG - Intergenic
978099801 4:104824198-104824220 CAGAGGGTAGGGAGGGAGGAGGG + Intergenic
978164162 4:105586878-105586900 CTGAGGGCAGAGAGGTGTGAGGG - Intronic
978277400 4:106968183-106968205 ATGTAGGCAGAGAGGGAAAAAGG + Intronic
978285334 4:107071679-107071701 CTGAAGCCAGAGAGGTAAGTGGG - Intronic
978386506 4:108180785-108180807 AAGAGGGAAGAGAAGGAAGAAGG + Intergenic
978919186 4:114161992-114162014 CCCCAGGCAGAGAGGGAAGAAGG + Intergenic
979382851 4:120029039-120029061 CTGAGGGCAGCGGGGAATGAGGG - Intergenic
979977212 4:127211747-127211769 TTGAGGTCAGAGTGGCAAGAGGG - Intergenic
980008775 4:127571428-127571450 TTGAGGGGAGAGAGGTGAGATGG - Intergenic
980731256 4:136826675-136826697 CAGAGTGCAGAGAGGTAGGAGGG - Intergenic
980874540 4:138647919-138647941 TTGAGGACAGAGGGAGAAGATGG - Intergenic
981460919 4:145012990-145013012 TTGGAGGAAGAGAGGGAAGAGGG - Intronic
981745908 4:148052230-148052252 AGGAGGAGAGAGAGGGAAGAAGG - Intronic
982194783 4:152900032-152900054 CAGATAGCAGAGAGAGAAGATGG + Intronic
982240903 4:153298415-153298437 GTGAGGACAAAGAGGCAAGAAGG - Intronic
982406543 4:155026780-155026802 CTTAGGGGAGGAAGGGAAGAGGG - Intergenic
983210441 4:164952877-164952899 GTGAGAGCAGAGAAAGAAGACGG - Intergenic
983372565 4:166879895-166879917 CAGGAGGCAGAGAGAGAAGAGGG - Intronic
983506493 4:168558545-168558567 CAGAGTTCGGAGAGGGAAGAAGG - Intronic
983534480 4:168842756-168842778 ATGAGGGCATGGAGAGAAGACGG - Intronic
983703297 4:170625099-170625121 CTGATGGCCGAGATGGCAGAGGG - Intergenic
983866837 4:172777399-172777421 CTAAGGTCAGAGAGGTAATACGG - Intronic
983998515 4:174214092-174214114 CCGACGGCTGAGAAGGAAGATGG - Intergenic
984210078 4:176836590-176836612 CTGAGGACACAGCGAGAAGATGG + Intergenic
984858861 4:184219286-184219308 CAGAGGGCAGAGGTGGAAGAGGG - Intronic
984910285 4:184668045-184668067 GTGAGGATAGAGTGGGAAGAGGG - Intronic
985364947 4:189219386-189219408 CTGAAGGAAGAAAGGAAAGAAGG + Intergenic
985625066 5:981600-981622 GAGGGGGCAGAGTGGGAAGAAGG + Intergenic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
986212821 5:5690188-5690210 GTGAGGGAAGTGAGGGAAGCAGG - Intergenic
986643434 5:9893663-9893685 CTGAGGGGAGAGGGGGGATAGGG - Intergenic
986827548 5:11538242-11538264 CTAATGGGAGAGTGGGAAGAAGG + Intronic
987114297 5:14714081-14714103 CTGACCGCAGGCAGGGAAGATGG - Intronic
987881068 5:23746928-23746950 CTGAGGACAGTTAGGGAACAGGG + Intergenic
988011963 5:25500438-25500460 TAGAGGGGAGAGAGGGAAGAAGG - Intergenic
988450413 5:31336909-31336931 CTTAGGGCAAGAAGGGAAGAGGG + Intergenic
988511711 5:31869843-31869865 CTGAGGGCAGAGAGAGGGGTGGG + Intronic
988515072 5:31897395-31897417 CTGAGGGCTGAGAGGACAAAGGG - Intronic
989271952 5:39544176-39544198 CTGAGGGCAGTCAGGGCAGAGGG - Intergenic
989481668 5:41937763-41937785 CAGAAGGCAGAAAGGGAAGCGGG + Intronic
989502133 5:42179864-42179886 TTGAGGGTAGAGAGGAAAGAGGG + Intergenic
989507853 5:42247988-42248010 CAGAAGGAAGAGAGAGAAGAGGG + Intergenic
989604124 5:43227629-43227651 CTGAGGGGAGAAAGGGAATTGGG + Intronic
989795583 5:45467296-45467318 CAGAGGGCAGTGAGGAAATAAGG - Intronic
990432453 5:55749644-55749666 GTGAGGACAGAGTGGGAGGAAGG - Intronic
990889800 5:60635273-60635295 ATAAGGGCAGAGAGGTAATAAGG + Intronic
991650502 5:68847739-68847761 ATGAGGGCAGACAGAGAAGAGGG + Intergenic
991733893 5:69614205-69614227 GAGAGAGGAGAGAGGGAAGAGGG - Intergenic
991810327 5:70469346-70469368 GAGAGAGGAGAGAGGGAAGAGGG - Intergenic
991860373 5:71007937-71007959 GAGAGAGGAGAGAGGGAAGAGGG + Intronic
992258583 5:74947434-74947456 CGTAGGAGAGAGAGGGAAGAAGG - Intergenic
992376301 5:76191162-76191184 CAGAAGGAAGAGAGAGAAGAGGG + Intronic
992391888 5:76337239-76337261 CTGAAGACACAGAGAGAAGATGG - Intronic
992556995 5:77913720-77913742 CTGAGGTCAGAGAGGAAGGCAGG - Intergenic
992846606 5:80755647-80755669 CTGAGGGAACAGATGGAAAAAGG + Intronic
994285319 5:97957571-97957593 AAGTGGGCAGAGAGGGAAAAAGG - Intergenic
994466526 5:100140137-100140159 CTGAGAGCAAAGAGGAAAAAAGG + Intergenic
995164080 5:109016963-109016985 GTGAGGACACAGTGGGAAGAAGG + Intronic
995396898 5:111696742-111696764 GTGAGGACACAGAGAGAAGATGG - Intronic
995624023 5:114056885-114056907 ATGAAGGGAGAGAGGGCAGAAGG + Intergenic
995721919 5:115144342-115144364 CTGAGGGAAGAGAAGGATGAAGG - Intronic
