ID: 1157346188

View in Genome Browser
Species Human (GRCh38)
Location 18:46836425-46836447
Sequence CTCATTCATTTGTAGATAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 266}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157346186_1157346188 -8 Left 1157346186 18:46836410-46836432 CCAGGTGGGCTTTTTCTCATTCA 0: 1
1: 0
2: 3
3: 18
4: 188
Right 1157346188 18:46836425-46836447 CTCATTCATTTGTAGATAGAGGG 0: 1
1: 0
2: 2
3: 12
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157346188 Original CRISPR CTCATTCATTTGTAGATAGA GGG Exonic
901302602 1:8210468-8210490 ATCTTTCATTTGTAAATAGGAGG + Intergenic
905511870 1:38528248-38528270 CCAATTCATTTGTAGAAAGATGG + Intergenic
908306413 1:62823573-62823595 GTCATTGGTTTGTAGATAAAGGG - Intronic
910544115 1:88394928-88394950 ATTATTAATTTGTATATAGAAGG + Intergenic
911112639 1:94207667-94207689 CTCCTCCATTTGTCAATAGATGG + Intronic
911793832 1:102052724-102052746 CTCAAACATTTGGAGATAGTTGG + Intergenic
912210236 1:107549029-107549051 GTCATTAGTTTGCAGATAGATGG - Intergenic
913044065 1:115058419-115058441 CTCCCTCATTTGTAGAATGAAGG - Intronic
914241074 1:145853572-145853594 CTCATTCATCTGTAGATAAAGGG + Exonic
914736299 1:150420511-150420533 TTCATTCATTTCTAAATAAATGG - Intronic
914820567 1:151099134-151099156 TTCATTCTTATTTAGATAGAAGG - Intronic
915029605 1:152866634-152866656 CCTATTCCCTTGTAGATAGATGG - Intergenic
916349220 1:163829946-163829968 CTCTGTCCTTTGTAGATAGTGGG + Intergenic
916669465 1:167001007-167001029 CTTATTCACTTGTTGATTGATGG - Intronic
917190447 1:172412858-172412880 GTCATTAATTTGGAGAAAGATGG + Intronic
917650818 1:177075812-177075834 TTCATTTCTTTGTAGATACAGGG + Intronic
917910276 1:179637572-179637594 TTAATTCTTTTGTAGATACAGGG - Intronic
918704090 1:187639439-187639461 TTCATTCATTTTTGGATACAAGG - Intergenic
919222581 1:194648955-194648977 CTCATTCAAATGTGGACAGAGGG - Intergenic
919547063 1:198937116-198937138 CTCTTTCATGTGTATATTGAAGG - Intergenic
921233864 1:213103032-213103054 CTAATTATTTTGTAGAGAGAGGG - Intronic
921374140 1:214456016-214456038 TTCATTTATTTGTAAAGAGATGG + Intronic
921786118 1:219231663-219231685 ATCATTCATTTTTAAACAGATGG + Intergenic
924445061 1:244121812-244121834 CTCATTCAATTCCAAATAGAAGG + Intergenic
924903843 1:248431502-248431524 CTCATTTATTTGTCTATTGATGG - Intergenic
924924027 1:248660503-248660525 CTCATTTATTTGTCTATTGATGG + Intergenic
1062948755 10:1479810-1479832 TTCATTCATTTGTCAAGAGAAGG + Intronic
1064118354 10:12597768-12597790 CTCCTTCATCTTTGGATAGAGGG - Intronic
1064760229 10:18611379-18611401 TACATGCATGTGTAGATAGATGG + Intronic
1064816845 10:19275098-19275120 CTCATTTATTTGTTAATATAAGG + Intronic
1068936835 10:62643972-62643994 CCCATTCATTTAGAGACAGAAGG - Intronic
1069224172 10:65920934-65920956 CTCATTTTTTTGTATCTAGATGG + Intronic
1071034598 10:81229440-81229462 TTCATTCATTTGTTGATAGTAGG - Intergenic
