ID: 1157346309

View in Genome Browser
Species Human (GRCh38)
Location 18:46838328-46838350
Sequence CCATCCCCATGTTATAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1049
Summary {0: 1, 1: 0, 2: 9, 3: 84, 4: 955}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157346309 Original CRISPR CCATCCCCATGTTATAAATA AGG Intronic
901370061 1:8789521-8789543 CCATCCCCACATTACAAATTTGG + Intronic
901939326 1:12649982-12650004 CCAGCTCCATTTTATAAATCAGG - Intronic
902094613 1:13932619-13932641 TCATCCCCATTTTATAGATGAGG + Intergenic
902221820 1:14971072-14971094 TCATCCCCATTTTATAGATGGGG - Intronic
902304790 1:15527494-15527516 TCATTCCCATTTTATGAATAAGG + Intronic
902467165 1:16625571-16625593 CTAGCCCCATGTTATAAATGGGG + Intergenic
902576530 1:17381429-17381451 TCATCCCCATTTTACAAATAGGG - Intronic
902741255 1:18440017-18440039 TCATCCCCATTTTATAGATGAGG + Intergenic
902792808 1:18780656-18780678 GCATCCCCATTCAATAAATAAGG + Intergenic
902793743 1:18786812-18786834 ACATCCCCACTTTATAAATGAGG + Intergenic
902979234 1:20111094-20111116 CGATCCCCATTTTATAATTGAGG - Intergenic
903187364 1:21636297-21636319 CTATCCCCATTTTATAGATGAGG - Intronic
903189015 1:21646054-21646076 CCATCCCCATTTTACAGATGAGG - Intronic
903475934 1:23619227-23619249 TCATTCCCATGTTACAGATAAGG + Intronic
903690579 1:25170563-25170585 GCATCCCCATTTTACAGATAAGG + Intergenic
903873706 1:26457138-26457160 CTATCCTCATTTTATAGATAAGG - Intronic
903919444 1:26788708-26788730 CCATCGCCATTTTATGGATATGG - Exonic
903988844 1:27250513-27250535 GCATCCCCATTTTACAAATGAGG + Intronic
904040602 1:27582304-27582326 CCATCCCAATTTTATAGATAAGG - Intronic
904056092 1:27671254-27671276 TCAACCACATGTTATAGATAAGG + Intronic
904131460 1:28278756-28278778 TCAACCCCATGTTATAGATGAGG - Intronic
904141784 1:28359247-28359269 TCATCCCCATTTTATAGATGAGG + Intergenic
904318933 1:29684035-29684057 CCATCCCCATTTTATAGATGGGG - Intergenic
904547619 1:31288390-31288412 GCATCCTCATTTTATAAATAAGG - Intronic
904899788 1:33847802-33847824 TGATCCCCATGTTTTAGATAAGG - Intronic
905137646 1:35811956-35811978 ACATGCCCATTTTATAAATGAGG + Intronic
905208508 1:36357188-36357210 CTATCCCCATTTTATAGATGGGG + Intronic
905320722 1:37114982-37115004 CCATTCCCATTTTATAGCTATGG - Intergenic
905582059 1:39089826-39089848 CCATCTCCCTTTTATAGATAAGG - Intronic
905798439 1:40828616-40828638 CCATCCCTATTTTATATACACGG - Intronic
906321134 1:44817296-44817318 TTATCTCCATTTTATAAATAAGG - Intergenic
906505676 1:46377804-46377826 ACATCCCCATTTTATAGATGAGG + Intergenic
906771131 1:48485364-48485386 CTATCCCCATTTAACAAATAAGG + Intergenic
906916740 1:50020399-50020421 TCATCCCCATTTTACAAATGAGG + Intronic
906939031 1:50239338-50239360 CAGCCCCCATTTTATAAATAAGG - Intergenic
907159386 1:52359659-52359681 CCACCCTCATTTTATAGATAGGG - Intronic
907385591 1:54123336-54123358 CTATCTCCATTTTATAAATGGGG - Intergenic
907426933 1:54385767-54385789 CAATCCCCATTTTACAGATAAGG + Intronic
907454197 1:54564776-54564798 ACATCCCTATGTTATGAATGAGG - Intronic
907612391 1:55885578-55885600 ACATCTTCATGTTATAGATAAGG - Intergenic
907684511 1:56596968-56596990 CCAACGCCATGTATTAAATAGGG + Intronic
907694598 1:56710222-56710244 CCATTTCCATGATATAACTAAGG - Exonic
907748042 1:57234397-57234419 CCATACTCACTTTATAAATATGG - Intronic
907790779 1:57661363-57661385 TCATCCCCATTTTATAGTTAAGG - Intronic
907920313 1:58905298-58905320 CAATCTCCATGTTGTAGATAAGG - Intergenic
908048035 1:60193559-60193581 TTATGCCCATGTTATAAATAAGG - Intergenic
908102015 1:60800851-60800873 GCATCCCCATTTTACAGATAAGG - Intergenic
908204943 1:61837118-61837140 CTATCTCCATTTTATAAATTTGG - Intronic
908226983 1:62066250-62066272 CTATTCCCATTTTATAGATAAGG + Intronic
908570795 1:65408019-65408041 CCATCCCCATTTTATGGATGAGG + Intronic
908703673 1:66928114-66928136 CCTTCCCCTTTTTATAAATGTGG - Intronic
908752081 1:67433640-67433662 CTATCCCCCTTTTATAGATAGGG + Intergenic
908914042 1:69105507-69105529 ATATTCCCATTTTATAAATAAGG + Intergenic
908974713 1:69883848-69883870 CCAGCACCATGTATTAAATAGGG + Intronic
908983031 1:69981902-69981924 CCATCCCCATTTTATAGATGAGG + Intronic
909181212 1:72426241-72426263 CCAACACCATGTATTAAATAGGG + Intergenic
909283662 1:73788704-73788726 CAATCCCCATGTGATAGATGGGG - Intergenic
910197770 1:84661845-84661867 ATATCCCCATTTTATAGATAAGG - Intronic
910340485 1:86181537-86181559 CCAGCACCATTTTTTAAATAGGG + Intergenic
910439331 1:87236598-87236620 TTATCCCCATTTTATAGATAAGG - Intergenic
910455716 1:87395443-87395465 TCAACCCCAAGTTATAATTAAGG + Intergenic
910803666 1:91169891-91169913 TCATCCCCATTTTACAAACAAGG + Intergenic
910810394 1:91229878-91229900 CCATCACCATTTATTAAATAGGG - Intergenic
910918655 1:92319376-92319398 TTATCCCCATGTTATAGATAAGG - Intronic
911402931 1:97399180-97399202 CCAGCACCATGTATTAAATAGGG + Intronic
911435521 1:97852367-97852389 TCATCCTCATTTTATAAATGAGG + Intronic
911494420 1:98613953-98613975 CCAGCACCATGTATTAAATAGGG - Intergenic
911498265 1:98656783-98656805 CCATCCCCATTTTACAGATGAGG - Intergenic
911531142 1:99044546-99044568 CCATCACCATTTATTAAATAGGG - Intergenic
911718357 1:101161640-101161662 CCAACACCATGTATTAAATAGGG - Intergenic
911837756 1:102643207-102643229 CCAGCACCATGTATTAAATAGGG - Intergenic
911966233 1:104375436-104375458 CCAGCCCCATTTATTAAATAGGG - Intergenic
912284976 1:108359546-108359568 CCAGCACCATTTTTTAAATAGGG + Intergenic
912636624 1:111300489-111300511 CCAGCACCATTTTTTAAATAGGG - Intronic
912652886 1:111455816-111455838 CTGTCCCCATTTTACAAATAAGG + Intronic
913355566 1:117917560-117917582 CCATCCCCATTTTAGAGATGAGG + Intronic
914436198 1:147661800-147661822 ATATCTCCATGTTATCAATAAGG - Intronic
915614989 1:157030765-157030787 TCATTCCCATTTTATAGATAGGG - Intronic
915995315 1:160556370-160556392 TTACCCTCATGTTATAAATAAGG - Intronic
918598064 1:186316755-186316777 TCATCCACATTTTATAGATATGG - Intronic
919177565 1:194037422-194037444 CCAGCACCATGTATTAAATAGGG + Intergenic
919334979 1:196220606-196220628 CCATCACCATTTATTAAATAGGG + Intergenic
919458752 1:197851244-197851266 TTATCCCCATATTATAAAGAAGG - Intergenic
919762211 1:201105397-201105419 TCATCCCCATTTTATAAAGGAGG + Intronic
920285370 1:204874977-204874999 CAATCCCCATTTTATAGATGGGG + Intronic
920511401 1:206555022-206555044 CTATGCCCATTTTATAGATAAGG - Intronic
920764647 1:208820252-208820274 TCATCCACATTTTATAAATAAGG + Intergenic
920866486 1:209757886-209757908 CTAGCCCCATTTTATAAATGAGG + Intronic
920954964 1:210610747-210610769 CCAGCACCATTTTTTAAATAGGG + Intronic
920994451 1:210975507-210975529 CCATCACCATTTATTAAATAGGG - Intronic
921125931 1:212178126-212178148 CCGTCCCCATTTTATAACTAAGG + Intergenic
921353404 1:214261281-214261303 GCATCTCTATCTTATAAATAGGG - Intergenic
921501760 1:215913053-215913075 CAATCTCCAAGCTATAAATATGG + Intronic
921567472 1:216737362-216737384 TCATCACCATGTTAAAAATGAGG - Intronic
922081047 1:222297188-222297210 CCAGCCCCATTTATTAAATAGGG - Intergenic
922098147 1:222460175-222460197 TCATTCCCATTTTATAAATGAGG + Intergenic
922209088 1:223473886-223473908 ACATCCTCATTTTACAAATATGG + Intergenic
923181856 1:231527909-231527931 CTATCCCTATGTTACAGATAAGG + Intergenic
923875956 1:238047382-238047404 CCAACACCATGTATTAAATAGGG + Intergenic
924290281 1:242529456-242529478 CCATCCCTATGTTACAGATGAGG + Intergenic
1064066062 10:12182534-12182556 ACATGACCATGCTATAAATATGG + Intronic
1065391646 10:25188540-25188562 CCAGCACCATTTAATAAATAGGG - Intronic
1065457295 10:25920457-25920479 TTATCCCCATGTTAGACATAAGG - Intergenic
1065654110 10:27928898-27928920 CTATCCCCATTTTATGTATATGG + Intronic
1066757222 10:38723090-38723112 CCGCACCCATTTTATAAATATGG - Intergenic
1068116152 10:52739786-52739808 ACATCCCCATGTCATGAATAAGG + Intergenic
1068116935 10:52746225-52746247 AGATCCCCATGTCATCAATAAGG - Intergenic