996646535 5:125824892-125824914 CAGAGGGCAGAGAGGAAACTAGG + Intergenic
996930030 5:128875141-128875163 CAGAAGGCAAAGAGGGAAGCCGG - Intronic
996977503 5:129452443-129452465 TTGGGGGCAAAGAGGGAAAAGGG - Intergenic
997055932 5:130444442-130444464 GTGAAGGCAGAGAAGGAAAAAGG - Intergenic
997093312 5:130882561-130882583 CAGAGGACAGACAGGCAAGAGGG + Intergenic
997119884 5:131163372-131163394 CTGAGGGCAGAGAGCTCAGAAGG - Intronic
997234476 5:132264864-132264886 AAGAGGGCAGATAGGGAAGCTGG - Intronic
997405887 5:133646369-133646391 ATGAGGTCAGAGAGGTAAGCAGG + Intergenic
997886500 5:137634859-137634881 CTGAGGGCTGAGAGTGAGGTTGG + Intronic
998114703 5:139527281-139527303 CTGTGGGGAGAGGGGGAAGGGGG - Intronic
998799493 5:145854935-145854957 GGGAAGGCAGAGAGGGAAGGAGG + Intergenic
999467601 5:151822420-151822442 CTGAGGGCTGGGAGGAAAGGAGG - Intergenic
1000122317 5:158209009-158209031 CTGAGGGCAGAGAGTGGAGAGGG + Intergenic
1000256248 5:159541268-159541290 ATGAGGGCAGAGAGGTAGGCAGG + Intergenic
1000419311 5:161020341-161020363 CAAAGGACGGAGAGGGAAGATGG - Intergenic
1000529622 5:162403155-162403177 GTGAGGGCTGATAGGGAAGTAGG + Intergenic
1000984930 5:167855956-167855978 AGGAGGGAAGGGAGGGAAGAAGG + Intronic
1000989683 5:167898983-167899005 TTCAGGGAAGAGAGGCAAGAGGG + Intronic
1000990443 5:167906558-167906580 CTGAGGCCAGAGTGGGTAGGAGG - Intronic
1001106071 5:168855713-168855735 CTGGGGGCAGGGAGGGAATGGGG + Intronic
1001133015 5:169079928-169079950 CAAAGGGAAGAGAGAGAAGAGGG + Intronic
1001557610 5:172647233-172647255 CTTAGAGCAGAGAGGGAAGAGGG + Intronic
1002027005 5:176402576-176402598 CTCATGGCAGGGAGGGAAGGGGG - Intronic
1002031066 5:176430899-176430921 CGGATGGCAAAGAGGGAAGCAGG + Intergenic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1002439172 5:179255529-179255551 GTGGAGGCAGAGAGGGAAGATGG - Intronic
1002959604 6:1901908-1901930 CAGAGGGGAGACAGGGAAAAGGG + Intronic
1003116441 6:3286814-3286836 CTGGGTGCAGGGAGGGAAGCTGG - Intronic
1003127599 6:3368040-3368062 CTGAAGGCAGAGAGCAAAGGAGG + Intronic
1003242120 6:4353927-4353949 GTGAGGGCAGAGAGGGAAGAAGG - Intergenic
1003517568 6:6829959-6829981 AGGAAGGCAGGGAGGGAAGAAGG + Intergenic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003972173 6:11310306-11310328 CAGTGGGCAGAGAGGGAAGTGGG - Intronic
1004282532 6:14293186-14293208 CCGATGGCAGAGAGAGGAGATGG + Intergenic
1004285697 6:14318564-14318586 CTAAGGGGAGAGAAGGAACAGGG - Intergenic
1004331804 6:14728697-14728719 ATGTGGGCAGAGAAGGAGGAGGG + Intergenic
1005021436 6:21423197-21423219 CGGAGGGCAGAGGGTGGAGAGGG - Intergenic
1005159596 6:22843595-22843617 CAGAGGGCAAAGAGGAAGGAGGG - Intergenic
1005463898 6:26093272-26093294 CCCAGGGCACAGTGGGAAGAGGG + Intronic
1005837899 6:29721635-29721657 CTGAGGGATGAGAGGGACGGAGG + Intergenic
1005851498 6:29826584-29826606 CTGAGGGATGAGAGGGACGGAGG + Intergenic
1005987017 6:30881946-30881968 CTGAGGCCAGGGAGCGAAGGAGG - Intronic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006169117 6:32082952-32082974 ATGAGAGCAAAGAGGGAAGATGG - Intronic
1006294712 6:33165037-33165059 GGGAGGGCTGGGAGGGAAGAGGG - Intronic
1006304717 6:33212013-33212035 CTGAGGGCAGTGGTAGAAGAGGG + Intronic
1006335123 6:33416362-33416384 CTGGGGGCAGAGACTGAGGAGGG + Exonic
1006361229 6:33588569-33588591 CTGAGGGCAGTAAGGGGAGATGG - Intergenic
1006474327 6:34245012-34245034 GTGAGGGCACAGGTGGAAGATGG - Exonic
1006519534 6:34563317-34563339 CTGAGGGTAGGGAGGGTAGTGGG + Intergenic
1006535421 6:34695874-34695896 CTGAGGATAGATAGGGAAAAGGG - Intronic
1006654892 6:35582471-35582493 GTGAGTGGAGAGAGGGCAGAGGG - Intronic
1006903417 6:37517244-37517266 CTGAGGGCAGTCGGGGAGGAGGG + Intergenic
1007027351 6:38589886-38589908 CTTAAGGTAGAGAAGGAAGAAGG - Intronic
1007324799 6:41051772-41051794 CTGAGGCCAGAGAGAGATGATGG - Intronic
1007377438 6:41466531-41466553 AGGAAGGAAGAGAGGGAAGAAGG + Intergenic
1007406418 6:41638451-41638473 CTGGAGGGAGAGAAGGAAGAAGG + Exonic
1007685520 6:43665233-43665255 CAGAGGGCAGATAGGGCTGATGG - Intronic
1007718888 6:43873679-43873701 CTGAGGTCAGGGAGGTAACAGGG + Intergenic
1007760599 6:44131360-44131382 CTGAGGGGAGGAGGGGAAGATGG - Intronic
1007761264 6:44134994-44135016 CTGAGGGAAGAGGGGGCAGTTGG - Intronic
