ID: 1157345223

View in Genome Browser
Species Human (GRCh38)
Location 18:46823550-46823572
Sequence GTTTCATGTTACTAAGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157345223_1157345226 23 Left 1157345223 18:46823550-46823572 CCTGTCACTTAGTAACATGAAAC 0: 1
1: 0
2: 0
3: 15
4: 128
Right 1157345226 18:46823596-46823618 CTTACTTAGGCAACACCAAAAGG 0: 1
1: 0
2: 0
3: 9
4: 111
1157345223_1157345224 10 Left 1157345223 18:46823550-46823572 CCTGTCACTTAGTAACATGAAAC 0: 1
1: 0
2: 0
3: 15
4: 128
Right 1157345224 18:46823583-46823605 TAAATAGCTACTCCTTACTTAGG 0: 1
1: 0
2: 0
3: 15
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157345223 Original CRISPR GTTTCATGTTACTAAGTGAC AGG (reversed) Intronic
903041892 1:20536930-20536952 GTTTCAAGTTACTACGTTATGGG + Intergenic
903733837 1:25517453-25517475 GTGTCATGTTCCACAGTGACTGG - Intergenic
907060720 1:51421184-51421206 GTTTCATTTTACAAAGAGAAAGG - Intronic
907751774 1:57269757-57269779 ATTTCATGTTAGGGAGTGACTGG + Intronic
909413747 1:75382073-75382095 GTTTCCAGTTACAATGTGACTGG + Intronic
909768900 1:79394860-79394882 ACTGCATATTACTAAGTGACAGG + Intergenic
911632168 1:100195644-100195666 AATTCATGTTACTAAAAGACAGG - Exonic
911902112 1:103519804-103519826 GTTTTAAGTTACTAAGTAATTGG + Intergenic
912678769 1:111714036-111714058 ATTTCAGTTTAGTAAGTGACAGG - Exonic
913235446 1:116777125-116777147 GATGCATATTACTAAGTGAAAGG + Intergenic
915401897 1:155628029-155628051 GTTTCCAGTTACAATGTGACTGG - Intergenic
918437211 1:184527719-184527741 GTAACATGCTAGTAAGTGACAGG - Intronic
918504656 1:185238680-185238702 GTTTCCTGTTGATAAGTGAATGG - Intronic
920369028 1:205465835-205465857 GTCACATGTTGCTAAGTGGCAGG + Intergenic
921106807 1:211989347-211989369 GTTTTATTTTACCAAATGACTGG - Intronic
923465433 1:234244014-234244036 GATTCATGTTACTGGTTGACAGG - Intronic
1065489637 10:26269847-26269869 GTTTTGTTTTACTAAGTGGCAGG + Intronic
1067285583 10:44905420-44905442 GTTTCAAGTTACCAGGTGTCAGG - Intergenic
1069282835 10:66677120-66677142 GTTTCCTGTTTGTAAATGACTGG + Intronic
1071839187 10:89451363-89451385 GTTTCATGCTTCTAAGTGCCAGG - Intronic
1074844310 10:117383649-117383671 TTTTCATGTTTCTAAGTGAAAGG + Intergenic
1080613569 11:33926324-33926346 GTTTCATGTCACTAAGTTTGGGG + Intergenic
1083972708 11:66090755-66090777 GTTTTATGTTCCTCAGTGAAAGG + Intronic
1087724565 11:101703143-101703165 GTTTCCAGTTACAATGTGACTGG + Intronic
1092588507 12:9925757-9925779 GTTTCCTGTTACTATCTGAGAGG - Intronic
1093304909 12:17503891-17503913 GTTAGATGCTACTAAGTGGCAGG - Intergenic
1097636591 12:62130153-62130175 CTTTCATCTTCCCAAGTGACTGG + Intronic
1098099298 12:66996784-66996806 TTTTCATGTGAATAAGTGAAAGG - Intergenic