1071428602 10:85584254-85584276 CTCATGTATTTGAAAATAGAAGG + Intergenic
1072303805 10:94087445-94087467 CTTTTTCTTTTGTAGAGAGAGGG + Intronic
1072448987 10:95524094-95524116 CTTATTTATTTGTAGATATCAGG - Intronic
1072926967 10:99624265-99624287 CTCTTTCTTTTGTAGAGACAGGG + Intergenic
1073495568 10:103887978-103888000 CTCCTTCAATTGTGGACAGATGG + Intronic
1073812652 10:107167152-107167174 ATTGTTCATATGTAGATAGATGG + Intergenic
1075125540 10:119696158-119696180 CTGATTAATTTGAAGAAAGATGG - Intergenic
1077205387 11:1340098-1340120 CTCATTCATTCCTAGATATTTGG + Intergenic
1079502547 11:21117893-21117915 CTCATCCCTTTGTGGATGGATGG - Intronic
1082269841 11:50158277-50158299 TTTATTCATTAGTAAATAGAAGG + Intergenic
1083283396 11:61641616-61641638 TCTATTCATTGGTAGATAGATGG + Intergenic
1084322192 11:68379537-68379559 CTCAGTCATCTGCAAATAGAAGG - Intronic
1085488782 11:76893925-76893947 TTCATTCATTTGTGGAGTGAAGG + Intronic
1087398375 11:97632647-97632669 CTTACTTATTTGTAGATATAAGG + Intergenic
1088227940 11:107642243-107642265 CTCACTCATTTTTTAATAGATGG + Intronic
1088435527 11:109808238-109808260 ATCATTCACTTTTAGATATATGG - Intergenic
1089218451 11:116850394-116850416 ATCAGTTATTTGCAGATAGAAGG - Intronic
1090448128 11:126781839-126781861 CTTATTCATTGGTAGAAATAGGG + Intronic
1091062616 11:132477979-132478001 CTTATTCATTTTTAAATATATGG + Intronic
1092087565 12:5776051-5776073 CTGATTGGTTTGGAGATAGAGGG - Intronic
1095289073 12:40455017-40455039 TTTATTCATTTGTAAATAGGGGG - Intronic
1096165127 12:49416265-49416287 CTTATGCAGTTGGAGATAGATGG + Intronic
1097568536 12:61301224-61301246 CACATTCATTTGAAAAGAGAGGG - Intergenic
1097764116 12:63504086-63504108 CTAATTTATTTGTACATAGCTGG + Intergenic
1098370757 12:69758939-69758961 GTCATTCCTTTGTAGATAATTGG + Intronic
1099151752 12:79122794-79122816 CTCAGTTATTTGGAGAAAGATGG + Intronic
1099685869 12:85888143-85888165 CTCATTCATTTGAAGCCTGAAGG + Intergenic
1100378373 12:94038745-94038767 TGTATTCATTTGTGGATAGATGG - Intergenic
1102184793 12:110939598-110939620 TTGATTCTTTTGTAGAGAGAGGG + Intergenic
1103694852 12:122806650-122806672 CTCATTTTTTTGTAGAGACAGGG + Intronic
1104417067 12:128604276-128604298 TTAATTGATTGGTAGATAGATGG + Intronic
1106026783 13:25962853-25962875 CTCATGCAAATCTAGATAGAGGG + Intronic
1106521227 13:30499328-30499350 ATCATTCAGTTGTAGTTAGTAGG - Intronic
1106879947 13:34118099-34118121 CTGATTCAATTTTAGAAAGAGGG + Intergenic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1109427469 13:62184530-62184552 TTTATCCATTTGTTGATAGATGG - Intergenic
1117450704 14:55846679-55846701 GTCATGCATTTGCAGATAGACGG + Intergenic
1117509585 14:56436778-56436800 CTCATTAATTTTTTGATATACGG + Intergenic
1117964813 14:61195955-61195977 TTCAGTCCTTTATAGATAGATGG + Intronic
1118171626 14:63394971-63394993 TTCATTCATTACTAGAAAGATGG - Intronic
1118623044 14:67631602-67631624 CTTATTTATTTTTAGATACAGGG + Intronic