1007957400 6:45929990-45930012 CTGGGGGCTGGGAGGGAGGAAGG + Intronic
1008288397 6:49682761-49682783 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1008750305 6:54725139-54725161 CTGAGGCCAGTGGGGGAAGAAGG + Intergenic
1008858552 6:56121170-56121192 CTCATGGCATAGAGGGTAGAAGG + Intronic
1009370125 6:62889123-62889145 CCGTGGGAAGAGAGAGAAGAGGG + Intergenic
1010835579 6:80584013-80584035 CTGAAGGAAGTGAGGGAACACGG + Intergenic
1011629497 6:89310492-89310514 GAGAGGGTAGAGAGAGAAGATGG - Intronic
1011939620 6:92826615-92826637 CAGATGGCAAAGGGGGAAGAAGG - Intergenic
1012067090 6:94561430-94561452 CTGAGGCCACAGAGGTAGGAAGG - Intergenic
1012555386 6:100505339-100505361 CAGAGGGTAGTGAGGGGAGAAGG + Intergenic
1012731821 6:102892910-102892932 CTGAGGGCCGTGAGTAAAGATGG + Intergenic
1012997663 6:105989835-105989857 ATGAGGGCAGAGAGACAACAGGG - Intergenic
1013346242 6:109263380-109263402 GTGAAGGCAGAGGGAGAAGATGG + Intergenic
1013355467 6:109342438-109342460 CTGATGGCAGAGCGAGAAGTGGG + Intergenic
1013420521 6:109962589-109962611 CTGTGTTCAGAGAGGAAAGAGGG + Intergenic
1013724741 6:113080133-113080155 GGGAGGGAAGAGAGAGAAGAAGG + Intergenic
1013805234 6:113989405-113989427 GTGAGGACACAGAGAGAAGAGGG - Intronic
1014688636 6:124533870-124533892 GTGAGGACACAGAGGGAAGATGG - Intronic
1015008110 6:128309367-128309389 CTGATGGCAGAGAGGGGTGGGGG + Intronic
1015121763 6:129708168-129708190 TTGAGGGCAGGGAGGAAGGAGGG - Intronic
1015330889 6:131977890-131977912 CTGGGGGCTCAGAAGGAAGAGGG - Intergenic
1015823064 6:137283347-137283369 ATGAGGGCAGAGAGGGGACAGGG - Intergenic
1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG + Intronic
1017240438 6:152162377-152162399 ATGATGGTAGAGAGGGAAAAAGG - Intronic
1018083337 6:160277599-160277621 CTGAGGTCAGGGGGAGAAGATGG - Intronic
1018425334 6:163674882-163674904 CAGAGTGAAGAGGGGGAAGATGG + Intergenic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1018916138 6:168133574-168133596 CTGGAGGCAGCGCGGGAAGAAGG + Intergenic
1019158900 6:170056645-170056667 CTGAGGACAGAAAGAGATGAGGG - Intergenic
1019301551 7:306754-306776 CTCCAGGCAGAGAGGGAACAAGG - Intergenic
1019302272 7:311846-311868 CTCCAGGCAGAGAGGGAACAAGG + Intergenic
1019508412 7:1404943-1404965 GAGAGGGAGGAGAGGGAAGAGGG + Intergenic
1019554590 7:1622600-1622622 CTGAGGGCAGAGAGGTCTCACGG - Intergenic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019717067 7:2543974-2543996 ATGGGGGAAGAGAGGGAAAAGGG + Intronic
1019762885 7:2826776-2826798 TTGAGGGGAGACAGGGAAGGAGG + Intronic
1019928657 7:4209273-4209295 GGGAGGGCAGAGAGGGAGGAGGG + Intronic
1020106043 7:5422770-5422792 CTGATGGGAGAGAGGGAGGGAGG - Intronic
1020133785 7:5574683-5574705 CTAAGGGAAGAGAAGGAAGGAGG + Intergenic
1020308715 7:6854186-6854208 ATGAGGGCAGAGAGGAGAGATGG + Intergenic
1021273176 7:18617322-18617344 GAGAGGTCAGAGAGGGAATAAGG - Intronic
1021376536 7:19914721-19914743 GTGAAGGCTGAGAGAGAAGAGGG - Intergenic
1021817098 7:24457908-24457930 CTTATGGAAGAGAGGAAAGAAGG - Intergenic
1021840326 7:24717133-24717155 CTGTGGGAAGAGAGGGAAAGAGG - Intronic
1022308044 7:29168658-29168680 CTGAGGTTTGAGGGGGAAGAGGG - Intronic
1022456538 7:30563240-30563262 CTAAGGGCAGAGGGAGCAGAGGG + Intergenic
1022470001 7:30676296-30676318 CTGCTGGGAGAGAGGGAAGGTGG - Intronic
1022539960 7:31126170-31126192 GTGAGGACACAGAGAGAAGACGG + Intergenic
1022863985 7:34398385-34398407 GTGAGGACACAGAGAGAAGATGG - Intergenic
1023585310 7:41724023-41724045 AAGAGGGGAGAGAGGGAAAAAGG + Intergenic
1023828963 7:44028329-44028351 CTGGGGTCAGAGGGGGAAGGAGG + Intergenic
1023965326 7:44961005-44961027 CTGAGGGCTGAGGGGGTTGAGGG + Intergenic
1023965641 7:44961974-44961996 CTGAGGGCTGAGGGGGCTGAGGG + Intergenic
1023968794 7:44977188-44977210 CTGAGAGTGGAGAAGGAAGAAGG + Intronic
1024047085 7:45592309-45592331 GTGAGGGCACAGAGGGAAGGCGG - Intronic
1024561373 7:50648136-50648158 GGGAGCGCAGAGAGGGGAGACGG + Intronic
1024626923 7:51215801-51215823 CACAGGACAGAGAGGGATGAGGG + Intronic
1024957037 7:54933266-54933288 CTGGTGGCAGAGAGGGAGGGAGG + Intergenic
1025005279 7:55349364-55349386 CTGAGAGCAGTGGAGGAAGAAGG + Intergenic
1025010638 7:55394820-55394842 CTGAGTGCAGAGCGGGCAGGCGG + Intronic
1025035122 7:55589027-55589049 CTCAGGCCAGAGAGGAAAGGTGG + Intergenic
1025079313 7:55968167-55968189 ATGGGGGCAGACAGGGAGGAGGG - Intronic
1026112077 7:67466396-67466418 GGGAGGGGAGAGAGGGAGGAAGG - Intergenic
1026137774 7:67678551-67678573 TTGAAGGCAGGGAGAGAAGAGGG - Intergenic
1026450216 7:70522446-70522468 AGGAGTGGAGAGAGGGAAGAAGG - Intronic
1026600925 7:71776658-71776680 CTGAGAGCAGAGAAGAAAGATGG + Intergenic
1026845549 7:73697137-73697159 CTGAGGGGTATGAGGGAAGAAGG - Intronic
1026941681 7:74290705-74290727 CTGTGGGCAGAGGAGGAGGAGGG + Intronic
1026970217 7:74463119-74463141 CTGAGGGTAGGGAAGGAAGGTGG + Intronic
1027052401 7:75028539-75028561 CTGAGTGCAGCAAGGGGAGAGGG - Intronic
1027428742 7:78088325-78088347 CAGAGGTCAGAGAGGAGAGAAGG - Intronic
1027428831 7:78088958-78088980 CAGAGGTCAGAGAGGACAGAAGG + Intronic
1027738239 7:81963368-81963390 TAGAAGGGAGAGAGGGAAGAGGG + Intronic
1027743327 7:82040649-82040671 CTGTGTGGAGACAGGGAAGATGG + Intronic
1028245927 7:88477195-88477217 CTGAGATGAGAGTGGGAAGAAGG + Intergenic
1028252045 7:88548030-88548052 TGGCTGGCAGAGAGGGAAGATGG + Intergenic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1028513770 7:91653848-91653870 CTCAGGGAGGAGAGAGAAGATGG - Intergenic
1028624840 7:92865862-92865884 TTGAGGGGAGAGAGTGAAGAGGG + Intergenic
1028943416 7:96551136-96551158 ATGAAAGGAGAGAGGGAAGAGGG + Intronic
1029252567 7:99247571-99247593 CTGGTGGGAGGGAGGGAAGATGG - Intergenic
1029413091 7:100427792-100427814 GTGAGGGAAGAGAGGAAAAATGG - Intronic
1029449650 7:100633592-100633614 CGGAGGAGAGGGAGGGAAGAGGG + Intronic
1029495596 7:100894377-100894399 ATGAGGGGAGAGAGGGAGGGAGG + Intronic
1029730406 7:102434494-102434516 CTCAGGGCAGTGAGGGCTGAGGG - Intronic
1029739262 7:102482586-102482608 CTGGGGTCAGAGGGGGAAGGAGG + Intronic
1029757263 7:102581765-102581787 CTGGGGTCAGAGGGGGAAGGAGG + Exonic
1029775203 7:102680826-102680848 CTGGGGTCAGAGGGGGAAGGAGG + Intergenic
1029793701 7:102871907-102871929 CTGGGGGCAGGGAGGGAAATAGG - Intronic
1029919158 7:104244082-104244104 GAGAGGGGAGAAAGGGAAGAGGG - Intergenic
1030380358 7:108803946-108803968 CAGGGGGGAGAGAGGGAAGCAGG - Intergenic
1031066827 7:117114512-117114534 GTGATGGCAGAGACTGAAGAAGG - Intronic
1031192763 7:118575723-118575745 ATGAGGTCAGAGAGGGAGCAGGG + Intergenic
1031492509 7:122406462-122406484 CTGCAGGAAGACAGGGAAGAAGG + Intronic
1031569438 7:123341007-123341029 CTGAGGACAGAGAGAAAGGAGGG - Intergenic
1031912838 7:127535430-127535452 TTGAGGGCAGAGAGGGACTTAGG - Intergenic
1032201366 7:129825328-129825350 CGGGGGGCAGGGTGGGAAGAGGG - Intergenic
1032388344 7:131539678-131539700 CTGAGGGCGGGGCTGGAAGAAGG + Intronic
1032517466 7:132517809-132517831 CTGAGGGCAGTGAGGGAGTTGGG + Intronic
1032746304 7:134790110-134790132 GAGAGGACAGAGAGGGAGGAAGG + Intronic
1033547152 7:142412046-142412068 CAGAGAGCAGAGAGTGAACATGG + Intergenic
1033557636 7:142502463-142502485 CTGAGGCCAGAGCTGGAGGAGGG - Intergenic
1033585353 7:142770758-142770780 CTGAGAGCAGAGAGGGAGACCGG - Intergenic
1033599057 7:142876145-142876167 CTGGGGGCTGAAAGGGAAGGTGG + Intronic
1033653896 7:143361267-143361289 CTGGGGGAAAAGAGGAAAGATGG + Intronic
1033760800 7:144434741-144434763 CTGAGAGCAAATAGGGTAGAGGG + Intergenic
1034230381 7:149521153-149521175 CAGAGGCCAGGGAGGGATGAAGG + Intergenic
1034277210 7:149829206-149829228 CTGAGGGGACTGTGGGAAGAGGG - Intergenic
1034391145 7:150788549-150788571 CTGAGGACACAGGGAGAAGACGG - Intergenic
1034634429 7:152555962-152555984 TGGAGACCAGAGAGGGAAGAGGG - Intergenic
1034686038 7:152972328-152972350 CTGAGAGCACAGAGGCAGGAAGG + Intergenic
1034686048 7:152972398-152972420 CTGAGAGCATAGAGGCAGGAAGG + Intergenic
1035038085 7:155908372-155908394 CTGAGGGCAGGGAGGAGAGGGGG - Intergenic
1035076394 7:156180446-156180468 GTCAGGGCAGAGAGGGAATCAGG - Intergenic
1035087031 7:156269092-156269114 CTGGGGGCAGATGGGGAGGAGGG + Intergenic
1035562658 8:617824-617846 CAGAGGGCAGTGAGGACAGATGG - Intronic
1035562693 8:618132-618154 CAGAGGGCAGTGAGGACAGATGG - Intronic
1035567312 8:650174-650196 CTGAGTGCAGAGAGGAACGCGGG - Intronic
1036010544 8:4717075-4717097 CTCGGGGCAGAGAGGGAAGAAGG - Intronic
1036519034 8:9473365-9473387 GTTAGGGAAGAGAGGGAGGATGG - Intergenic
1037209354 8:16366890-16366912 AAGAGGGGAGAGTGGGAAGAGGG + Intronic