1068201917 10:53793580-53793602 CCAGCCCCATTTATTAAATAGGG + Intergenic
1068270492 10:54717017-54717039 CCAGCACCATTTTTTAAATAGGG - Intronic
1068295768 10:55070512-55070534 CCAGCACCATTTTTTAAATAGGG + Intronic
1068473028 10:57489508-57489530 CCAGCACCATGTATTAAATAGGG - Intergenic
1068658721 10:59601585-59601607 CCATCCCCATGATCTGAATGTGG + Intergenic
1068878549 10:62024027-62024049 TCATCCCCATTTTAAAACTAGGG - Intronic
1069523236 10:69142984-69143006 TCTACCCCATTTTATAAATAAGG - Intronic
1070055647 10:72932197-72932219 TCATCCCCATTTTACAGATAAGG - Intronic
1070166721 10:73904449-73904471 GTATCCCCATCATATAAATATGG + Intergenic
1070550753 10:77488878-77488900 CCATTCTCCTGTTATAAAAAGGG + Intronic
1070766432 10:79059235-79059257 CCATCCCCACTTTACAGATAAGG + Intergenic
1070891175 10:79943039-79943061 ACATCCCCATTTTATAGATGAGG + Intronic
1071494660 10:86159806-86159828 TCATCCCCATTTTATAGATGAGG - Intronic
1071574120 10:86713613-86713635 TCATCCCTCTGTTATATATAAGG - Intronic
1072041642 10:91612035-91612057 TCATCACCATTTTACAAATAAGG - Intergenic
1072092691 10:92144702-92144724 GCATCTCCATTTTATAGATAAGG - Intronic
1072170069 10:92849820-92849842 CCCTCCCCATTCTACAAATAAGG - Intronic
1072206687 10:93211084-93211106 TCATACCCATCTTACAAATAAGG - Intergenic
1072464237 10:95648427-95648449 TTATCCCCATTTTATAAATAAGG + Intronic
1073058446 10:100717403-100717425 CTATCCCCATCTTGCAAATAGGG - Intergenic
1073118038 10:101103442-101103464 CCATCCCCATGTCACAGATGAGG - Intronic
1073176891 10:101562161-101562183 TCATCCCCCTCTTATAAATGAGG - Intergenic
1073426851 10:103460146-103460168 CCATCCCCATTTTACAGAGATGG + Intergenic
1073513518 10:104057419-104057441 TTAACCCCATGTTATAAAAACGG - Intronic
1073927821 10:108537493-108537515 CCAGCACCATGTATTAAATAGGG - Intergenic
1074276205 10:112004931-112004953 AGATTCCCATGTCATAAATAAGG + Intergenic
1074596944 10:114876453-114876475 CCATCCCCATTTTACAGATAAGG - Intronic
1074833779 10:117269586-117269608 GCATCCCCATTTTATAGATGAGG - Intronic
1075150784 10:119928979-119929001 TAATCCCCATTTTATAAATCAGG + Intronic
1075157003 10:119986339-119986361 CCATCACCATTTATTAAATAGGG + Intergenic
1075174935 10:120150809-120150831 CCATCACCATTTATTAAATAGGG + Intergenic
1075870337 10:125768234-125768256 CCACGCCCATCTTACAAATAAGG + Intronic
1076448488 10:130537052-130537074 CCAACACCATTTTTTAAATAGGG - Intergenic
1077595575 11:3528731-3528753 CCATCCCTCTGTGATAAATTAGG + Intergenic
1078720881 11:13882011-13882033 ACATTCCCATTTTATAAATAAGG - Intergenic
1078727599 11:13945572-13945594 CCATCCCCATTTCATAGATGAGG - Intergenic
1078794318 11:14576513-14576535 CCAGCACCATGTATTAAATAGGG + Intronic
1079016730 11:16875289-16875311 TTATCCCCATGTTAAACATAAGG + Intronic
1079132065 11:17752742-17752764 CCACCCCAATTTTATAAAGAAGG - Intronic
1079157703 11:17963841-17963863 CCATCCCCATGTTACTGACAGGG + Intronic
1079243159 11:18735005-18735027 CCATCCCCAGATTACAGATAAGG - Intronic
1079327596 11:19507574-19507596 TGATCCCCATTTTCTAAATAAGG - Intronic
1079341502 11:19615348-19615370 TTATCCCCATTTTACAAATAAGG - Intronic
1079400302 11:20101613-20101635 CCATCCCCATTTTACAGAGAAGG + Intronic
1079576588 11:22011108-22011130 CCATTCTCATTTTATAAATGAGG - Intergenic
1079914036 11:26346100-26346122 AAATCCCTATTTTATAAATAAGG + Intronic
1080605784 11:33863945-33863967 TCATCCCCATTTTACAGATAAGG + Intronic
1080862429 11:36161306-36161328 CTATCCCCATTTTCTAAATGAGG + Intronic
1080866989 11:36204228-36204250 GTATCCCCTTGTCATAAATATGG + Intronic
1080946133 11:36977516-36977538 TTATCCCCATTTTATAGATAAGG - Intergenic
1081204501 11:40259645-40259667 CCATCACCATTTATTAAATAGGG + Intronic
1081226829 11:40534120-40534142 TAATCCTCATGTAATAAATAAGG - Intronic
1081304436 11:41494310-41494332 ACATCCCCATGTTATAGGTGAGG - Intergenic
1081403464 11:42668999-42669021 CCAGCACCATGTTGTACATACGG + Intergenic
1081496858 11:43620283-43620305 TCATCCCCATTTTATAGATGAGG + Intronic
1081797745 11:45833227-45833249 CTATCTCCATTTTATAGATAAGG + Intergenic
1081798825 11:45842991-45843013 TCATCCCCATTTTACAAATGAGG + Intergenic
1082248056 11:49948001-49948023 CCAGCACCATTTAATAAATAGGG - Intergenic
1082556692 11:54571180-54571202 CCATCACCATTTATTAAATAGGG + Intergenic
1082579263 11:54846342-54846364 CCATCACCATTTATTAAATAGGG + Intergenic
1082986837 11:59176339-59176361 TTATCCCCATTTTATAAGTAAGG + Intronic
1083248326 11:61447715-61447737 TCATCCCCATTTTATAGATGAGG - Intronic
1083368792 11:62161679-62161701 CCAACACCATGTATTAAATAGGG - Intergenic
1083749778 11:64754598-64754620 CCTGCCCCATGTAATAGATAAGG - Intronic
1084251467 11:67902714-67902736 CCATCCCTCTGTGATAAATTAGG + Intergenic
1084458604 11:69283848-69283870 CCATCCCGATGTTATAGACTAGG - Intergenic
1085380252 11:76110350-76110372 ACATCCCCATTTTACAAGTAAGG + Intronic
1085426989 11:76413493-76413515 CCATCCCCATCTTATAGATGAGG - Intronic
1085583292 11:77675394-77675416 TTTTCCCCATTTTATAAATAGGG - Intronic
1085682062 11:78585935-78585957 TCATCCTCATTTTATAGATAAGG + Intergenic
1085708844 11:78811134-78811156 CCATTCCCATTTTATAGACAAGG + Intronic
1085742019 11:79085506-79085528 CTATCCCCATTTTACAGATAAGG - Intronic
1086175731 11:83888863-83888885 CCAGCACCATGTATTAAATACGG - Intronic
1086594128 11:88550972-88550994 GTATCCCCATTTTATAAGTAAGG - Intronic
1086594138 11:88551101-88551123 CTATTCCCATTTTATAAATAAGG - Intronic
1086789414 11:91016904-91016926 CCAACACCATGTATTAAATAGGG + Intergenic
1086867928 11:92002533-92002555 TTATCCCCATGTTATAAATAAGG + Intergenic
1086913286 11:92497507-92497529 TCATCTCCATCTTATAAAGAGGG + Intronic
1086934742 11:92732665-92732687 CTATTCCCATGTAACAAATATGG - Intronic
1086935025 11:92735927-92735949 CTATTCCCATGTAACAAATATGG + Intronic
1086978804 11:93170496-93170518 CTATTCCCATTTTACAAATAAGG + Intronic
1087451151 11:98326133-98326155 CCAGCCCCATTTATTAAATAGGG + Intergenic
1087521906 11:99248698-99248720 CCAGCACCATGTATTAAATAGGG + Intronic
1087692547 11:101338432-101338454 TTATCCCCATTTTATAGATATGG + Intergenic
1087836572 11:102880953-102880975 ACATTTCCATGTTATAATTATGG + Intergenic
1088180883 11:107108745-107108767 CCAGCCCCATTTGTTAAATAGGG - Intergenic
1088232318 11:107685827-107685849 TCATCCCCATTTTATGTATAAGG + Intergenic
1088370073 11:109079313-109079335 CCAGCACCATGTGTTAAATAGGG + Intergenic
1088753236 11:112863741-112863763 TTATCCCCATTTTATAGATAAGG + Intergenic
1089184099 11:116603201-116603223 CCACCCCAATTTTATATATAAGG - Intergenic
1089256859 11:117198783-117198805 ACATCCCCATTTTATAGATGAGG - Intergenic
1089534230 11:119150677-119150699 TCATCTCCATGTTACTAATAAGG + Intronic
1089634269 11:119802291-119802313 TTATCCCCATTTTATAAATAGGG - Intergenic
1090156596 11:124444626-124444648 TCATCCCCATTTTATAGATGAGG - Intergenic
1090255598 11:125281516-125281538 TTATCCCCATTTGATAAATAAGG - Intronic
1090933149 11:131317422-131317444 CCAGCACCATGTATTAAATAGGG - Intergenic
1090938626 11:131367931-131367953 TCATCCCCATTTTATAAATGAGG - Intergenic
1091003833 11:131933947-131933969 CCATCCCAATTTTAAAAATGAGG + Intronic
1091157711 11:133388955-133388977 CCATCCCCATGTTGCAGATGAGG + Intronic
1091409836 12:232032-232054 GCATCCCCATTTTATAGATTAGG - Intronic
1091580443 12:1784515-1784537 TCATCCTCATTTCATAAATAAGG - Intronic
1091645831 12:2271538-2271560 TCATCCCCATTTTATAGATTAGG - Intronic
1091665247 12:2414146-2414168 TCATCCCCATCTTACAGATAAGG - Intronic
1091965112 12:4734186-4734208 CCCTCACCGTCTTATAAATAAGG + Intronic
1092039777 12:5374026-5374048 CCATCCCCATCTTACAGATGAGG + Intergenic
1092048633 12:5451987-5452009 CCAGCTCCCTTTTATAAATAAGG + Intronic
1092295378 12:7193119-7193141 CCACCCCCATTTTATAGATGAGG + Intronic
1092411610 12:8257451-8257473 CCATCCCCAAGTTACAGATGAGG - Intergenic
1092421736 12:8337504-8337526 CCATCCCTCTGTGATAAATTAGG + Intergenic