1119061472 14:71479400-71479422 TTCATTCATTTCTAGAGACAGGG + Intronic
1119568714 14:75650984-75651006 CTCATGCATCTGTAGATAGAAGG + Exonic
1119981164 14:79083033-79083055 CTCCTTCATTTTTAAATGGATGG + Intronic
1120486495 14:85120643-85120665 TTCAGTCATGTGTATATAGAAGG + Intergenic
1121724068 14:96133321-96133343 TTCATTCATATGCAAATAGATGG - Intergenic
1125544265 15:40490709-40490731 CTCATTTTTTTGTAGAGACACGG + Intergenic
1126046222 15:44643051-44643073 CTCATTCATTTTTATGTAGGAGG + Intronic
1128410658 15:67393685-67393707 CTAATTTTTTTGTAGATAGGGGG + Intronic
1129334435 15:74843780-74843802 CATATACATTTGTACATAGAGGG + Exonic
1130920711 15:88342206-88342228 TTCATTCATTTTTAGAGACAGGG + Intergenic
1131705275 15:94987899-94987921 TTAATGCATTTCTAGATAGAAGG + Intergenic
1132199283 15:99937821-99937843 CTTATTCATTTGTCCATTGATGG + Intergenic
1135379003 16:21977588-21977610 CTAATTCATTAGTAGTTCGAGGG + Intronic
1138854647 16:60674756-60674778 TTCATTCTTTTGTAGATAAAGGG + Intergenic
1139330548 16:66186239-66186261 CTCATGCATTTGCAGAGGGAAGG - Intergenic
1139403795 16:66702583-66702605 CTCATTTTTTTGTAGAGACAGGG - Intergenic
1140468301 16:75199651-75199673 CACATTTATTTGTATGTAGATGG + Intergenic
1142506082 17:364072-364094 CTCATTCATAGATAGATAGATGG + Intronic
1142721403 17:1778415-1778437 CTCAAACATTTGTAGAATGAAGG - Intergenic
1143425851 17:6836965-6836987 CTCATTCTTTTGTAGCTTCATGG - Intergenic
1143811156 17:9472832-9472854 CTCATCCCTTTCTAGTTAGATGG + Intronic
1145768815 17:27478046-27478068 CTCCTTCCTTTGAAGCTAGAGGG - Intronic
1146563825 17:33894814-33894836 CTCATTCCTTTGTAGACTGCTGG - Intronic
1147447429 17:40483113-40483135 CTAATTCTTTTGTAGAGACAAGG + Intronic
1147518831 17:41148813-41148835 CTCCTGCATTTGAAGAGAGATGG + Intergenic
1148490552 17:48021214-48021236 CTCTCTCATTTGTAAAAAGAAGG + Intergenic
1149040094 17:52177645-52177667 CTCTTTCATTTTTACATATAAGG - Intergenic
1149600630 17:57890924-57890946 CTCCCTCATTTGTAGACATAGGG + Intronic
1150427576 17:65088678-65088700 CTTATTCTTTTGTATATTGATGG + Intergenic
1150668171 17:67164831-67164853 CTCCTTGATATGTAGATAAAGGG - Intronic
1151044816 17:70907043-70907065 CTCATTCAGCTGAAGATAAAAGG + Intergenic
1153107647 18:1546363-1546385 CTCATTGATTTGAAGCTACATGG + Intergenic
1155136490 18:22999306-22999328 CTCATGCAGTTGTAGGCAGATGG + Intronic
1155158967 18:23180521-23180543 CTTATTTATTTGTAGAGACAGGG + Intronic
1155528095 18:26737700-26737722 CTCTTTCATTTATAGAAAGCAGG - Intergenic
1156608200 18:38694027-38694049 TTTTTTCATTTGTAGAGAGATGG + Intergenic
1156880945 18:42078456-42078478 CTGTTTCATTTGTAGATCAAAGG + Intronic
1156942880 18:42791892-42791914 CTCAGTAATTTGTCGAAAGATGG + Intronic
1157346188 18:46836425-46836447 CTCATTCATTTGTAGATAGAGGG + Exonic
1158170867 18:54597956-54597978 CTCCATCATTTGTGGATAGCTGG - Exonic
1158294673 18:55982649-55982671 CTCATTACTTTGTAGTTGGAAGG - Intergenic
1159071983 18:63634727-63634749 GTCATTCATTATTACATAGATGG - Intergenic
1159463958 18:68755455-68755477 CTCTTTCATGTGTAGAGAAATGG - Intronic
1159564077 18:70028220-70028242 CTCAGTGATTTTTAGACAGAAGG + Intronic
1159876077 18:73812736-73812758 CTCATTCACTTTTAAAGAGATGG - Intergenic
1160180291 18:76628795-76628817 TTTATTCATTTGTTGATGGATGG + Intergenic
1160491651 18:79342140-79342162 CTCATTCATTTATCTATTGACGG + Intronic
1161424288 19:4194088-4194110 CCCATTCATTTGTAGATCGTTGG - Intronic
1166992810 19:46703452-46703474 TTAAATCATTTGTAGAGAGAAGG - Intronic
927626951 2:24731746-24731768 TCCATTCATCTTTAGATAGAGGG + Intronic
928857822 2:35821561-35821583 CTCATTCTTTTTTAGAAAAATGG - Intergenic
930535523 2:52641376-52641398 CTCCTTCAGTTTTAGAAAGATGG - Intergenic
930689298 2:54343458-54343480 CCACTTCATTTGTTGATAGAAGG + Intronic
931213402 2:60218934-60218956 GTTATTCATTTGTAGATGTATGG + Intergenic
931255514 2:60568840-60568862 ATTATGCATTTCTAGATAGATGG + Intergenic
931559242 2:63539830-63539852 GCCATTTATTTATAGATAGATGG + Intronic
932439338 2:71722077-71722099 CACATTCATGGGTAGAGAGAAGG - Intergenic
932549556 2:72754057-72754079 CTCATTTTTTTGTAGAGACAAGG + Intronic
932844019 2:75116270-75116292 CTAATTTATTTGTAGAGAGGGGG + Intronic
936229120 2:110684262-110684284 CAGAGTCATTTTTAGATAGATGG - Intergenic
936442746 2:112569512-112569534 CTCTGTCATTTCTAGTTAGAAGG + Intronic
936706630 2:115082723-115082745 CTCATGCATCTGTAGTTAGCTGG - Intronic
937522349 2:122726981-122727003 TTTATTCATGTATAGATAGATGG + Intergenic
937730942 2:125228249-125228271 CTCCTCCATTTGTAGGAAGAGGG + Intergenic
939159680 2:138572723-138572745 CTCATTAATTTGTATAAAAAAGG - Exonic
939338458 2:140862054-140862076 GTTATTCAATTGTAGATTGAAGG - Intronic
939511287 2:143109240-143109262 CTCGTTCATTTGGACACAGAAGG - Intronic
939627757 2:144498896-144498918 TTCATTCATTTTTAGAGACAGGG - Intronic
939894360 2:147773930-147773952 TTGATTCTTTTGCAGATAGATGG + Intergenic
940074928 2:149731137-149731159 CTCATTCATTTTGAGGGAGAGGG + Intergenic
941923308 2:170872700-170872722 TTTATTCATTTGTAGAGACAGGG - Intergenic
941949810 2:171143069-171143091 GTCATTCATTTATTGAGAGACGG - Intronic
943456117 2:188109387-188109409 CTTATATATTTGTAGATATAAGG - Intergenic
943889303 2:193266023-193266045 TTCATTTATTTGTAGAGACAGGG + Intergenic
944372126 2:198996903-198996925 CTTATTCATTTGTACATATCAGG - Intergenic
944752805 2:202728564-202728586 CTCATTCATTCATAAATAAATGG + Intronic
945787353 2:214258528-214258550 CCCATTCATTTGTTGGTTGATGG + Intronic
1168801519 20:646357-646379 CTCATTTTTTTGTAGAGACAGGG - Intergenic
1169796992 20:9473828-9473850 CTCAGTGATTTGTAGAGTGATGG - Intronic
1170465056 20:16615013-16615035 CTTATTTATTTTTAGAGAGAGGG - Intergenic
1170777052 20:19384565-19384587 CCTATTCATCTGTAGGTAGATGG + Intronic
1172621855 20:36322626-36322648 CACAGTCATCTGTAGATGGAGGG + Intronic
1174469529 20:50746180-50746202 CTCATTCCTTTGCTCATAGAGGG - Intronic
1178289085 21:31351232-31351254 CTCATTCATCTGAAGTCAGAAGG + Intronic
1181896409 22:26111753-26111775 CTCATACAGTTGTTGGTAGAAGG - Intergenic
1182059197 22:27384918-27384940 CACATTTATTTGTAGAGACAGGG + Intergenic
949277163 3:2297624-2297646 CAAATTTATTTGTAGGTAGACGG - Intronic
949582125 3:5399018-5399040 TTCATTTATTTGTAGAGACAGGG + Intergenic
954189692 3:48948941-48948963 CCCATTCATTTGTAAGTTGAGGG + Intronic
957361236 3:79161789-79161811 CACACTCATTGTTAGATAGAAGG + Intronic
958465678 3:94454457-94454479 CTCTTTCATTTATGGCTAGATGG + Intergenic
958522567 3:95209878-95209900 CTCATTCTTTTTTATATTGATGG + Intergenic
959297874 3:104560358-104560380 CACATTCATATTTAGAAAGATGG + Intergenic
961679818 3:128591988-128592010 TTGGTTTATTTGTAGATAGATGG - Intergenic
964687868 3:159417564-159417586 CTCATGCATAGGTAAATAGACGG + Intronic
965358352 3:167706652-167706674 TTCAGTCATTGGTAGATGGATGG - Intronic
966566322 3:181385468-181385490 CTCATTATTTTGGAGATAAAAGG - Intergenic
970271078 4:14348308-14348330 CCCATTCCTTGGTAGACAGAGGG + Intergenic
971888026 4:32478217-32478239 CTCAAATATTTTTAGATAGATGG - Intergenic
971983722 4:33791781-33791803 TTCATTCATTTATATTTAGATGG + Intergenic
972954909 4:44377189-44377211 CTCAGTAATGTGTAGAGAGATGG + Intronic
973126682 4:46594498-46594520 CACATTCATTTGAAGTTAGGTGG - Intergenic
974196165 4:58578207-58578229 TTCATTCATTGGTAGCTTGATGG - Intergenic
975190477 4:71454869-71454891 CTCATTCACTTGCAGTCAGATGG + Intronic
975351486 4:73352008-73352030 CTAATTTTTTTGTAGATATAGGG + Intergenic
976193438 4:82510930-82510952 ATCATTCATTTGTAATTATAAGG + Intronic
977276033 4:94978334-94978356 CTCATGCATTTGCAGTCAGATGG + Intronic
977579678 4:98711435-98711457 CTCTTTCCTTTGGAAATAGAAGG - Intergenic
977591353 4:98831207-98831229 TTCATTCATTTTTAGATACAGGG + Intergenic
978868503 4:113545144-113545166 TTCATTCATTTCTAAATTGAAGG + Intronic
979327163 4:119393681-119393703 CTCAGTCATTTGCAGGTTGATGG - Intergenic
979427672 4:120587669-120587691 CTCACTTATTTCTAAATAGATGG + Intergenic
980082891 4:128363100-128363122 CTAAGTGGTTTGTAGATAGAAGG + Intergenic
980617350 4:135247428-135247450 CAGATTCATTTGTAAATACACGG + Intergenic
980847351 4:138339960-138339982 CTAATTCAGTTGCATATAGAGGG - Intergenic
980921141 4:139087285-139087307 TTCATTCATTTATAGAAACAGGG + Intronic
983245045 4:165278369-165278391 CTCAGTCATTTGCAGGTTGATGG - Intronic
983910183 4:173229980-173230002 TTCATTTATTTGTAGATACCAGG + Intronic
984088799 4:175344646-175344668 CTAATTTTTTTGTAGATACAAGG + Intergenic
986550913 5:8954189-8954211 GTCATTCTTTTGTAGTTAAATGG - Intergenic
986741413 5:10708987-10709009 ATCAATTATTTGTAGATTGAGGG - Intronic
988784104 5:34550065-34550087 CTCATTCTTTTGTAGAGATGGGG - Intergenic
991413252 5:66366093-66366115 CTCATTCATTTTTGCATAAAAGG - Intergenic
992294665 5:75316008-75316030 CTCATTCATTATTAGATTAATGG - Intergenic
992700048 5:79332932-79332954 CTCATTCATCTGTAAATTGAAGG + Intergenic
993687869 5:90962289-90962311 CACAATACTTTGTAGATAGAGGG + Intronic
994754911 5:103781846-103781868 CTAATTCACTTGTGGTTAGAAGG - Intergenic
995154443 5:108894026-108894048 GTGATTCATTTGGAGATGGAAGG - Intronic
996963504 5:129280146-129280168 CCAATTCATTTGTCCATAGAAGG - Intergenic
997494109 5:134306702-134306724 CTCATTCATTTTTAAATAATAGG - Exonic
998851591 5:146356057-146356079 CTGATTTATGTGTAGATAGCTGG + Intergenic
998886425 5:146699484-146699506 CTGATTCATTCGTAGAATGATGG - Intronic
1000358927 5:160429907-160429929 CTGATTCAGTTGTATTTAGAAGG - Intergenic
1001924257 5:175624849-175624871 CTTATTTTTTTGTAGAGAGAGGG - Intergenic
1006670031 6:35724482-35724504 CTCCTTCATTTGAAGGGAGAAGG + Intronic
1006762148 6:36472358-36472380 CCCATTTGTTTGTAGATAAAAGG - Intronic
1007332415 6:41123351-41123373 CTCATTCGTTTGTTTAAAGATGG + Intergenic
1008010822 6:46465911-46465933 CTGAGTCATTTGTAAATAGATGG + Intronic
1008568818 6:52795350-52795372 CTCCTTCATTTATTGATTGATGG + Intronic
1008584387 6:52935622-52935644 CTTTTTTATTTGTAGAGAGAGGG - Intergenic
1009415658 6:63413693-63413715 CTCAATTATTTGTAAAAAGAGGG - Intergenic
1010235274 6:73569963-73569985 CTCCTTCATCTTTAGATACAGGG + Intergenic
1010682504 6:78812881-78812903 CTCATTCATTTGTTAGTAAAGGG - Intergenic
1011626642 6:89288487-89288509 CTCATGCAGTTGTAGTCAGATGG - Intronic
1014037376 6:116782686-116782708 TTAATTCATTTGTAGAGATAAGG + Intergenic
1016630302 6:146221820-146221842 CTCACTCATTTGTATACAAATGG - Intronic
1016879085 6:148893261-148893283 CTCATTCATTTGGAGATTGCTGG - Intronic
1019663561 7:2239787-2239809 CTCATTCATTTCTAGAGATGGGG + Intronic
1020462616 7:8442138-8442160 CTCATTAATTTATAGGAAGAAGG - Intronic
1020959925 7:14789116-14789138 CAGATTCACTTGTAGATATAAGG + Intronic
1022572080 7:31464678-31464700 CACATGCATTTGGAGATAAAAGG + Intergenic
1023548266 7:41341949-41341971 CTCATTTTTTTGTAGAGACAGGG + Intergenic
1024781295 7:52853374-52853396 TTAAATCATTTGAAGATAGAAGG - Intergenic
1025743077 7:64216776-64216798 CTCAATTATTTGTAGAGACAGGG + Intronic
1025886819 7:65602705-65602727 TTCCTTCATTTGTAAAAAGAAGG - Intergenic
1027485308 7:78754203-78754225 CTAATTTTTTTGTAGATAGCAGG - Intronic
1028701101 7:93781134-93781156 CCCATGAATTTGTAGATACATGG + Intronic
1029531432 7:101127836-101127858 TTCATTCATTTTTAGAGACAGGG - Intronic
1031073689 7:117191334-117191356 ATCATTCATTTATAGAGACACGG - Intronic
1031152836 7:118074331-118074353 CACATCCATTTGAATATAGATGG - Intergenic
1031855602 7:126919237-126919259 TTCCTTCATTTGTAAAAAGAAGG + Intronic
1033837400 7:145331925-145331947 CTCATCCATTTCTAAATAAATGG - Intergenic
1033839658 7:145358811-145358833 CTCTTTCATTTATACATACATGG + Intergenic
1034313072 7:150107045-150107067 CTCATGCATGTGTAGATAACAGG - Intergenic
1034793792 7:153993619-153993641 CTCATGCATGTGTAGATAACAGG + Intronic
1036001433 8:4609225-4609247 TTCATTTTTTTGTAGATACAGGG - Intronic
1037733053 8:21545271-21545293 CTCATGCATTTGTAAAGAAATGG + Intergenic
1037870749 8:22493779-22493801 CTTTTTCTTTTGTAAATAGAAGG + Intronic
1038622758 8:29159622-29159644 CTAATTCCTTTGTAAATGGAGGG - Intronic
1038806997 8:30803368-30803390 CTCATTTTTTTGTAGAGACAGGG - Intronic
1039874689 8:41575780-41575802 CACATTCATTTCTAGGTACAAGG - Intergenic
1041544663 8:59029182-59029204 TTTATTCATTTTTAGTTAGATGG + Intronic
1042791307 8:72609095-72609117 CTCTTTCATTTGTAAAGATAAGG + Intronic
1043041368 8:75266196-75266218 TTTATTCTTTTGTAGAGAGAGGG + Intergenic
1043131247 8:76464416-76464438 ATCATTCATTTTTATATAAATGG - Intergenic
1043465262 8:80499849-80499871 TTCACTCATTTGAAGATAGCTGG - Exonic
1043953233 8:86332881-86332903 CTCATTTTTTTGTAGAGACAGGG - Intergenic
1047462961 8:125086307-125086329 CTCATTTCTTTGTATAGAGATGG + Intronic
1049005177 8:139850663-139850685 CATATGCATTTGTAGATGGATGG - Intronic
1050371606 9:4927409-4927431 CTCATTAATTTGTAAATGAAGGG - Intergenic
1052471583 9:28903480-28903502 TTCATTCATTTATAGAGACAGGG + Intergenic
1052606217 9:30705480-30705502 CTGTTTCTTTTGTAGATAAATGG - Intergenic
1052732286 9:32302857-32302879 TTCAATCATTTGTTGAGAGAAGG - Intergenic
1054337908 9:63824544-63824566 TTCAGTCATCTGTAGATTGAAGG - Intergenic
1055268506 9:74527888-74527910 TTCATGCACTTGAAGATAGATGG + Intronic
1055705050 9:78989979-78990001 ATCATTCATCTCTAGAGAGATGG + Intergenic
1057603102 9:96476342-96476364 CTCATCCATTTCTAAATAAAGGG + Intronic
1059135366 9:111801611-111801633 CTCCTTCATTTTTAAATACAAGG - Intergenic
1059351015 9:113664956-113664978 CTCACTCCTTTGTATATATAGGG + Intergenic
1062669606 9:137699840-137699862 TTCATTCATTTTTAGAAACAGGG - Intronic
1202784620 9_KI270718v1_random:36728-36750 TTCAGTCATCTGTAGATTGAAGG + Intergenic
1185498554 X:578985-579007 CACATGCATATGTACATAGATGG + Intergenic
1187413529 X:19072027-19072049 CTCTTTCATCTGTAGAACGAGGG - Intronic
1188489278 X:30720657-30720679 CTCAGTCATTTGCAGGTAGATGG + Exonic
1189355359 X:40306357-40306379 CTGATTTATTTGTACAGAGAAGG - Intergenic
1189623612 X:42870936-42870958 GTCCTTCATTTGTAGAATGAGGG - Intergenic
1191768237 X:64725462-64725484 CTCATTCATTTGTCTATACCAGG - Intergenic
1192114705 X:68399071-68399093 CTCACTGGTTTGTAAATAGATGG - Intronic
1193248651 X:79261908-79261930 CTGCTTCATGTGTAGATAGTTGG - Intergenic
1194518858 X:94893659-94893681 CTCATTCATTGGTGGCTGGAAGG - Intergenic
1195123277 X:101779264-101779286 CTCAGTCATTTGCAGGTAGATGG - Intergenic
1195938632 X:110148262-110148284 CTCAGTCATTTGTGGGGAGAGGG - Intronic
1197218103 X:123885859-123885881 GTCATGCAGCTGTAGATAGATGG + Exonic
1198123403 X:133618329-133618351 TTCATTCATTTGTATCCAGACGG - Intronic
1199255535 X:145714961-145714983 CTTATTCATTTCTATATACACGG + Intergenic
1199573659 X:149292312-149292334 TTAATTCATTTATAGATTGATGG - Intergenic
1201536505 Y:15054209-15054231 TTCATTCATTTGGAAAAAGAAGG - Intergenic