1037220397 8:16512586-16512608 TGGAGGGCAGAGATGGCAGACGG + Intronic
1037588788 8:20295944-20295966 GAGAGGGGAGAGAGGGAAGGAGG - Intronic
1037606127 8:20438644-20438666 CAGAGGGCAGGATGGGAAGAGGG + Intergenic
1037885976 8:22596604-22596626 CTCAGTGCAGGAAGGGAAGAGGG - Intronic
1037935679 8:22913581-22913603 CTGAGGGAAGAGGAGGAGGAAGG - Intronic
1037949696 8:23010846-23010868 ATGAGGACACAGAGTGAAGAAGG + Intronic
1038040338 8:23718706-23718728 ATGAGGTCAGAGAGGTAAGGGGG + Intergenic
1038435403 8:27532197-27532219 CTGAGGGGAGAGGGTGAGGAGGG - Intronic
1038492591 8:27981491-27981513 GTGAGGGGAGACAGGGAAGCTGG - Intronic
1038697574 8:29819660-29819682 GGGAGGGCAGAGAGGGCACAGGG - Intergenic
1038919894 8:32071060-32071082 CTGAGGGCAGAAGGATAAGAAGG - Intronic
1038922185 8:32097002-32097024 CTGAAGGCAGGGAAGGATGAGGG - Intronic
1039045907 8:33449200-33449222 CTGTGGGCACTGAGAGAAGAAGG + Intronic
1039352950 8:36782297-36782319 ATGAGGGAAGGGAGGGAGGAAGG - Intergenic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1039438947 8:37581394-37581416 CTGGGGGCACAGAAGGAACATGG - Intergenic
1039471469 8:37815930-37815952 ATGAGAGCAGAGATGGGAGACGG - Intronic
1039545761 8:38410052-38410074 CTGAGGAGAGCCAGGGAAGAAGG - Intergenic
1039634486 8:39148210-39148232 ATGAGGTCAGAGAGGTAAAAGGG - Intronic
1039689645 8:39850298-39850320 CCGAGAGCTGAGAGGGAATAAGG - Intergenic
1040064454 8:43133765-43133787 CAGGGGGCAAAGAGGAAAGAGGG + Intergenic
1040523568 8:48198544-48198566 CTGAGGGCAGCAAGTGGAGAAGG - Intergenic
1040537582 8:48323329-48323351 CTGAGTGGAGACAGGGCAGAGGG + Intergenic
1040547043 8:48406855-48406877 CTGAGGTCAGCGAGGGAAGATGG + Intergenic
1040661180 8:49577643-49577665 CTGAGGAATGGGAGGGAAGAAGG - Intergenic
1040747277 8:50660476-50660498 CAGAGGGGAGAAAGGAAAGAAGG + Intronic
1041231359 8:55756539-55756561 AAGAGGAAAGAGAGGGAAGAAGG - Intronic
1041301278 8:56414438-56414460 CCGAAGGCAGAGAGGAAAGATGG + Intergenic
1041465961 8:58157872-58157894 CTCAGGGAAGAGAGGTGAGATGG - Intronic
1041527521 8:58823798-58823820 CTAGGGGCGAAGAGGGAAGAAGG + Intronic
1041604048 8:59759451-59759473 TTGAGCGCAGGGAGGGAACATGG - Intergenic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1041796896 8:61754352-61754374 AAGGGGGCAGAGAGGAAAGAGGG - Intergenic
1041930254 8:63279098-63279120 CTGAGAGCAGTCAGTGAAGAAGG - Intergenic
1042035919 8:64533796-64533818 CCGAAGGCAGAGAGGTATGAGGG + Intergenic
1042081151 8:65052927-65052949 CTTAGGGAGGGGAGGGAAGATGG - Intergenic
1042502808 8:69527873-69527895 CTGAGAGCAGAGAGACAAGGAGG + Intronic
1042765416 8:72315850-72315872 CAGGAGACAGAGAGGGAAGAGGG + Intergenic
1042823056 8:72952754-72952776 CTGAGGGAAGAGGGTGAAGAGGG - Intergenic
1042942123 8:74118381-74118403 AGGTGGGGAGAGAGGGAAGAAGG - Intergenic
1043285962 8:78531783-78531805 AGGAGGAGAGAGAGGGAAGAAGG + Intronic
1043355614 8:79408841-79408863 GAGAGGGCAGAGGGGGATGAGGG - Intergenic
1043500030 8:80844352-80844374 CTGAGGCCATAGCGAGAAGATGG - Intronic
1043692104 8:83167689-83167711 ATCATGGCAGACAGGGAAGAAGG - Intergenic
1043885700 8:85597290-85597312 ATAAGGCCAGAGAGGTAAGACGG - Intergenic
1044581697 8:93832083-93832105 ATGAGGGTAGAGAGGAAAGTTGG - Intergenic
1044699150 8:94950070-94950092 CTGAAGGCAGAGAGGTCAGCAGG + Intronic
1044880471 8:96718137-96718159 CTGAGGGGTGAGTGGGAAGTGGG - Intronic
1044923411 8:97188839-97188861 CAGAGGGCACAGTGGGTAGAGGG - Intergenic
1045203191 8:100008570-100008592 CTGAAGGAGAAGAGGGAAGAAGG + Intronic
1045351731 8:101347250-101347272 CTGAGAGGAGAAAGGGAGGAAGG + Intergenic
1045606078 8:103778410-103778432 CAGAGGCCAGAAAGGGCAGAGGG - Intronic
1046104498 8:109649421-109649443 CTTGGGGCAGAGAGGGCAGTGGG + Intronic
1046681809 8:117178889-117178911 GTGGGGGAAGAGAGAGAAGAAGG + Intergenic
1046886626 8:119374727-119374749 CTGAGGGATGGGAAGGAAGAAGG + Intergenic
1046960689 8:120110087-120110109 GTGAGATCAGAGTGGGAAGAGGG - Intronic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1047574485 8:126137768-126137790 CTGGGGGAAGAGAGTGAAGGGGG + Intergenic
1047722832 8:127657676-127657698 CAGAGGGAAGGCAGGGAAGAAGG + Intergenic
1047784203 8:128137884-128137906 CTGAGAGCTGAGATGGGAGAGGG + Intergenic
1047849129 8:128837441-128837463 GGGAGGGCAGAGATGGAACATGG + Intergenic