1098827995 12:75323245-75323267 GTTTCATGTTAAAAAGTTACGGG - Intronic
1099885494 12:88525124-88525146 GTTACATTCTACCAAGTGACTGG + Intronic
1100745339 12:97639491-97639513 GTTTGATGATACTCAGGGACAGG + Intergenic
1100886584 12:99077522-99077544 CTATCATTTTTCTAAGTGACAGG + Intronic
1102145782 12:110654238-110654260 TTTTCATGTTTCTCAGAGACTGG - Intronic
1107915865 13:45150003-45150025 GTTTCATGGTACCAAGAGAGGGG - Intronic
1108821258 13:54353435-54353457 GTTTCAGCCTACTAAGTGGCTGG - Intergenic
1109067797 13:57722297-57722319 GTTTCATGTTTCATATTGACTGG - Intronic
1109751073 13:66692839-66692861 GTGTCATGTTATTAACTGTCTGG - Intronic
1109882160 13:68493978-68494000 GTTTATTGTCACTAAGTGAAGGG + Intergenic
1112734811 13:102404060-102404082 GTTTCTTCTTAGTAAGTCACTGG - Intergenic
1116692222 14:48123202-48123224 CTTTGATGTTACTAGGCGACAGG + Intergenic
1116848552 14:49886840-49886862 GTTTCATGAAACTCAGTGATTGG + Intergenic
1119230428 14:72975142-72975164 GTTTCCTTTCACTAAGTGTCTGG + Intronic
1133929178 16:10218265-10218287 GCTGCATCATACTAAGTGACAGG + Intergenic
1134603214 16:15549718-15549740 GTTTCATGTGACCAACTGGCTGG - Intronic
1135862178 16:26066613-26066635 GTCTCATTTACCTAAGTGACAGG - Intronic
1137646926 16:50083538-50083560 GTTTGGTGTTTCTAAGTGCCTGG + Intronic
1137855680 16:51792322-51792344 GGTTCATGCTGCTAAGTGACAGG + Intergenic
1138184283 16:54964245-54964267 GTTTCTTGTTACACAGTAACTGG - Intergenic
1139729790 16:68933441-68933463 GTTTCAGGTTACTGAGTGTCAGG - Intronic
1140236023 16:73159659-73159681 GTTTTAAGTTACTAAGTGTTGGG + Intergenic
1140445812 16:75026952-75026974 ATTTCATCTTATTAAGTGCCCGG + Intronic
1145776205 17:27530878-27530900 GTGTTATTTTACTAAGCGACAGG - Intronic
1157345223 18:46823550-46823572 GTTTCATGTTACTAAGTGACAGG - Intronic
1163403284 19:17107500-17107522 GTTTCCTGTTGCTAAGTGTTAGG + Intronic
1164370449 19:27638980-27639002 GTTTCCAGTTACAATGTGACTGG - Intergenic
927095891 2:19747343-19747365 GTTTCATGTAACTAACTGTGAGG + Intergenic
928144406 2:28759123-28759145 CTATGATGTCACTAAGTGACAGG - Intronic
930171175 2:48253142-48253164 TTTTCATCTTAGTAAATGACAGG - Intergenic
935102329 2:100008592-100008614 GTTGCATGTTACTGAGGGAGTGG + Intronic
939253159 2:139709301-139709323 GTGTAATGTTATTAAGAGACAGG - Intergenic
940381010 2:153014831-153014853 GTCTCATGTTAGTAAGGGATAGG + Intergenic
941038953 2:160598976-160598998 GTTTCCTCTTGTTAAGTGACCGG - Intergenic
941556108 2:166984190-166984212 GTTTCTTGTCACTAAATGACAGG + Intronic
944974711 2:205035600-205035622 GTTTCATGATACTAAGGTACAGG - Intronic
945221856 2:207491519-207491541 GTTGCATATTACAAAGAGACAGG + Intergenic
945512151 2:210715795-210715817 GTGTCATGTTGATAAGTCACTGG - Intergenic
945645269 2:212484213-212484235 GTTTCATTTAACTAAGTGAAGGG + Intronic
