ID: 1157341198

View in Genome Browser
Species Human (GRCh38)
Location 18:46779996-46780018
Sequence AGTTATCTGGAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157341198_1157341205 22 Left 1157341198 18:46779996-46780018 CCTGCCATCTTCTCCAGATAACT No data
Right 1157341205 18:46780041-46780063 CTTGGCCTGTTACTGGGCTTTGG 0: 169
1: 171
2: 103
3: 76
4: 232
1157341198_1157341206 25 Left 1157341198 18:46779996-46780018 CCTGCCATCTTCTCCAGATAACT No data
Right 1157341206 18:46780044-46780066 GGCCTGTTACTGGGCTTTGGTGG 0: 144
1: 161
2: 86
3: 68
4: 218
1157341198_1157341203 15 Left 1157341198 18:46779996-46780018 CCTGCCATCTTCTCCAGATAACT No data
Right 1157341203 18:46780034-46780056 GACAACTCTTGGCCTGTTACTGG 0: 17
1: 171
2: 183
3: 131
4: 176
1157341198_1157341204 16 Left 1157341198 18:46779996-46780018 CCTGCCATCTTCTCCAGATAACT No data
Right 1157341204 18:46780035-46780057 ACAACTCTTGGCCTGTTACTGGG 0: 17
1: 184
2: 186
3: 148
4: 230
1157341198_1157341201 4 Left 1157341198 18:46779996-46780018 CCTGCCATCTTCTCCAGATAACT No data
Right 1157341201 18:46780023-46780045 TCCTTTTGAGAGACAACTCTTGG 0: 17
1: 200
2: 191
3: 170
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157341198 Original CRISPR AGTTATCTGGAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr