ID: 1157339027

View in Genome Browser
Species Human (GRCh38)
Location 18:46762728-46762750
Sequence GTCCTCACGCATCACAATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157339027_1157339033 6 Left 1157339027 18:46762728-46762750 CCTGAATTGTGATGCGTGAGGAC No data
Right 1157339033 18:46762757-46762779 CCAGGTAAAGAGGTGGGACAAGG No data
1157339027_1157339031 0 Left 1157339027 18:46762728-46762750 CCTGAATTGTGATGCGTGAGGAC No data
Right 1157339031 18:46762751-46762773 GTTCAGCCAGGTAAAGAGGTGGG No data
1157339027_1157339030 -1 Left 1157339027 18:46762728-46762750 CCTGAATTGTGATGCGTGAGGAC No data
Right 1157339030 18:46762750-46762772 CGTTCAGCCAGGTAAAGAGGTGG No data
1157339027_1157339034 15 Left 1157339027 18:46762728-46762750 CCTGAATTGTGATGCGTGAGGAC No data
Right 1157339034 18:46762766-46762788 GAGGTGGGACAAGGTACTGTAGG No data
1157339027_1157339037 25 Left 1157339027 18:46762728-46762750 CCTGAATTGTGATGCGTGAGGAC No data
Right 1157339037 18:46762776-46762798 AAGGTACTGTAGGTGGAGGCTGG No data
1157339027_1157339036 21 Left 1157339027 18:46762728-46762750 CCTGAATTGTGATGCGTGAGGAC No data
Right 1157339036 18:46762772-46762794 GGACAAGGTACTGTAGGTGGAGG No data
1157339027_1157339035 18 Left 1157339027 18:46762728-46762750 CCTGAATTGTGATGCGTGAGGAC No data
Right 1157339035 18:46762769-46762791 GTGGGACAAGGTACTGTAGGTGG No data
1157339027_1157339029 -4 Left 1157339027 18:46762728-46762750 CCTGAATTGTGATGCGTGAGGAC No data
Right 1157339029 18:46762747-46762769 GGACGTTCAGCCAGGTAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157339027 Original CRISPR GTCCTCACGCATCACAATTC AGG (reversed) Intergenic
No off target data available for this crispr