1093237116 12:16624320-16624342 TCATCTCCAAGTTATAAATGGGG + Intergenic
1093278249 12:17155792-17155814 CCATCACCATTTGTTAAATAGGG - Intergenic
1093408328 12:18833799-18833821 CCATCACCATTTATTAAATAGGG - Intergenic
1093655781 12:21692924-21692946 CCAGCCCCATTTATTAAATAAGG - Intronic
1093788649 12:23221130-23221152 CCCTTCCCATCTTATAAATAAGG + Intergenic
1093886584 12:24468313-24468335 ACATCCCCATTTTACAGATAAGG - Intergenic
1094032902 12:26033888-26033910 TCATCCCCATTTTACAAATGAGG - Intronic
1094038868 12:26102045-26102067 CCATCCCCATTCTATAGATAAGG + Intergenic
1094135528 12:27121305-27121327 TCATCTCCATTTTATAAATGGGG - Intergenic
1094179828 12:27580425-27580447 CCATCCCCATTTTACAGATGTGG - Intronic
1094185018 12:27632701-27632723 TCATCTCCATTTTATAAATGAGG - Intronic
1094191618 12:27703988-27704010 TCATTCCCATTTTACAAATAAGG - Intergenic
1094788656 12:33882640-33882662 CCAGCACCATTTAATAAATAGGG - Intergenic
1095481359 12:42639278-42639300 CCCTCCTCATTTTACAAATAGGG + Intergenic
1095803026 12:46288402-46288424 CCAGCACCATGTATTAAATAGGG - Intergenic
1095858682 12:46890464-46890486 CCAGCACCATGTATTAAATAGGG - Intergenic
1095956434 12:47809002-47809024 TTATCCCCATGTTACAGATAGGG - Intronic
1096070079 12:48770243-48770265 TTATCCCCATTTTATAGATAAGG + Intronic
1096607956 12:52780242-52780264 CAATCCCCATCTGCTAAATAAGG - Intergenic
1096622520 12:52873487-52873509 CTATCCCCATTTTACAGATAGGG + Intergenic
1096815411 12:54198821-54198843 CCATCCCCGTTTTATAGATGAGG + Intergenic
1097444617 12:59654139-59654161 CTAACCCTATGTTATAACTATGG - Intronic
1097444652 12:59654911-59654933 CTAGCCCCATGTTATAATTATGG - Intronic
1097581149 12:61458525-61458547 CCAGCACCATGTATTAAATAGGG + Intergenic
1097614544 12:61868232-61868254 CCATCCCCATTTTGTAGATGAGG + Intronic
1097933622 12:65219547-65219569 CCATCCCCTTGTTAAAATTGTGG + Intronic
1098480516 12:70953521-70953543 TCATCCCCATTTTACAAATGAGG + Intergenic
1098524608 12:71472330-71472352 TTATCCCCATTTTATAAACAAGG + Intronic
1098611312 12:72461989-72462011 ATATCCCCATGTTATCAATAAGG + Intronic
1098643461 12:72867558-72867580 TCATCCCCATTTTACAGATAAGG - Intergenic
1099041438 12:77658866-77658888 CCAGCCCCATTTATTAAATAGGG - Intergenic
1099083312 12:78214081-78214103 CTATGCCCATTTTATAAATGAGG - Intergenic
1099510984 12:83537065-83537087 CAATACCCATGTTGTAAGTAAGG - Intergenic
1099855328 12:88157400-88157422 CCATACCCCTTTTGTAAATATGG + Intronic
1099931825 12:89083998-89084020 CTATCCTCATTTTATAGATAAGG + Intergenic
1100061225 12:90578213-90578235 CCAGCACCATTTAATAAATAGGG - Intergenic
1100066260 12:90649309-90649331 CCAGCACCATTTTCTAAATAGGG + Intergenic
1100127811 12:91451847-91451869 TCATCCTCATTTTATAAATGAGG - Intergenic
1100154549 12:91782464-91782486 CCAGCACCATGTATTAAATAGGG - Intergenic
1100156816 12:91809378-91809400 CCAGCACCATGTATTAAATAGGG - Intergenic
1100271784 12:93032399-93032421 CCATGCCCATTTTATAGACAAGG + Intergenic
1100377082 12:94027406-94027428 ATATCCCTATGTTATAGATAAGG + Intergenic
1100728218 12:97433036-97433058 TCATCCCCATTTTATAAATGTGG - Intergenic
1100964160 12:99994496-99994518 CCATCACCATTTATTAAATAGGG - Intergenic
1101062348 12:100985453-100985475 TCATGCCCATTTTATAGATAAGG + Intronic
1101330765 12:103755922-103755944 CCATCTCCATTTTATAGATGAGG - Intronic
1101337350 12:103808200-103808222 CCATCCCCATTTTATTCAGAGGG + Intronic
1101358610 12:104005139-104005161 CCATCACCATTTATTAAATAGGG - Intronic
1101362254 12:104039052-104039074 CCATCACCATTTAATAAATAGGG - Intronic
1101385132 12:104250569-104250591 TCATCCCCATTTTACAAACAAGG - Intronic
1101558869 12:105836797-105836819 TCATCCTCATTTTATAGATAAGG + Intergenic
1101646252 12:106633373-106633395 ATATCCCCATTTTATAAATAAGG - Intronic
1101663764 12:106790082-106790104 CCATTCCTATCTTATGAATAAGG + Intronic
1102237359 12:111302430-111302452 TAATCCCCATTTTATTAATAGGG + Intronic
1102536452 12:113585071-113585093 TCACCCCCATTTTATAAATAGGG - Intergenic
1102548916 12:113676715-113676737 TCATCCCCATTTTACAGATAAGG - Intergenic
1103521657 12:121540099-121540121 CTATCCCCATTTTATAGACAAGG - Intronic
1103710084 12:122906025-122906047 TAATCCCCATTTTATAGATAAGG - Intergenic
1104098946 12:125588228-125588250 CCATCCCCATTTTATAGATAAGG - Intronic
1104136095 12:125940341-125940363 CCATCCCTGTTTTATACATAAGG - Intergenic
1104798763 12:131538687-131538709 TCATTCCCATTTTATAAATGAGG - Intergenic
1105770620 13:23608435-23608457 CCATCCCCATCTTATGGACAGGG + Intronic
1106074425 13:26445450-26445472 CCATCTCCATTTTATAAATGAGG - Intergenic
1106186127 13:27411593-27411615 TCATCCCCGTGTTACAGATAAGG - Intergenic
1106247002 13:27959124-27959146 GGATCCCCATGTTACAAATAAGG + Intergenic
1106292803 13:28380903-28380925 TTATCCCAATTTTATAAATAGGG + Intronic
1106404945 13:29465293-29465315 CAATCCTCATTTTATAGATAAGG + Intronic
1106829035 13:33558265-33558287 TCATCCCCAATTTATAGATAAGG - Intergenic
1107199695 13:37699131-37699153 CTATCCCCATTTTACAAATTGGG - Intronic
1107233418 13:38138677-38138699 CCATCACCATTTATTAAATAGGG + Intergenic
1107233958 13:38145993-38146015 CCATCACCATTTATTAAATAGGG + Intergenic
1107311039 13:39078310-39078332 CCAGCACCATTTAATAAATAGGG - Intergenic
1107746458 13:43515572-43515594 CAATACTCATGTTATAGATAAGG + Intronic
1108089036 13:46826512-46826534 TCATCTCCATGTTCTATATAAGG - Intergenic
1108627650 13:52247051-52247073 CCAGCACCATTTTTTAAATAGGG + Intergenic
1108658414 13:52559402-52559424 CCAGCACCATTTTTTAAATAGGG - Intergenic
1109329133 13:60905827-60905849 CCATCACCATTTATTAAATAGGG - Intergenic
1109358992 13:61271333-61271355 CCATCACCATTTATTAAATAGGG - Intergenic
1109496769 13:63181703-63181725 CCAGCACCATTTTTTAAATAGGG - Intergenic
1110434605 13:75465098-75465120 CCATCCCCATATTATAAATGAGG + Intronic
1110876953 13:80521739-80521761 CCAGCACCATATTTTAAATAGGG - Intergenic
1110928797 13:81189067-81189089 TCGTCCCTATTTTATAAATAAGG + Intergenic
1111049223 13:82857280-82857302 CCAGCACCATTTTTTAAATAGGG + Intergenic
1111299018 13:86322246-86322268 CCAGCACCATGTATTAAATAGGG + Intergenic
1111667323 13:91285661-91285683 CGATACTCATGTTATATATAGGG - Intergenic
1112134915 13:96566756-96566778 CCTTCCCCATCTTCTCAATATGG - Intronic
1112768257 13:102769778-102769800 TTATCCCCATTTTATAGATAAGG + Intronic
1113053292 13:106238184-106238206 TTATCCCCATGTTATAGATGAGG - Intergenic
1113677321 13:112215595-112215617 CCATCCCCGTTTTGTGAATAGGG + Intergenic
1114028850 14:18557446-18557468 CCATCCCTTTGTTTTCAATAAGG - Intergenic
1114068865 14:19092522-19092544 CCTTCCCTATTTTAGAAATAAGG + Intergenic
1114093396 14:19307483-19307505 CCTTCCCTATTTTAGAAATAAGG - Intergenic
1114777886 14:25505772-25505794 CTATACTCATTTTATAAATAAGG + Intergenic
1115038697 14:28893168-28893190 TCATCCCCATCTTGTAAATAAGG + Intergenic
1115323662 14:32113383-32113405 CCCTCCCCTTGTTATATGTATGG + Intronic
1115402585 14:32979051-32979073 TTATCCCCATTTTATAGATAAGG - Intronic
1115677273 14:35691601-35691623 CTATCTCCATTTTATAAATGAGG - Intronic
1116165145 14:41325611-41325633 CCATCACCATTTATTAAATAGGG + Intergenic
1116177854 14:41496014-41496036 CCAGCACCATGTATTAAATAGGG - Intergenic
1116527275 14:45920352-45920374 CAAACCCCATTTTTTAAATAAGG - Intergenic
1116629826 14:47316093-47316115 TCATCCCCATTATATAAATGAGG - Intronic
1116815366 14:49578988-49579010 CCGTCCCCATTTTACAAATGAGG - Intronic
1116828821 14:49697840-49697862 ATATCCCTATTTTATAAATAAGG + Intronic
1116871039 14:50069514-50069536 TTATCCCCATTTTATAGATAAGG + Intergenic
1117088549 14:52226270-52226292 CCATCACCATTTATTAAATAGGG - Intergenic
1117748175 14:58892670-58892692 TCATCCCCATTTTACAAATGAGG - Intergenic
1118331621 14:64819935-64819957 TCATCCCCATTTTATAAAAATGG + Intronic
1118444532 14:65839297-65839319 TCATCCCCATTTTATAGATGGGG + Intergenic
