ID: 1157337910

View in Genome Browser
Species Human (GRCh38)
Location 18:46755060-46755082
Sequence CCTTCCCAGGGAGCGTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157337910_1157337917 19 Left 1157337910 18:46755060-46755082 CCAGGGAACGCTCCCTGGGAAGG No data
Right 1157337917 18:46755102-46755124 GTAAACAAATGTTCAGAACAAGG No data
1157337910_1157337915 -6 Left 1157337910 18:46755060-46755082 CCAGGGAACGCTCCCTGGGAAGG No data
Right 1157337915 18:46755077-46755099 GGAAGGTCCGGAGCAGCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157337910 Original CRISPR CCTTCCCAGGGAGCGTTCCC TGG (reversed) Intronic