948272481 2:236685258-236685280 GTTTCATGCTACTAAGTTTACGG - Intergenic
1170393127 20:15896858-15896880 ATTTCAAGTTACTAATTGATTGG + Intronic
1173530853 20:43768369-43768391 GTGTCAGGCTGCTAAGTGACAGG + Intergenic
1175301546 20:57946742-57946764 GCTTCATGTGTCCAAGTGACAGG - Intergenic
1177202039 21:17968242-17968264 GTTTCCTGTTACTAAAAGCCAGG + Intronic
1177670102 21:24213900-24213922 GTTTCATGATACGAAGGGATAGG - Intergenic
1180838549 22:18946467-18946489 GTTTCCAGTTACAATGTGACTGG + Intergenic
950030481 3:9849041-9849063 GTTTCCAGTTACAATGTGACTGG - Intronic
952806318 3:37356495-37356517 TTTTCAGGTTACTAAATGCCAGG - Intronic
955986214 3:64576607-64576629 TTTTCATGGTAATAAGTGCCAGG - Intronic
957462849 3:80544691-80544713 GTTACATGTTACTTAATGACAGG + Intergenic
957887889 3:86314127-86314149 CTTTCATATTACTATTTGACTGG + Intergenic
961297490 3:125898380-125898402 GTTTCACGTTACAATGTGACTGG + Intergenic
965346363 3:167555788-167555810 GTATCCTGTTATTAAGTGATGGG - Intronic
966328285 3:178781759-178781781 GTTTCATGTTAGAAAGTGTCAGG - Intronic
966799646 3:183750797-183750819 TTTTGTTGTTGCTAAGTGACAGG + Intronic
969978470 4:11128962-11128984 GTTGGATGTTTCTGAGTGACTGG - Intergenic
970473409 4:16399003-16399025 TTTTCATAATACTAATTGACAGG + Intergenic
970686319 4:18571748-18571770 GTATCATTTTACTGAGTGACTGG - Intergenic
970913503 4:21306566-21306588 TTTTCATGTTCCAAAGTTACCGG - Intronic
971847498 4:31939342-31939364 GTTTTATGTTACCAATTCACTGG + Intergenic
972694915 4:41435540-41435562 CTTCAATGTTTCTAAGTGACTGG - Intronic
977935581 4:102799812-102799834 GTTTCTTGGTACTCAGTGGCTGG + Intronic
977996867 4:103505105-103505127 GTTTCAAGTTACTAAGTTGTGGG + Intergenic
979826411 4:125239080-125239102 TTTTCATGTTAAAGAGTGACAGG + Intergenic
982619301 4:157683405-157683427 GTTTTTTGTGACTATGTGACAGG + Intergenic
983215797 4:165001517-165001539 GTTTCCAGTTACAATGTGACTGG + Intergenic
987448679 5:18054496-18054518 GCTTCATGTTTTTATGTGACTGG + Intergenic
988376761 5:30445887-30445909 ATTTCATGTTAGTAGGAGACAGG - Intergenic
989315914 5:40078431-40078453 GTTTCAAGCTACTAAGTTATGGG - Intergenic
990310598 5:54534274-54534296 GATTCCTGTTGCTTAGTGACTGG + Intronic
991538300 5:67697625-67697647 GTTTAATGTGACAGAGTGACTGG - Intergenic
994942015 5:106336147-106336169 GTTTCAAGTTACTAAGTTGGTGG + Intergenic
996176070 5:120359918-120359940 CTTTCATGTCACTACGTGATAGG + Intergenic
999162920 5:149520112-149520134 ATTTCAAGTTACTAAGTTAATGG + Intronic
999951802 5:156659069-156659091 GTTTCCAGTTACAATGTGACTGG - Intronic
1000769739 5:165337836-165337858 CTATGATGTCACTAAGTGACGGG - Intergenic
1002802696 6:540469-540491 GTTTTTTGTTACTAAGTAAGGGG - Intronic
1008765016 6:54901804-54901826 GGTTGATGTTATTTAGTGACAGG + Intronic