1118494975 14:66299362-66299384 CCATCACCATTTATTAAATAGGG - Intergenic
1118569171 14:67175311-67175333 CCAGCACCATTTAATAAATAGGG + Intronic
1118572852 14:67211121-67211143 GTATCCCCATGTTACAAATGAGG - Intronic
1118690914 14:68338994-68339016 CCTGCCCCATGTTGTAAAAAGGG - Intronic
1118769376 14:68931649-68931671 CCATCCCCATTTTACAGATGTGG - Intronic
1118864763 14:69694346-69694368 GAATCCCCATGTTAAAAATGAGG + Intronic
1118994521 14:70823738-70823760 GTATCCCCATGTTATAAATGAGG - Intergenic
1120085826 14:80271541-80271563 TCATCCCCATCTTATAGATGAGG - Intronic
1120500595 14:85292673-85292695 TCATGCATATGTTATAAATAAGG - Intergenic
1120615167 14:86695284-86695306 CCAGCACCATTTAATAAATAGGG - Intergenic
1120885011 14:89445243-89445265 CCATCCCCATTTTACAGATGGGG - Intronic
1121000776 14:90450835-90450857 TCCTCCCCATGTTATAGATGAGG - Intergenic
1121495631 14:94389898-94389920 CCATCCCCATTTTACAGATAGGG - Intronic
1121904245 14:97725016-97725038 CCATCCACATTTTATAAATAGGG - Intergenic
1122104968 14:99446144-99446166 CCGTCCCCATTTTATAAGTGAGG - Intronic
1122449102 14:101789610-101789632 CCAGCTCCATGTAGTAAATACGG - Intronic
1125220282 15:37324848-37324870 CCAGCACCATGTATTAAATAGGG - Intergenic
1125290191 15:38137928-38137950 CCAGCACCATGTATTAAATAGGG + Intergenic
1125399200 15:39282340-39282362 CCACCCCCATTTGTTAAATAGGG - Intergenic
1126095877 15:45089737-45089759 CAATCCCCATTTTACAGATAAGG - Intergenic
1126112379 15:45183260-45183282 CTATCCCCAGATTATAAATGGGG - Intronic
1126311996 15:47327956-47327978 TTATCTCCATTTTATAAATACGG + Intronic
1126549090 15:49907667-49907689 GTATCCCCATTTTACAAATAAGG + Intronic
1126567575 15:50115821-50115843 TTATCCCCATTTTATAGATAAGG + Intronic
1126660975 15:51032856-51032878 CCAGCACCATTTAATAAATAGGG + Intergenic
1127032226 15:54876594-54876616 CCATCACCATTTATTAAATAGGG - Intergenic
1127045319 15:55019193-55019215 TTTTCCCCATTTTATAAATAAGG + Intergenic
1127300666 15:57650593-57650615 CCATTCCCATATTATTGATAAGG - Intronic
1127364600 15:58275963-58275985 CCATCCCCATGATCTAAATAAGG - Intronic
1127601130 15:60538017-60538039 TCATCCCCATTTTACAGATACGG + Intronic
1127726114 15:61751781-61751803 CTATCCCCATTTTATAGATGAGG + Intergenic
1127843799 15:62851956-62851978 GCAACCCCATTTTATAAATGAGG + Intergenic
1127974603 15:63987867-63987889 TCATCCCCATGTGACAAAGAAGG - Intronic
1128136914 15:65270645-65270667 TCATCCCCATTTTATAGATGAGG + Intronic
1129603332 15:77012698-77012720 TCATCCCCATTGTATAGATACGG - Intronic
1129630797 15:77257961-77257983 CCATCACCATTTATTAAATAGGG + Intronic
1129713023 15:77830862-77830884 TCATCCCCATTTTATAAATGAGG + Intergenic
1130208429 15:81900324-81900346 CTATCCCCATTTTATAGATGAGG + Intergenic
1130926176 15:88387592-88387614 CCATCCCCATTTTACAGATAAGG - Intergenic
1131230094 15:90653428-90653450 CCATTCCCATTTGATAGATAAGG + Intergenic
1131625293 15:94112115-94112137 TCATCCCCATATTATAGATGAGG + Intergenic
1131713195 15:95078646-95078668 CCATGCCAATGTTAAAAATTAGG + Intergenic
1131857029 15:96608285-96608307 CCATACCCATGTTGTGCATATGG + Intergenic
1132442421 15:101881503-101881525 CCAACCCCATTTATTAAATAGGG + Intergenic
1133376552 16:5292063-5292085 CCATCCCTCTGTGATAAATTAGG - Intergenic
1133446830 16:5868419-5868441 CCATCCCCATGGTATACCTGAGG - Intergenic
1133555199 16:6899998-6900020 GCATCCTCCTGTTATAAATAAGG - Intronic
1133674229 16:8055187-8055209 ACATGCCCATTTTATAAATGGGG - Intergenic
1133703409 16:8330855-8330877 CCATTCCCACTTTATAAATTAGG + Intergenic
1134744417 16:16576626-16576648 CCAGCACCATGTATTAAATAGGG - Intergenic
1134764661 16:16746276-16746298 CCAGCACCATGTATTAAATAGGG + Intergenic
1134823378 16:17264841-17264863 TCATCCCAATGTTTTAAATGAGG - Intronic
1134867140 16:17618501-17618523 TCATCCCCATTTTATAAATAAGG + Intergenic
1134981391 16:18612937-18612959 CCAGCACCATGTATTAAATAGGG - Intergenic
1134987970 16:18672012-18672034 CCAGCACCATGTATTAAATAGGG - Intergenic
1135001067 16:18777130-18777152 CCAGCACCATGTATTAAATAGGG + Intergenic
1135059726 16:19260929-19260951 CCCTCTCCATGTTATAGGTAAGG - Intronic
1135479332 16:22808992-22809014 TTATCCCTATTTTATAAATAAGG - Intergenic
1135660208 16:24289790-24289812 TTATCCCCATTTTACAAATAAGG - Intronic
1135856995 16:26020925-26020947 CCATCCCCATTTTACATATATGG - Intronic
1136318457 16:29467233-29467255 CCATCCCCATCTTAGAGATGTGG - Exonic
1136433032 16:30206582-30206604 CCATCCCCATCTTAGAGATGTGG - Exonic
1136464312 16:30431535-30431557 TCATCCCCATTTTAAAGATAAGG + Intergenic
1136688162 16:32008289-32008311 CCATCCCCATTTTACAGATGGGG + Intergenic
1136788766 16:32951844-32951866 CCATCCCCATTTTACAGATGGGG + Intergenic
1136881047 16:33902090-33902112 CCATCCCCATTTTACAGATGGGG - Intergenic
1138139832 16:54558644-54558666 CCATCCCCATTTTACAGATGAGG - Intergenic
1138139988 16:54559801-54559823 CCATCCCCATTTTACAGATGAGG + Intergenic
1138142405 16:54580169-54580191 TCATCCCCATCTTACAGATAAGG + Intergenic
1138505491 16:57476337-57476359 TCATCCCCATTTTATAGATGGGG + Intronic
1138575721 16:57906231-57906253 CCATCCCCATCTTATGGAGAAGG - Intronic
1138598221 16:58040772-58040794 CCATCCCCATTTTGTAGATGAGG + Intronic
1138922104 16:61543765-61543787 CCATGCCCATTTTACAGATATGG - Intergenic
1138950943 16:61912155-61912177 CCATACTCCTTTTATAAATACGG - Intronic
1139133309 16:64171911-64171933 TTATCACCATGTTATAGATAAGG + Intergenic
1139349509 16:66326410-66326432 CCATCACCATGTTACAGATTAGG + Intergenic
1139351015 16:66335770-66335792 TCATCCCCATTTTACAAATGAGG - Intergenic
1139366513 16:66437051-66437073 TCATCCCCATTTTATAAACAAGG - Intronic
1140077237 16:71711592-71711614 CTGTCCCCATTTTATAAATGAGG - Intronic
1140649079 16:77066896-77066918 CTATTCCCATTTTACAAATAAGG + Intergenic
1141309291 16:82897543-82897565 CCATCCCCATTTTATAGATGAGG + Intronic
1141389836 16:83655331-83655353 CTATCCCCATTTTACAGATAAGG + Intronic
1141713757 16:85715364-85715386 CCAGCCCCATCTTACAAATGTGG + Intronic
1203090963 16_KI270728v1_random:1213333-1213355 CCATCCCCATTTTACAGATGGGG + Intergenic
1143392375 17:6567297-6567319 CCATTCCCATTTTACAGATAAGG + Intergenic
1144148023 17:12416854-12416876 GCAGCCCTATTTTATAAATAGGG + Intergenic
1144346937 17:14357986-14358008 AAATCACCATGTTATAAACAGGG - Intergenic
1144808951 17:17986283-17986305 TCATCCCCATTTTATAGATGAGG - Intronic
1145733080 17:27208004-27208026 CCAACACCATGTATTAAATAGGG - Intergenic
1145868746 17:28256802-28256824 CCATCCCCATTTTACAGATTAGG + Intergenic
1146134529 17:30307282-30307304 CCATTCCCATTTTATAGATGAGG + Intergenic
1146161564 17:30562415-30562437 CCAGCACCATTTTTTAAATAGGG + Intronic
1146176902 17:30670943-30670965 CCATCCTCATTTTATAAATGAGG - Intergenic
1146350362 17:32087043-32087065 CCATCTTCATTTTATAAATGAGG - Intergenic
1146419296 17:32667768-32667790 ACATGCCCATTTTATATATATGG + Intronic
1146470218 17:33118361-33118383 TCATCCCCATTTTACAGATAAGG + Intronic
1146552076 17:33789402-33789424 CAATCCCCATTTTATAGACAAGG + Intronic
1146557242 17:33836518-33836540 TTATCCCCATTTTATAGATAAGG + Intronic
1146561793 17:33876582-33876604 CTGTCCTCATTTTATAAATAAGG + Intronic
1147149152 17:38503993-38504015 CCATCCCCATTTTACAGATGTGG + Intronic
1147163931 17:38583436-38583458 ACATCCCCATTTTACAAATTAGG - Intronic
1147529407 17:41261077-41261099 CCAGCCCCATTTATTAAATAGGG - Intergenic
1148049896 17:44764719-44764741 GCATCCCCATTTTATGAATGAGG - Intronic
1149325557 17:55526473-55526495 TTATCCCCATGTTATAGATGAGG + Intergenic
1149451802 17:56755503-56755525 GCATCCCCATTTTACAGATATGG + Intergenic
1149456160 17:56790264-56790286 CTATCCCCAACTTATAAATGAGG - Intergenic
1150178723 17:63091444-63091466 CCAGCCCCATTTATTAAATAGGG + Intronic
1150335452 17:64327375-64327397 CCATCTCCACTTTATAGATAAGG + Intronic
1150343770 17:64388495-64388517 TCATCCCCATGTTACAGATTGGG + Intronic
1150510002 17:65741113-65741135 TCATCCCCATATTACAAATGGGG - Intronic
1150802550 17:68292908-68292930 CCATCCCCATTTTACAGATCTGG - Intronic
1151052137 17:70990375-70990397 CCAGCACCATGTATTAAATAGGG - Intergenic
1151340416 17:73467393-73467415 CCATCTCCATGTTACAGATGAGG - Intronic
1151372745 17:73659235-73659257 TCAGCCCCTTGTTATAAACATGG + Intergenic
1152098452 17:78286791-78286813 TCATCCCCATTTTATGAATGGGG + Intergenic
1153583207 18:6596218-6596240 CCAACCTGATGTGATAAATAAGG - Intergenic
1153680125 18:7492541-7492563 CCATCCCCATTTTACAAATGAGG - Intergenic
1153827121 18:8885276-8885298 CCAGCACCATGTATTAAATAGGG + Intergenic
1153996825 18:10450097-10450119 TTATCCCCATGTTATAGATGGGG + Intergenic
1154040157 18:10847015-10847037 TCACCCCTATTTTATAAATAAGG + Intronic
1154292221 18:13118690-13118712 GCATCTCCATTTTACAAATAAGG - Intronic
1155038624 18:22046090-22046112 CCATCCCTATTATATAAATGGGG - Intergenic
1155164245 18:23219689-23219711 ACATCCCCATTTTATAGATGAGG - Intronic
1155311591 18:24529620-24529642 TTATCCCCATTTTATAAATTGGG - Intergenic
1155518791 18:26648845-26648867 GCATCCCCATGTTTTAGATGAGG - Intronic
1155523681 18:26695074-26695096 TCATTCCCATGTTAAAGATATGG + Intergenic
1155579490 18:27287013-27287035 CCATTCTCATTTTATAAATGAGG + Intergenic
1155788344 18:29931420-29931442 CAATTCCCAAGTTATACATATGG - Intergenic
1155999448 18:32368568-32368590 CCATCTAGAGGTTATAAATAAGG - Intronic
1156034234 18:32748807-32748829 TTATCCCTATTTTATAAATAAGG - Intronic
1156247171 18:35312449-35312471 CCATACCTATGTTATCAGTATGG - Intergenic
1156307329 18:35889563-35889585 TCATCCCCATTGTATAGATAAGG - Intergenic
1156348588 18:36283136-36283158 CCATCTCCATTTTAGAAATGAGG + Intergenic
1157217304 18:45795300-45795322 CCATCACCATTTATTAAATAGGG + Intergenic
1157219123 18:45812676-45812698 CCATCACCATTTATTAAATAGGG - Intergenic
1157346309 18:46838328-46838350 CCATCCCCATGTTATAAATAAGG + Intronic
1157370546 18:47107193-47107215 TTATCCCCATTTTATAGATAAGG + Intergenic
1157491527 18:48127121-48127143 CCATCCCCATTTTGCAAATGGGG + Intronic
1157587928 18:48817089-48817111 CAAACCCCATGTTTTAAATGAGG - Intronic
1157732726 18:50018619-50018641 TCATCCCCATGCTACAGATAAGG + Intronic
1157944893 18:51968142-51968164 CCAGCCCCATTTATTAAATAGGG + Intergenic
1158074837 18:53516207-53516229 CCATCACCATTTATTAAATAGGG - Intronic
1158124782 18:54089029-54089051 CTATCCCCATTTTATAGATGAGG + Intergenic
1158399965 18:57113270-57113292 CTCTCCCCATTTTATAAATGGGG + Intergenic
1158587369 18:58753005-58753027 TCATCCCCATTTTACAGATAAGG - Intergenic
1158667875 18:59449210-59449232 CCATCCCCATTTTATAGATGAGG - Intronic
1159463415 18:68749009-68749031 CCATCACCATTTATTAAATAGGG + Intronic
1159607581 18:70491294-70491316 CCATCTCTATGATGTAAATATGG + Intergenic
1159645398 18:70912337-70912359 CCAACACCATTTAATAAATAGGG + Intergenic
1160317781 18:77864343-77864365 CCATCCCCACTTCTTAAATATGG + Intergenic
1162552063 19:11363627-11363649 CCATCCCCATTTTTCAGATAAGG - Intronic
1162981917 19:14245967-14245989 CCATCCTCATTTTATAAATGAGG + Intergenic
1163241200 19:16064900-16064922 CCCTCCCTGTGTTACAAATAGGG - Intergenic
1163481416 19:17558830-17558852 CCACCCCCATGTTACAGATGAGG + Intronic
1164690317 19:30206097-30206119 CCATCCCCATTTTATAGAGAAGG + Intergenic
1165696998 19:37908005-37908027 AAATCCCCATTTTATAGATAGGG - Intronic
1165795106 19:38514824-38514846 CTATCCCCATGTTACAGGTAGGG + Intronic
1165925451 19:39323348-39323370 CCATCCCCATTTTATGGATAAGG + Intergenic
1166008727 19:39925677-39925699 TCACCCCCATGTTACAAATGAGG - Intronic
1166164649 19:40978732-40978754 GCATCACCATTTTATAGATAAGG + Intergenic
1166566988 19:43771392-43771414 GCATCCCCATTTTATAGATGAGG + Intronic
1166797923 19:45439345-45439367 CCACACCCATTTTATAAATGAGG - Intronic
1167457610 19:49605673-49605695 CCATCCCCATTTTACAGATGGGG + Intronic
1167529383 19:50005479-50005501 CTATCCCCATTTTATACATGAGG - Intronic
925158874 2:1668208-1668230 CCAGCACCATGTATTAAATAGGG - Intronic
925301439 2:2816110-2816132 CCATCACCATTTATTAAATAGGG + Intergenic
925498400 2:4478337-4478359 TCATCCCCATTTTAAAAGTAAGG + Intergenic
926036233 2:9638103-9638125 TCATCCCCATTTTATAAATGGGG - Intergenic
926048142 2:9725149-9725171 CTATCCCCATGTTACAGATGAGG - Intergenic
926071814 2:9900903-9900925 AAATCCCAATGTTATAAATATGG + Intronic
926259401 2:11243441-11243463 CCTTCTCCAAGTGATAAATATGG + Intronic
926333280 2:11843477-11843499 TCAGCCCCATTTTATAGATAAGG - Intergenic
926886204 2:17601210-17601232 CCTCCCCCATTTTACAAATAAGG + Intronic
926920228 2:17932898-17932920 CCATGCTCATGTTCTAAACATGG + Exonic
926920651 2:17936837-17936859 CCATTCCCATTTTATAGATGAGG + Intronic
926943294 2:18160766-18160788 GCATCCTCATTTTATAAATAAGG - Intronic
928816388 2:35299890-35299912 TCATCCCCATTTTACAGATAAGG + Intergenic
929367536 2:41178274-41178296 CCAGCACCATTTTTTAAATAGGG + Intergenic
929697019 2:44126366-44126388 CCATCCTCATTTTATGAATGAGG + Intergenic
929934584 2:46285591-46285613 TCATCCCCATTTTACAGATAAGG + Intergenic
930397402 2:50840712-50840734 CCACACCCATTTTAGAAATAGGG + Intronic
930728335 2:54704382-54704404 TCATCCCCATTTTACAGATAAGG + Intergenic
930908243 2:56599611-56599633 CCAGCACCATTTTTTAAATAGGG + Intergenic
931188097 2:59973284-59973306 CCATCCCCATTTTACAGATGAGG + Intergenic
931713375 2:65008866-65008888 CTATCTCCATTTTATAAATGGGG + Intronic
931945393 2:67300563-67300585 TCATCCCCGTGTTATAAATGAGG - Intergenic
932181989 2:69654934-69654956 CCATCGCCATTTATTAAATAGGG - Intronic
932199570 2:69813618-69813640 CTATCCCCATTTTACAAACAAGG + Intronic
932913611 2:75831181-75831203 TTATCCCCATTTTACAAATAAGG - Intergenic
933465607 2:82647073-82647095 CCAGCACCATTTAATAAATATGG - Intergenic
933791093 2:85884131-85884153 TCATCCCCATTTTATAAAGGAGG - Intronic
934320526 2:91967531-91967553 CCGCACCCATATTATAAATATGG - Intergenic
935392086 2:102563573-102563595 CTGTCCCCATTTTATAGATAAGG - Intergenic
935710593 2:105894763-105894785 TCATCCCCATTTTATAGATGGGG + Intergenic
936664362 2:114577235-114577257 TTATCCCCATCTTATAAATAGGG + Intronic
936923064 2:117708889-117708911 TTATCCCCATGTTATAGATGAGG + Intergenic
937387498 2:121449347-121449369 TAATTCCCATGTTATAAATGAGG - Intronic
937715551 2:125027873-125027895 CCATCACCATTTATTAAATAGGG + Intergenic
938537981 2:132260757-132260779 CCAGCACCATGTATTAAATAGGG - Intergenic
938680437 2:133684313-133684335 CAATCCCCATTTTACAAATGGGG - Intergenic
938782347 2:134596346-134596368 CCAGCACCATTTTTTAAATAGGG + Intronic
939142701 2:138374931-138374953 TCATTCCCATTTTATAGATAAGG + Intergenic
939236960 2:139507088-139507110 CCAGCACCATGTTTTGAATAGGG - Intergenic
939424319 2:142015280-142015302 CCAACCCCATTTATTAAATAGGG - Intronic
939940477 2:148344047-148344069 CCATCACCATGTATTGAATAGGG + Intronic
940056904 2:149523032-149523054 CCAGCACCATTTAATAAATAAGG + Intergenic
940994672 2:160135811-160135833 CCATCACCATTTATTAAATAGGG - Intronic
940996254 2:160153345-160153367 CCATCACCATTTATTAAATAGGG - Intronic
941163375 2:162059970-162059992 TCATTCCCATTTTACAAATAAGG + Intronic
941205840 2:162571803-162571825 CCAGCACCATGTATTAAATAGGG - Intronic
941382604 2:164814208-164814230 CCTTCCCCATCTGATAAATCGGG + Intronic
941530742 2:166667634-166667656 CCAGCACCATGTATTAAATAAGG + Intergenic
941767031 2:169309457-169309479 CCAACACCATGTATTAAATAGGG + Intronic
942268389 2:174249666-174249688 CCATCCCCATTTTACAAGTGAGG + Intergenic
942336067 2:174887504-174887526 ACATCCTCATCTTATAGATAAGG + Intronic
942809820 2:179985050-179985072 TCATCCTCATCTTATAGATAAGG + Intronic
943292512 2:186092029-186092051 CCAGCACCATGTATTAAATAGGG + Intergenic
943837283 2:192529401-192529423 CCATCACCATTTATTAAATAGGG - Intergenic
943873580 2:193033745-193033767 CCAGCACCATTTAATAAATAGGG + Intergenic
943875915 2:193067131-193067153 CCAGCACCATTTAATAAATAGGG - Intergenic
944040149 2:195344446-195344468 TTATCCCCATTTTATAGATAAGG + Intergenic
944827354 2:203498474-203498496 TCATTCCCATTTTATAAATGAGG + Intronic
946588905 2:221221086-221221108 ACATCCCTATCTTATAAAGACGG - Intergenic
947177029 2:227378203-227378225 ACATCCCCATTTTACACATATGG + Intronic
947278397 2:228421224-228421246 CCAGCCCCATTTATTAAATAGGG + Intergenic
947297655 2:228650333-228650355 CCAGCACCATGTATTAAATACGG - Intergenic
947788489 2:232846765-232846787 TTATCCCCATTTTATAAATTAGG + Intronic
947847184 2:233254005-233254027 TCATCCCCATTTTATAGATGAGG - Intronic
947944588 2:234090732-234090754 CTATCCCAATTTTACAAATAAGG + Intergenic
948295024 2:236854213-236854235 CCATCCCCATTTTACGGATAGGG + Intergenic
1168758025 20:329269-329291 TTATCCCCACGTTATACATATGG - Exonic
1168803030 20:655645-655667 CCATCCCCATTTGATAGATGGGG + Intronic
1168860399 20:1042299-1042321 TCATCCCCATTTTGTAGATAAGG + Intergenic
1169458675 20:5775752-5775774 TCATCTCCATTTTACAAATAAGG - Intronic
1169954712 20:11088352-11088374 CCATCACCATTTATTAAATAGGG - Intergenic
1171140713 20:22739529-22739551 CCAGCACCATTTTTTAAATAGGG - Intergenic
1171448831 20:25222446-25222468 CCCTCCCTATGTCATAGATAAGG - Intronic
1171560967 20:26125670-26125692 TCATCTCCATTTTACAAATAAGG + Intergenic
1171740080 20:28873713-28873735 CCATCACCATTTATTAAATAGGG + Intergenic
1171740480 20:28879755-28879777 CCATCACCATTTATTAAATAGGG + Intergenic
1171998069 20:31748756-31748778 CCATCACCATTTTATAAACAAGG - Intronic
1172122291 20:32605578-32605600 TCATCCCCACTTTATAGATATGG - Intronic
1172831038 20:37834763-37834785 ACATCTCCATTTTATAAATGTGG - Intronic
1173153771 20:40590212-40590234 CCCTCCCCATTTTTCAAATAAGG + Intergenic
1173318478 20:41966308-41966330 CCATCACCATTTATTAAATAGGG + Intergenic
1173413552 20:42836892-42836914 CCATCCCCATATCAAAAATAAGG + Intronic
1173625898 20:44472751-44472773 ATATCCCCATTTTATACATAAGG + Intergenic
1173958620 20:47053979-47054001 CCATCCCCATTTTACAAATGGGG - Intronic
1174423744 20:50417472-50417494 CAATCTCCATGTTATAAATGTGG + Intergenic
1174423752 20:50417542-50417564 CAATCTCCATGTTATAGATGTGG + Intergenic
1174530517 20:51209144-51209166 TTATCCCCATTTTATAGATAAGG - Intergenic
1174555905 20:51395215-51395237 TCATCCCCATTTTATAGATGGGG + Intronic
1174724347 20:52845617-52845639 TCATCCCCATCTTACAGATATGG + Intergenic
1174798950 20:53546630-53546652 TCATCCCCATTTTATAGATGAGG - Intergenic
1175017555 20:55808129-55808151 CCAGCCCCATTTATTAAATAGGG + Intergenic
1175019404 20:55828337-55828359 CCATCCCCATGTTGCAGATTAGG - Intergenic
1175028370 20:55927599-55927621 GCCTGCACATGTTATAAATAGGG + Intergenic
1175226371 20:57446474-57446496 CCATTCACATGTTACAAATGAGG - Intergenic
1175464561 20:59181601-59181623 CCAGCACCATTTAATAAATAGGG + Intergenic
1175541971 20:59753692-59753714 TTATCCCCATTTTATAGATAAGG + Intronic
1175550084 20:59811852-59811874 CCATCCCCATTTCACAAACAAGG - Intronic
1175555134 20:59846980-59847002 CCATCCTCATGTTTTACATATGG + Intronic
1175583378 20:60117996-60118018 CTATCCCCATGTTAAAGACAAGG - Intergenic
1177126768 21:17203900-17203922 CCATCACCATTTATTAAATAGGG - Intergenic
1177428594 21:20959478-20959500 CCAACCCCATTTATTAAATAGGG - Intergenic
1177689646 21:24488753-24488775 CCATCAGCATGTATTAAATAGGG - Intergenic
1177960758 21:27663185-27663207 CCAGCACCATTTTTTAAATAGGG - Intergenic
1178229496 21:30764912-30764934 CTATCCCCATCATATAACTAAGG + Intergenic
1178248695 21:30979789-30979811 CCATGCCCATTTTACAGATAAGG - Intergenic
1178569115 21:33718116-33718138 CCATCCCCATATTATGGATCAGG - Intronic
1179170170 21:38966899-38966921 TGATTCCCATTTTATAAATAAGG + Intergenic
1179664585 21:42901731-42901753 CTATCCCCATGTCATAGACAAGG + Intronic
1180308774 22:11151590-11151612 CCGCACCCATTTTATAAATATGG - Intergenic
1180452970 22:15484508-15484530 CCATCCCTTTGTTTTCAATAAGG - Intergenic
1180487337 22:15815082-15815104 CCTTCCCTATTTTAGAAATAAGG + Intergenic
1180547251 22:16513401-16513423 CCGCACCCATTTTATAAATATGG - Intergenic
1181618331 22:24070524-24070546 GCATCCCCACTTTATAAATGGGG + Intronic
1181907042 22:26206474-26206496 CCATCCCCATTTTGAAAATAAGG + Intronic
1182117012 22:27762321-27762343 CCATCCCCATTTCATAGATGAGG - Intronic
1183255155 22:36757211-36757233 CCATCCCCCTTTTACAAATGAGG - Intergenic
1184042812 22:41954148-41954170 CTATCCCCATTTTACAGATAAGG - Intergenic
1184043059 22:41955858-41955880 CTATCCCCATTTTACAGATAAGG + Intergenic
1184088575 22:42280668-42280690 CCATCTCCATTTTACAACTAGGG + Intronic
1184311069 22:43643216-43643238 CCAACTCCATGTTCTAAATGAGG + Intronic
1184341444 22:43888213-43888235 CCAGCCCCATTTTCTAGATAAGG - Intronic
1184579875 22:45409198-45409220 TTATCCTCATTTTATAAATATGG + Intronic
1184813652 22:46854266-46854288 CCATCCCCATTTTACAAATGAGG - Intronic
1185010197 22:48308662-48308684 TCATTCTCATGTTATAATTAAGG + Intergenic
949095933 3:85551-85573 CAATGCCCATATTATCAATATGG - Intergenic
949188569 3:1223311-1223333 CCAGCCTCATTTTATGAATAAGG - Intronic
949244827 3:1914732-1914754 CCAGCACCATTTTTTAAATAGGG + Intergenic
949304937 3:2629162-2629184 CCTTCCCCTTATTATAAAGACGG - Intronic
949361948 3:3241805-3241827 TCATCCCCATTTTACAAATGAGG - Intergenic
949921614 3:9007723-9007745 TCATTCCCATTTTATAGATAAGG + Intronic
950157120 3:10729953-10729975 CTATTCCCGTGTTATAAATGAGG + Intergenic
950521381 3:13499949-13499971 CCATCCCCATTTTACAGATGAGG - Intronic
950716511 3:14851302-14851324 TCATCTCCATGTTATAGATGAGG + Intronic
951685108 3:25335117-25335139 CCATCCCCATATTATAGCTGAGG - Intronic
951919572 3:27839342-27839364 CCTTCCTCTTGTTATTAATATGG - Intergenic
951977245 3:28526073-28526095 CCATCCCCATTTTACATATGAGG - Intronic
951977401 3:28528048-28528070 CCATCACCATTTATTAAATAGGG + Intronic
952177090 3:30876176-30876198 ACATCCCCGTTTTATAAATGAGG + Intronic
952357449 3:32597576-32597598 AAATCCCCATTTAATAAATAAGG - Intergenic
952366106 3:32676346-32676368 TCATACCCATTTTATAGATAAGG - Intergenic
953525178 3:43683837-43683859 CCAGCACCATTTTTTAAATAGGG - Intronic
954055915 3:48024756-48024778 ACATCCTCATTTTACAAATAAGG + Intronic
954306869 3:49731574-49731596 TCATTCCCATGTTATAGATGAGG - Intronic
954525778 3:51269879-51269901 TCATCCCCATTTTATAGATGGGG + Intronic
954685164 3:52366324-52366346 CCATCCTCATTTTATAGATGAGG + Intronic
954960330 3:54558807-54558829 TTATCCCCATTTTACAAATAAGG + Intronic
955023665 3:55145960-55145982 ACACCCTCATTTTATAAATAGGG - Intergenic
955506873 3:59641294-59641316 TCATCCCCATTTTATAGATGAGG + Intergenic
956093482 3:65692562-65692584 CCATCCCCATTTTGTAGATAAGG + Intronic
956100110 3:65759328-65759350 ACATCCCCATTTTATAGATAAGG - Intronic
956308447 3:67852254-67852276 ACATCACCATGTTAGAACTAAGG + Intergenic
956482274 3:69685146-69685168 CCATTCCCATTTTACAGATATGG - Intergenic
958422722 3:93946563-93946585 CCAGCACCATTTTTTAAATAGGG - Intronic
959092629 3:101920289-101920311 CCAACCCCATTTATTAAATAGGG + Intergenic
959321765 3:104885848-104885870 CCATTCCCATGTCTTAAAAAGGG - Intergenic
959403015 3:105925577-105925599 CCATCTCTAGGTTGTAAATATGG + Intergenic
959720732 3:109485002-109485024 CCTTCCACATGTTAAAAATGGGG - Intergenic
960014985 3:112877004-112877026 CCAACACCATTTTTTAAATAGGG + Intergenic
960156351 3:114300559-114300581 AAATCCCCATTTTATATATAAGG - Intronic
960546355 3:118919016-118919038 CCAGCCCCATTTATTAAATAGGG - Intronic
961899472 3:130197029-130197051 CCATCCCTCTGTGATAAATTAGG + Intergenic
961968493 3:130932568-130932590 TCATCACCATTTTATAGATAAGG - Intronic
962021505 3:131507020-131507042 TCAACCCCATTTTACAAATATGG + Intergenic
962616091 3:137128208-137128230 TTATCTCCATGTTATAAATGAGG + Intergenic
962974082 3:140431078-140431100 TCATCACCATCTTATAGATAAGG - Intronic
963233030 3:142928005-142928027 CCATCCCCAGTTTACAGATAAGG - Intergenic
963352552 3:144169842-144169864 TCATCCCCATCTTCCAAATATGG - Intergenic
963747561 3:149140801-149140823 TCATCCCCATTTTACAAATGAGG - Intronic
963792496 3:149598368-149598390 TTATCCCCATCTTATAAATGAGG + Intronic
964007336 3:151847495-151847517 CCAGCACCATGTATTAAATAGGG + Intergenic
964277969 3:155028040-155028062 CCATTCCCATTTTAAAAAGAAGG - Intronic
964389643 3:156183954-156183976 TTATCCCCATTTTACAAATAAGG - Intronic
964775777 3:160275062-160275084 CCAGCCCCATTTTACAAATGAGG - Intronic
964778253 3:160304774-160304796 TTATCCCCATTTTACAAATAAGG - Intronic
964799449 3:160538916-160538938 CTATCCCAATTTTATAGATAAGG - Intronic
964844792 3:161033599-161033621 CCAACCCCATTTATTAAATAGGG - Intronic
964853721 3:161122555-161122577 CCAACCCCATTTATTAAATAGGG - Intronic
965358546 3:167708955-167708977 TTATCCCCATTTTATAAATAAGG + Intronic
965499252 3:169438052-169438074 TCATCCCCATTTTATATGTAAGG + Intronic
965727980 3:171739702-171739724 CCATCCCCTCTTTATAGATAAGG + Intronic
965864857 3:173194139-173194161 TCATCCTTATGTTATAGATAAGG + Intergenic
966440907 3:179942984-179943006 CTATCCCCATTTTACAGATAAGG - Intronic
966939487 3:184736497-184736519 TCATCCCCATTTTATAGATGAGG + Intergenic
967725176 3:192855578-192855600 TCATCTCCATTTTACAAATAAGG + Intronic
968590141 4:1454340-1454362 CTATTCCCATTTTACAAATAAGG + Intergenic
969193478 4:5542664-5542686 TCATCCCCATTTTATAGATGGGG - Intergenic
969520619 4:7675825-7675847 CCATCCCCATTTTAGAGATGGGG + Intronic
969743904 4:9054701-9054723 CCATCCCTCTGTGATAAATTAGG - Intergenic
969814248 4:9674902-9674924 CCATCCCCAAGTTACAGACAAGG + Intergenic
970271742 4:14355339-14355361 TCATCCCCATTTTATAAATGTGG - Intergenic
970279497 4:14438591-14438613 TGAACCCCATTTTATAAATAAGG - Intergenic
970346882 4:15160881-15160903 TAATCCCCATTTTATATATAAGG + Intergenic
970498211 4:16649650-16649672 GCATCCCCATTTTACAAATGAGG - Intronic
970754235 4:19405089-19405111 TCATCCCCATTTTATAGATCAGG + Intergenic
971080668 4:23207122-23207144 CCATCACCATGTATTGAATAGGG + Intergenic
971130253 4:23800828-23800850 TCATCCCCATTTTACAGATAAGG - Intronic
971466718 4:26971477-26971499 CCAGCACCATGTATTAAATAGGG + Intronic
971505673 4:27364245-27364267 TCACCCTCATGTTATAGATAAGG + Intergenic
971525824 4:27617561-27617583 TCATCCCCATTGTATATATAAGG + Intergenic
971554596 4:27997664-27997686 CCATCACCATTTTTTGAATAGGG + Intergenic
971874914 4:32295593-32295615 ACATTCCCATATTTTAAATATGG + Intergenic
971999691 4:34014922-34014944 CTATGCCCATCTTTTAAATATGG - Intergenic
972382764 4:38534876-38534898 ACATCCTTATTTTATAAATAAGG - Intergenic
972397586 4:38671235-38671257 TCATCCCCATTTTAGAAATGAGG - Intronic
972820603 4:42697530-42697552 CCAGCACCATGTATTAAATAGGG + Intergenic
972829003 4:42792468-42792490 CCAGCACCATGTATTAAATAGGG - Intergenic
973158811 4:46991730-46991752 CCATCCCCACTTTACAGATAAGG - Intronic
973194507 4:47424330-47424352 CCATCCCCATTTTATAGATAAGG - Intronic
973538298 4:51906938-51906960 TAATCCCCAATTTATAAATAAGG - Intronic
974319546 4:60329158-60329180 TTATCCCCATGTTGTAAATGAGG + Intergenic
974908000 4:68080896-68080918 ACATCCCCAAGTTTTAGATAAGG + Intronic
975287579 4:72638068-72638090 CCAGCACCATTTTTTAAATAGGG - Intergenic
975531678 4:75405969-75405991 CCAGCACCATTTAATAAATAGGG - Intergenic
975610038 4:76194419-76194441 TTATCCCCATTTTATAGATAAGG + Intronic
975807014 4:78123210-78123232 CCAGCACCATGTATTAAATAGGG + Intronic
975829947 4:78358529-78358551 TTATCCCCATTTTATAAATGAGG - Intronic
976335395 4:83879500-83879522 CTATCCCCATTTTATAGATAAGG - Intergenic
976580096 4:86726052-86726074 CCAGCACCATGTATTAAATAGGG + Intronic
976771381 4:88656813-88656835 TTATCCCCATGTTAGAGATAAGG + Intronic
976925509 4:90490755-90490777 CCAGCACCATTTTTTAAATAGGG + Intronic
977288206 4:95135095-95135117 CCAGCCCCATTTATTAAATAGGG + Intronic
977478413 4:97541878-97541900 CCATCACCATTTGTTAAATAGGG - Intronic
977488482 4:97679860-97679882 CCATCACCATTTATTAAATAGGG + Intronic
977558793 4:98511887-98511909 TAATCCCCATTTTATAGATAAGG + Intronic
977744094 4:100524665-100524687 CCAGCACCATTTTTTAAATAGGG - Intronic
978055341 4:104256815-104256837 CCATCACCATTTATTAAATAGGG - Intergenic
979284300 4:118904132-118904154 CTATCCCCATGTTACAAATGAGG - Intronic
979617346 4:122758774-122758796 CCTACCCCGTGTTATAAACATGG - Intergenic
979659990 4:123242506-123242528 CCAGCACCATGTATTAAATAGGG - Intronic
979742805 4:124172385-124172407 CCAGCACCATTTAATAAATAGGG - Intergenic
980084162 4:128374456-128374478 TCATCCCCATTTTACAGATAAGG + Intergenic
980160490 4:129156266-129156288 CCAACAGCATGTTATAAATTAGG + Intergenic
980479646 4:133371568-133371590 CCAACTCCATGTTATATACAAGG - Intergenic
980637164 4:135522093-135522115 ATATCCCCATTTCATAAATAAGG + Intergenic
980695745 4:136353050-136353072 CCAGCACCATGTATTAAATAGGG + Intergenic
980848383 4:138351872-138351894 CCAGCACCATGTATTAAATAGGG + Intergenic
981625742 4:146752809-146752831 CCATCACCATTTATTAAATAGGG - Intronic
981654684 4:147099992-147100014 TTATCCCCATTTTATAAATGAGG + Intergenic
982285096 4:153725711-153725733 TTATCCTCATGTTATAAATTAGG - Intronic
983126974 4:163965400-163965422 GCATCCCCATTTTATAGATGAGG + Intronic
983843918 4:172492706-172492728 CCATCTCCATTTTAGAATTAGGG - Intronic
984663248 4:182397087-182397109 CCATCATCATGTTATGAATTAGG + Intronic
985210492 4:187587214-187587236 CTGTCCCCATTTTACAAATAAGG - Intergenic
986189234 5:5478855-5478877 CCAGCACCATTTAATAAATAGGG - Intronic
987239811 5:15984272-15984294 CCATCACCAAGCTAGAAATAGGG + Intergenic
987351407 5:17025456-17025478 TCATCCCCATTTTATAAGTAAGG - Intergenic
987625201 5:20389895-20389917 CCATCACCATTTATTAAATAGGG - Intronic
987669375 5:20987394-20987416 CCATCACCATATATTAAATAGGG + Intergenic
987917754 5:24237847-24237869 CCAGCCCCATGATGTAAATTAGG + Intergenic
988002571 5:25367560-25367582 CCATCACCATTTATTAAATAGGG - Intergenic
988017912 5:25583464-25583486 CCAGCCCCATTTCTTAAATAGGG + Intergenic
988672172 5:33393611-33393633 CCAGCACCATTTTTTAAATAGGG - Intergenic
989040416 5:37221993-37222015 CCATCCCTTTGATATACATATGG - Intronic
989302969 5:39916243-39916265 CCAGCACCATTTAATAAATAGGG + Intergenic
989426011 5:41296734-41296756 TCATCTCTATGTTACAAATAAGG - Intergenic
989669355 5:43896941-43896963 TCATCCCCATTTTATAGATGAGG + Intergenic
989676279 5:43977084-43977106 CCAGCACCATGTATTAAATAGGG + Intergenic
989796574 5:45481887-45481909 TCATCCCCATTTTATAAATGAGG - Intronic
989951025 5:50297484-50297506 CCAGCACCATTTAATAAATAGGG - Intergenic
990479573 5:56196490-56196512 TTATTCCCATGTTATAGATAAGG + Intronic
990676579 5:58193328-58193350 CCATCACCATTTATTAAATAGGG - Intergenic
991168040 5:63586680-63586702 CCATCACCATTTATTAAATACGG - Intergenic
991477968 5:67043929-67043951 CTTTCCCCATGTTATAAAACTGG + Intronic
991979743 5:72218694-72218716 CCATCCACATGGAAGAAATATGG + Intergenic
992154730 5:73943889-73943911 TCATCCCTGTTTTATAAATAAGG - Intergenic
992244191 5:74801352-74801374 CCATCCCTATTTTATAGCTAAGG + Intronic
992405773 5:76456232-76456254 CCACCCCCATGTTAAAAACATGG - Intronic
992651203 5:78862508-78862530 CCAGCACCATGTATTAAATAGGG - Intronic
993305022 5:86266273-86266295 CCAGCACCATTTTTTAAATAGGG + Intergenic
993403130 5:87477457-87477479 CCATCACCATTTATTAAATAGGG - Intergenic
993481360 5:88428718-88428740 TTATCCCCATTTTACAAATATGG - Intergenic
993520594 5:88894954-88894976 CCTTCCCCATTTTACAAAAAGGG - Intronic
993741555 5:91546908-91546930 CCAACACCATTTTTTAAATAGGG + Intergenic
993762347 5:91810845-91810867 CCAGCACCATGTATTAAATAGGG + Intergenic
993874949 5:93295529-93295551 ACATCCCCATTTTATAGAAAAGG + Intergenic
993937198 5:94019069-94019091 CCAACACCATGTATTAAATATGG - Intronic
993954223 5:94213046-94213068 TCATCCCCATTTCATAGATAAGG + Intronic
993969764 5:94404873-94404895 CCCTCACCATTTTATAAATGAGG - Intronic