1047892877 8:129331915-129331937 GTGAGAGCAGACAGGGGAGATGG - Intergenic
1048079494 8:131110116-131110138 CTGAGGTCAGAGAGGGTATGAGG - Intergenic
1048285812 8:133140821-133140843 ATGAGGCCAAAGAGGGAAGAAGG - Intergenic
1048334052 8:133490094-133490116 CTTTGGGCAGAGAAGGAAGTTGG + Intronic
1048353611 8:133635488-133635510 CTGAGGGCAGAGAGGTGAGGGGG + Intergenic
1048510658 8:135059221-135059243 GTCAGGGCTGAGGGGGAAGAGGG + Intergenic
1048670998 8:136719618-136719640 CAGAGTGCAGATAGGGAAAAGGG + Intergenic
1048936921 8:139365141-139365163 GTGAGGACACAGAGAGAAGACGG - Intergenic
1048946143 8:139449328-139449350 GTGAGGGCACAGGGAGAAGAGGG - Intergenic
1049036279 8:140078785-140078807 CTGGGGGCAGGGAGGGGAGGTGG - Intronic
1049152480 8:141044237-141044259 CAGAGGGTAGAGTGGGAAGCTGG - Intergenic
1049161144 8:141098736-141098758 CTGAGGTCAGGGAGGTAACACGG - Intergenic
1049343492 8:142126382-142126404 GAGAGGGCAGATAGGGAACATGG + Intergenic
1049399436 8:142418321-142418343 CGCAGGGCAGAGGGGGCAGAGGG + Intergenic
1049417243 8:142500653-142500675 CTGAGGTCAGAGAGGGAGGGTGG + Intronic
1049561873 8:143316169-143316191 CTCAGGGCAGACAGGGAGGGTGG - Intronic
1049592037 8:143466961-143466983 CTAAGGCCAAGGAGGGAAGAAGG + Intronic
1049595540 8:143481638-143481660 CTGAAGGCAGACAGGGACGATGG + Intronic
1049621664 8:143601002-143601024 CTGGGGGCAGATGGGGACGAGGG - Exonic
1049641954 8:143719844-143719866 CTGAGGGAAGAGGTGGAGGAAGG + Intronic
1049696663 8:143987304-143987326 CTGAGGGGTGAGTGGGAAGTAGG - Intronic
1049733179 8:144189575-144189597 CTGAGGGCAGAGCTGGGAGCGGG - Intronic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1050414152 9:5397624-5397646 AAGAGGGGAGAGAGGGAAGAAGG + Intronic
1050446581 9:5729027-5729049 CTGGAGACAGAGAGGGGAGAGGG - Intronic
1050513052 9:6413983-6414005 CAGAGGGCGGGGAGGGCAGAGGG + Intronic
1050933796 9:11366903-11366925 GCGTGGGCAGAGAGGGGAGAGGG + Intergenic
1051074227 9:13210953-13210975 TTGAGAGAAGAGAAGGAAGAAGG - Intronic
1051362332 9:16292203-16292225 GTGAGGTCAGAGAGGAAAGCAGG + Intergenic
1051467660 9:17398915-17398937 TTTTTGGCAGAGAGGGAAGAAGG - Intronic
1051622966 9:19070886-19070908 CAGACTGCAGAGTGGGAAGAAGG + Intronic
1051747150 9:20305927-20305949 GTGAAGGCAGAGGGAGAAGATGG - Intergenic
1052067517 9:24040566-24040588 CACAGAGCAAAGAGGGAAGATGG - Intergenic
1052901055 9:33795342-33795364 CTGAGAGCAGAGAGGGAGACTGG - Intronic
1052976070 9:34411174-34411196 GTGAGGGAAGAGAGGAAACAGGG - Intronic
1053188675 9:36040770-36040792 ATGTGGGAAGTGAGGGAAGAAGG + Intronic
1053316103 9:37053002-37053024 CTGAGGACAGAGAGGGATAGAGG - Intergenic
1053317496 9:37064332-37064354 CTGAGGTCAGAGGGGAAAGGAGG - Intergenic
1054814674 9:69463739-69463761 CTGCAGGGAGTGAGGGAAGAAGG + Intronic
1054925496 9:70584829-70584851 CACATGGCAGAGAGGGAACAGGG - Intronic
1055068231 9:72140397-72140419 AAGAGGGCAGAGAGAGAAGTTGG + Intronic
1055075564 9:72211808-72211830 CTGGGGGCAGTGGGAGAAGAGGG + Intronic
1055734620 9:79313566-79313588 CTGAGGAGAGAGGGGGAAGTTGG - Intergenic
1055767624 9:79681732-79681754 CTGGAGGCAGGGAGGGAAGGAGG + Intronic
1056591377 9:87968445-87968467 CTGAGTGCAGGGAGGGGACAGGG + Intronic
1056665250 9:88576577-88576599 CTGAGGGGAGAAGGGGAAGAGGG + Intronic
1056684527 9:88748639-88748661 CTGAAGGCAAAGAGGGAGGCTGG + Intergenic
1056764141 9:89434565-89434587 AGGAGGGCAGAGAGGAGAGAAGG - Intronic
1057181366 9:93032581-93032603 CTGAGGGCAGAGAGCAAGGCTGG - Intronic
1057267602 9:93629639-93629661 CAGGGGGCAGGGAAGGAAGAGGG - Intronic
1057294983 9:93829669-93829691 CTGGGGCCAGAGAGAAAAGAGGG - Intergenic
1058643316 9:107107870-107107892 AGGAAGGCAGGGAGGGAAGAAGG + Intergenic
1058833169 9:108837507-108837529 CTGAGGGTAGAGAGGGAGGCTGG - Intergenic
1059277057 9:113106333-113106355 CTGTGTGCAGGGAGGGGAGAGGG + Intergenic
1059279194 9:113118218-113118240 CTGTGTGCAGGGAGGGGAGAGGG - Intergenic
1059287267 9:113185335-113185357 TTGTGGGAAGAGAGGAAAGAGGG + Intronic
1059529573 9:115023498-115023520 CTGAGGTCACAGAGTGAAGTTGG - Intronic
1059725986 9:117008481-117008503 CTTAGGACTGAGAGGGAAGTAGG + Intronic
1059754163 9:117276689-117276711 CTGAGGGCACAGAGAGACAAGGG + Intronic
1059989099 9:119847833-119847855 CTCAGAGCAAATAGGGAAGATGG - Intergenic
1060024856 9:120162309-120162331 CTGAGGTCAAAGAGGGCAGCAGG - Intergenic
1060260588 9:122070646-122070668 CTGAGGGGACAGAGGAATGAAGG + Intronic
1060496536 9:124123384-124123406 CAGAGGCCAGAGAAGGCAGATGG + Intergenic
1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG + Intronic
1060685364 9:125606200-125606222 AGGAAGGCAGGGAGGGAAGAAGG + Intronic
1060828375 9:126699212-126699234 CTGAGGCAAGAGAGGGAAAGAGG + Exonic
1060864401 9:126983687-126983709 ATGAGGGAGGAGAGGGAGGATGG - Intronic
1060995885 9:127874758-127874780 CTGAGGGCAGAGGGGGCTGCTGG + Intronic
1061077008 9:128347917-128347939 CTGAAAGGGGAGAGGGAAGAAGG + Intronic
1061159472 9:128884894-128884916 GGGAGGGCAGACATGGAAGATGG - Intronic
1061297674 9:129685846-129685868 CTGAGGGCGCAGAGGGAACCCGG + Intronic
1061338579 9:129960617-129960639 ATGAGGTCAGAGAAGAAAGAGGG + Intronic
1061507550 9:131039879-131039901 CTGAGGGGAGAGAGGGACAGGGG + Intronic
1061920460 9:133779751-133779773 TAGAGGCCAGAGAGGCAAGAGGG + Intronic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062201695 9:135306193-135306215 GGGAAGGGAGAGAGGGAAGAAGG - Intergenic
1062249192 9:135585846-135585868 CTGGGGCCTGGGAGGGAAGATGG - Intergenic
1062362604 9:136194748-136194770 GGGAGGGAAGAGGGGGAAGAGGG - Intergenic
1062438283 9:136556806-136556828 CTGTGGGCTGTGGGGGAAGAAGG - Intergenic
1062586069 9:137250679-137250701 CTGGGGGCACAGAGGCTAGAGGG - Intergenic
1203769682 EBV:43060-43082 CTGAGGTGAGTGTGGGAAGATGG + Intergenic
1185571286 X:1136824-1136846 GTGAGGGCACAGGGAGAAGACGG - Intergenic
1185606301 X:1368934-1368956 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185606342 X:1369169-1369191 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185606385 X:1369404-1369426 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185606426 X:1369636-1369658 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185606467 X:1369871-1369893 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185606550 X:1370333-1370355 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185606720 X:1371266-1371288 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185606763 X:1371498-1371520 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185606936 X:1372433-1372455 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185606979 X:1372665-1372687 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185607153 X:1373598-1373620 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185607278 X:1374297-1374319 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185607319 X:1374532-1374554 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185607402 X:1374996-1375018 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185607490 X:1375462-1375484 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185607667 X:1376395-1376417 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185610030 X:1388843-1388865 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185610065 X:1389077-1389099 GTGAGGGCACAGGGAGAAGACGG + Intronic
1185618424 X:1437473-1437495 GTGAGGACACAGGGGGAAGACGG - Intronic
1185672189 X:1821682-1821704 GTGAGGGCACAGGGAGAAGACGG - Intergenic
1185682023 X:1896832-1896854 GTGAGGGCACAGGGAGAAGACGG - Intergenic
1185704736 X:2258289-2258311 GTGAGGACACAGAGAGAAGATGG + Intronic
1185790209 X:2923600-2923622 CTGAGGACACAGGGAGAAGATGG - Intronic
1185808008 X:3078419-3078441 TGGAGGCCAAAGAGGGAAGATGG - Intronic
1185825525 X:3245542-3245564 TGGATGGCAGAGAGAGAAGATGG + Intergenic
1185843033 X:3410905-3410927 GTGAGGGCCCAGAGAGAAGACGG - Intergenic
1185859570 X:3565006-3565028 GTGAGTGCAGCGAGGGATGAAGG + Intergenic
1185986955 X:4845423-4845445 GTGAGGGCACAGAGAAAAGACGG + Intergenic
1186020607 X:5251177-5251199 GGCAGGGGAGAGAGGGAAGAAGG + Intergenic
1186020644 X:5251309-5251331 GGGAGGGGAGGGAGGGAAGAAGG + Intergenic
1186490700 X:9970154-9970176 AGGAAGGGAGAGAGGGAAGAAGG - Intergenic
1186749457 X:12606741-12606763 AGGAAGGGAGAGAGGGAAGAAGG - Intronic
1186892646 X:13974739-13974761 GTGAGGGCAGAGAAGTAACAGGG - Intergenic
1186932125 X:14405369-14405391 AGGAGGGAAGAGAGTGAAGAGGG + Intergenic
1187178576 X:16919770-16919792 CAGAAGGCAGAGAGGAAAGATGG + Intergenic
1187200839 X:17132349-17132371 CTGAAGGCAGAGAGGGAGAGGGG + Intronic
1187992780 X:24893946-24893968 CTGAAGGCAGAGACAGAAAAAGG - Intronic
1188160270 X:26791739-26791761 GTGAAGACAGATAGGGAAGAGGG - Intergenic
1188506829 X:30892028-30892050 CTGAGGAGAGAGAGGCTAGATGG - Intronic
1188522439 X:31053746-31053768 CTGAGGAGAGAGAGGGAGGGAGG - Intergenic
1188535385 X:31190972-31190994 CTGAGGGTAGAGAGAGCAAAAGG + Intronic
1188734578 X:33696705-33696727 ATGAGGGGAGGGAGAGAAGAAGG + Intergenic
1189074071 X:37897504-37897526 CAGAGGGCAGAGAGTTAACAAGG + Intronic
1189446539 X:41085834-41085856 CTGAGGGGAGAAGGGGAAGAGGG + Exonic
1190054712 X:47174906-47174928 CGGGGGGCAGAGAGGGAAAGGGG - Intronic
1190074047 X:47302678-47302700 CGGAGGGGAAAGAGGGAGGAGGG - Intergenic
1190153038 X:47964568-47964590 CAGAAGGGGGAGAGGGAAGAGGG + Intronic
1190209047 X:48429749-48429771 CAGAGGGCAGAGGGAGAAGTAGG + Intergenic
1190491886 X:50990624-50990646 CTGAGGGCAGAGAGGGAGGCAGG - Intergenic
1190501276 X:51081056-51081078 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1191675017 X:63784799-63784821 GGGAGGCCAGAGAGGGAAGGGGG - Intronic
1191955278 X:66637321-66637343 CTAGGGGCAGAGAGGGAACAAGG - Intronic
1192078203 X:68021841-68021863 CTGAGGGCAGTGGGGGCAGTGGG - Intergenic
1192325239 X:70126396-70126418 AGGAGGGCAGAGATGGAAGTTGG + Intergenic
1192424999 X:71067800-71067822 CTGAAGGAAGGGAGGGAGGATGG - Intronic
1192442293 X:71183482-71183504 CTGAGGCCAGAGGGGCAAGCTGG - Intergenic
1192554412 X:72078538-72078560 CTGTGGTTAGAGAGGAAAGAGGG - Intergenic
1192725099 X:73741673-73741695 CTGAAGTCATAGTGGGAAGAAGG - Intergenic
1192953595 X:76044298-76044320 CTCAGGCCAGAGAGGGAATGAGG - Intergenic
1193359924 X:80569976-80569998 CTGGGAGCACAGAGGGGAGAGGG - Intergenic
1193397402 X:81001926-81001948 TTGAAGGCAGAGAAGGAAGAGGG - Intergenic
1193737480 X:85175955-85175977 CTGAGGGCAGAGAGCAAAGATGG + Intergenic
1194250040 X:91563093-91563115 CCGAGGGGAGAGAGGCAAGAAGG - Intergenic
1194311558 X:92315456-92315478 CTGAGGCCAGAGAAGTGAGATGG - Intronic
1194585347 X:95726369-95726391 ATGAGGCCAGAGAGGCAGGAAGG + Intergenic
1195227123 X:102808384-102808406 CTGAGTCCAGAGTGAGAAGATGG - Intergenic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1195375588 X:104224441-104224463 CAGAGGCCAGAGAGGGGAGTTGG + Intergenic
1195705422 X:107734686-107734708 CTGAAGCAAGTGAGGGAAGAGGG + Intronic
1195903206 X:109819529-109819551 CTGAGGGAGCACAGGGAAGATGG + Intergenic
1195934620 X:110113023-110113045 CAGAGGGGAGGGAGGGAGGAAGG - Intronic
1196003790 X:110813890-110813912 ATGAGGTCAGAGAGGGAACAGGG + Intergenic
1196377920 X:115055200-115055222 GTGAGGGAAGAGAGAGAACAAGG - Intergenic
1197713470 X:129688862-129688884 CTGAGGGAAGAGCAGGAAGTAGG - Intergenic
1197957877 X:131972341-131972363 ATGATGGCAGAGAGGTAACAGGG + Intergenic
1197984662 X:132254888-132254910 GTGAGGGCAGAGGGAGAACAAGG + Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198520889 X:137451313-137451335 CAGAGGGAAGAAAGGGATGATGG + Intergenic
1198657921 X:138934983-138935005 CTGAGGGCAGGGGGAGAAGAGGG - Intronic
1198928695 X:141828050-141828072 CTAAGGGTAGAGAATGAAGAAGG - Intergenic
1200072817 X:153537426-153537448 GTGAGGGCAGAGCGGGAGGCTGG - Intronic
1200569002 Y:4804342-4804364 CTGAGGGGACAGAGGCAAGAAGG - Intergenic
1200619833 Y:5429590-5429612 CTGAGGCCAGAGAAGTGAGATGG - Intronic
1200875728 Y:8152720-8152742 CTGAAGGAAGCCAGGGAAGAAGG - Intergenic
1201232162 Y:11875670-11875692 GTGAGGGCCCAGAGAGAAGACGG + Intergenic
1201284103 Y:12364337-12364359 CTGAGGACACAGGGAGAAGATGG + Intergenic
1201316688 Y:12654303-12654325 ATGAGAGCAAATAGGGAAGAAGG - Intergenic
1202102691 Y:21327191-21327213 CTGAAGGAAGCCAGGGAAGAAGG - Intergenic
1202188979 Y:22221403-22221425 CTGAAGGAAGCCAGGGAAGAAGG - Intergenic
1202239764 Y:22754458-22754480 CTGAAGGAAGCCAGGGAAGAAGG + Intergenic
1202270962 Y:23073645-23073667 CAGAAGACAGAAAGGGAAGAAGG + Intergenic
1202295064 Y:23347037-23347059 CAGAAGACAGAAAGGGAAGAAGG - Intergenic
1202392750 Y:24388220-24388242 CTGAAGGAAGCCAGGGAAGAAGG + Intergenic
1202423957 Y:24707389-24707411 CAGAAGACAGAAAGGGAAGAAGG + Intergenic
1202446832 Y:24962696-24962718 CAGAAGACAGAAAGGGAAGAAGG - Intergenic
1202478033 Y:25281897-25281919 CTGAAGGAAGCCAGGGAAGAAGG - Intergenic