1010591554 6:77718300-77718322 GTTTCCAGTTACAATGTGACTGG - Intronic
1010906227 6:81493362-81493384 GTATTTTGTTCCTAAGTGACTGG + Intronic
1011933301 6:92740481-92740503 GTTACATGATACCAAGTGATTGG - Intergenic
1013718013 6:112987033-112987055 GTTTCTTTTTACTAAGGGAAAGG - Intergenic
1015199390 6:130562101-130562123 AATTCATGTTACTAAGTGAAAGG - Intergenic
1015240923 6:131022328-131022350 GTGTCACGTTACCATGTGACAGG - Intronic
1016032138 6:139348779-139348801 ATTTCAGGTTACTAGGTGTCAGG - Intergenic
1016664631 6:146622206-146622228 GTTTCATGTAACTAAGTTCCTGG - Intronic
1019976229 7:4583789-4583811 GTTTCCAGTTACAATGTGACTGG - Intergenic
1019977165 7:4592293-4592315 GTTTCCAGTTACAATGTGACTGG - Intergenic
1024070195 7:45778141-45778163 GTTTTAAGTTACTAAGTGTGTGG - Intergenic
1027798836 7:82726363-82726385 GTGACATGTTAGGAAGTGACAGG + Intergenic
1030356886 7:108553122-108553144 GCTGCATTTTACTAAGTGTCAGG - Intronic
1031673112 7:124576109-124576131 GTTTAATGCCACTAAGTGAGTGG + Intergenic
1033947095 7:146733223-146733245 GTTTCAAATTACTAAGGGTCTGG - Intronic
1035940488 8:3895182-3895204 GTTTCCTGTTACTAAGAAAATGG + Intronic
1037588940 8:20296899-20296921 GATTTTTCTTACTAAGTGACAGG - Intronic
1042027820 8:64442891-64442913 CTTTCAAGTTTCTAAGTCACAGG - Intergenic
1043360752 8:79469175-79469197 GTTTCATGTGACTAACAGAAAGG - Intergenic
1046940903 8:119930576-119930598 GTTTCAGGCTTGTAAGTGACTGG + Intronic
1047861675 8:128973707-128973729 ATTACATTTTACTAATTGACAGG - Intergenic
1047887033 8:129262846-129262868 GTTTCATACTAATAAATGACAGG + Intergenic
1051005843 9:12342665-12342687 GATTCATGCTACTAAATTACTGG + Intergenic
1051977440 9:22968723-22968745 GTGTAATATTAGTAAGTGACAGG - Intergenic
1055494808 9:76843644-76843666 GTTTGATGTTACTACATAACTGG + Intronic
1056145078 9:83721134-83721156 TTTTCATGTTATTATGTAACTGG - Intergenic
1057850625 9:98564418-98564440 GTTACATGATACTGTGTGACAGG + Intronic
1058370376 9:104259346-104259368 GGTTCATCTTTCTCAGTGACAGG + Intergenic
1058470565 9:105274008-105274030 GTTTCATGGTACTTAAAGACAGG + Intronic
1060362842 9:122976999-122977021 GTTTGCTGTGACTAAGTGACTGG + Intronic
1185852268 X:3500245-3500267 GATGCATGGTACTAAGTGAAGGG + Intergenic
1188898585 X:35699808-35699830 GTCACATGTGGCTAAGTGACAGG - Intergenic
1189539137 X:41967869-41967891 GTTTCATGTTTCAACTTGACTGG - Intergenic
1194640271 X:96395608-96395630 ATTTCAAATTACTCAGTGACAGG - Intergenic
1195521711 X:105838088-105838110 GTTACATTTTACTGAGTGCCAGG - Intronic
1197530762 X:127623000-127623022 GTTTCATAGTACTCAGTGAAAGG + Intergenic
1197999303 X:132415301-132415323 TTTTCATTTTACTTAGAGACAGG - Intronic
1201910831 Y:19132181-19132203 GTCACATGTTACTCACTGACAGG - Intergenic