993994999 5:94712171-94712193 CTATCCCCATTTTATAAATGGGG - Intronic
994015491 5:94960177-94960199 CCAACACCATGTATTAAATAGGG - Intronic
994294829 5:98078387-98078409 CCATCTCCATTTTACAAATAAGG + Intergenic
994546065 5:101167746-101167768 CCAGCACCATTTTTTAAATAGGG - Intergenic
994799839 5:104358871-104358893 CCAGCACCATGTATTAAATAGGG + Intergenic
994982464 5:106893075-106893097 CCAGCACCATGTATTAAATAGGG + Intergenic
995664988 5:114531881-114531903 CCAGCACCATTTTTTAAATAGGG + Intergenic
996312869 5:122126578-122126600 CCCCCACAATGTTATAAATAGGG + Intergenic
997797013 5:136820435-136820457 TCATCTCCATTTTATAAATGAGG - Intergenic
998242166 5:140456619-140456641 CCAGCACCATGTATTAAATAGGG - Intronic
998247389 5:140519685-140519707 CCAGCACCATGTATTAAATAGGG - Intronic
998276523 5:140759762-140759784 CCAGCACCATGTATTAAATAGGG + Intergenic
998391501 5:141789815-141789837 TCATTCCCATTTTATAGATAAGG + Intergenic
998516953 5:142764976-142764998 CCATCCCCATTTTACAGGTAAGG - Intergenic
998607407 5:143649194-143649216 CCATCCCTAGTTTATAAATGAGG + Intergenic
998796326 5:145823540-145823562 CCATCCCCATCTTTCAGATACGG + Intronic
998959889 5:147474102-147474124 TCATCCCCATTTTATAGAAAAGG - Intronic
999067437 5:148704652-148704674 CCAGCACCATGTGTTAAATAGGG - Intergenic
999123063 5:149224818-149224840 TCATCCCTGTTTTATAAATAGGG + Intronic
999265839 5:150266306-150266328 CTCTCCCCATTTTATAGATAAGG + Intronic
999343642 5:150795803-150795825 CCATCCCCATTTGAAAGATAAGG - Exonic
999598099 5:153228252-153228274 CCATCACCATTTATTAAATAGGG - Intergenic
999703184 5:154247043-154247065 CCAGCACCATGTATTAAATAGGG + Intronic
999861277 5:155649299-155649321 CCATCCCCATTTTACAGATGAGG - Intergenic
999920426 5:156312694-156312716 TTATCCCCATTTTATAAATGAGG - Intronic
1000086076 5:157888465-157888487 TTATCCCCATGTTATAAATTAGG - Intergenic
1000297696 5:159926576-159926598 CTCTGCCCATTTTATAAATAAGG + Intronic
1000926002 5:167194844-167194866 CCATCTCCATTTTATAGACAGGG + Intergenic
1000932342 5:167266658-167266680 CTATCCCCATTTTACAGATAAGG - Intergenic
1001235323 5:170024429-170024451 TCATCCCCATGTTACAAATGAGG - Intronic
1001259127 5:170212065-170212087 CTATCCCCATTTTACAAAGAAGG + Intergenic
1001399135 5:171436416-171436438 GCATCCCCATTTTATAGATCAGG - Intronic
1001745087 5:174086347-174086369 CCATCCCCAAGTTAAAAACTGGG + Intronic
1001780340 5:174363291-174363313 CCACCCCCATTTTATAGAGAAGG - Intergenic
1002047442 5:176549859-176549881 TCATCCCCATTTGATAAATGAGG - Intronic
1002248180 5:177903521-177903543 TCATCCCCATTTTACAGATAAGG + Intergenic
1002715712 5:181225551-181225573 CCATTCCCATTTTATAGATTGGG + Intronic
1003459490 6:6317262-6317284 TCATCCCCATGTTATATGTTAGG - Intronic
1003481056 6:6533919-6533941 TTATCCCCATTTTACAAATAGGG + Intergenic
1004129254 6:12903180-12903202 GCATTCCCACCTTATAAATAAGG - Intronic
1004205233 6:13586477-13586499 CCAGCCCCATTTATTAAATAGGG + Intronic
1004760691 6:18662797-18662819 CCATCCCCAAGGTACAAAGATGG - Intergenic
1004880373 6:20001679-20001701 TCCTCCCCATGTTATAGGTAAGG + Intergenic
1004942972 6:20580638-20580660 CCCTCTCCAGGTTATAAGTAAGG + Intronic
1005178132 6:23071456-23071478 CCAGCACCATGTATTAAATAGGG + Intergenic
1005846750 6:29787221-29787243 CCATCACCATTTATTAAATAGGG - Intergenic
1006123977 6:31825910-31825932 CCTTCCTCCTGTTTTAAATACGG - Intergenic
1006727326 6:36209199-36209221 TTATCCCCATTTTACAAATATGG - Intronic
1006788422 6:36683227-36683249 CTATCCCCATTTTATAGATGAGG + Intronic
1006837815 6:37009644-37009666 CTATCCCCATTTTACAAATGAGG - Intronic
1007513454 6:42392309-42392331 TTATCCTCATTTTATAAATAAGG - Intronic
1007557318 6:42777303-42777325 TCATCCCCATTTTATAGATGAGG + Intronic
1007805488 6:44441784-44441806 CTTTCCCCATTTTAAAAATAGGG + Intronic
1007897134 6:45374392-45374414 CCATCTTCATTTTATAAATGAGG + Intronic
1007917585 6:45575470-45575492 CCATCACCATTTTGTTAATATGG - Intronic
1007918020 6:45579262-45579284 CCATCCCCATTTTACAGATGAGG + Intronic
1007981487 6:46163853-46163875 CCATCACCATTTATTAAATAGGG - Intronic
1008800654 6:55364672-55364694 CCAGCACCATTTAATAAATAGGG + Intronic
1009558546 6:65207784-65207806 CCATCACCATTTTTTAAATGGGG - Intronic
1009874476 6:69488705-69488727 TCATCCCCATTTTAGAACTAAGG + Intergenic
1010608160 6:77918001-77918023 CCATCACCATATATTAAATAGGG + Intronic
1010904654 6:81472918-81472940 CCAGCACCATGTATTAAATAGGG - Intergenic
1011009633 6:82689136-82689158 TTATCCCCATTTTACAAATAAGG - Intergenic
1011534364 6:88359908-88359930 TTATCCCCATTTTAAAAATAAGG - Intergenic
1012526533 6:100184580-100184602 TCCTCCCCATGTAATAAATAAGG - Intergenic
1012662502 6:101920144-101920166 CCCTCTTCATTTTATAAATATGG + Intronic
1013193853 6:107828088-107828110 CCATTCCCATCTTACAGATAAGG + Intergenic
1013218689 6:108056239-108056261 TTATCTCCATTTTATAAATAAGG + Intronic
1013390753 6:109684155-109684177 CCAACACCATTTTTTAAATAGGG - Intronic
1013399576 6:109779405-109779427 ACATCCCCATTTTCTAAAAAAGG + Intronic
1013715749 6:112959415-112959437 CCAACACCATGTATTAAATAGGG - Intergenic
1014008228 6:116445804-116445826 ACAGCCCCATCTTATAAATTAGG + Intergenic
1014717393 6:124882116-124882138 TGAACCCCATGTGATAAATAGGG - Intergenic
1015703441 6:136061513-136061535 CCACCCCCATATAAGAAATAAGG + Intronic
1016021935 6:139245242-139245264 TCACCCCCATTTTATAAATGGGG + Intronic
1016248027 6:142010466-142010488 CAATCCCCATTTTATAGATGAGG - Intergenic
1016401431 6:143685564-143685586 ATATCCCCATTTTATAAATGAGG + Intronic
1017131514 6:151112129-151112151 CCTTCCCCATTTTGTAATTAAGG + Intergenic
1017196973 6:151712077-151712099 CCATCACCATTTATTAAATAGGG + Intronic
1017319423 6:153072473-153072495 ACATTGCCATTTTATAAATAAGG + Intronic
1018108312 6:160510229-160510251 TCATCCCAATTTTATAAACAAGG - Intergenic
1018114388 6:160569389-160569411 CCAGCACCATGTATTAAATAGGG - Intronic
1018135479 6:160774742-160774764 TCATCCCCATTTTATACACAAGG + Intergenic
1018399923 6:163412432-163412454 TTATCCCCATTTTACAAATAAGG - Intergenic
1018919259 6:168160074-168160096 CCCTCCTCATTTTATAGATAGGG - Intergenic
1020361678 7:7333385-7333407 TCATCCCCATGGAAAAAATATGG - Intergenic
1020468306 7:8506370-8506392 GCATCCCCATTTTATAAATGAGG - Intronic
1020883372 7:13792409-13792431 CCATCTCCATGTTGTTAATTTGG + Intergenic
1021011800 7:15478169-15478191 CCATGCCCATTTTCTAATTAAGG - Intronic
1021069713 7:16221202-16221224 CCAGCCCCATTTATTAAATAGGG - Intronic
1021492386 7:21233264-21233286 CCATCACCATTTATTAAATAGGG + Intergenic
1021636272 7:22697106-22697128 TCATCTCCATTTTATAAATGAGG - Intergenic
1021776804 7:24062301-24062323 CCATCACCATTTATTAAATAGGG - Intergenic
1021982320 7:26066889-26066911 CCATCCCCATTTTACAGATGAGG + Intergenic
1022185360 7:27962005-27962027 CCATCTTCATTTTATAGATAAGG - Intronic
1022543090 7:31157614-31157636 CCATCACCATTTATTAAATAGGG + Intergenic
1022824599 7:33995986-33996008 GTATCCCCATTTTATAAATGAGG - Intronic
1022952053 7:35348558-35348580 GCATGCCCATTTTATAAAGAAGG + Intergenic
1023375305 7:39549852-39549874 CCCTCTCCATTTTATAGATAAGG - Intergenic
1023821715 7:43984312-43984334 CCATCCTCATTTTACAGATAGGG + Intergenic
1024661294 7:51497712-51497734 TTATCCCCATTTTAGAAATAAGG + Intergenic
1025143735 7:56486518-56486540 CGATCCCCATTTTATAAGTGAGG + Intergenic
1025146297 7:56507654-56507676 CCAGCCCCATTTATTAAATAGGG + Intergenic
1025247381 7:57327612-57327634 CAATCTCCATGTTATAGATGTGG - Intergenic
1025600753 7:62994440-62994462 CCAGCACCATTTTTTAAATAGGG + Intergenic
1025886392 7:65598133-65598155 CCATCACCATTTATTAAATAGGG + Intergenic
1026609020 7:71840683-71840705 TTATCCCCATTTTATATATAAGG - Intronic
1027331738 7:77103463-77103485 CAATTCCCATGCTATAAATCTGG - Intergenic
1027834521 7:83223327-83223349 CCAGCCCCATTTATTAAATAGGG + Intergenic
1027839556 7:83291694-83291716 CCAGCCCCATTTATTAAATAGGG - Intergenic
1027873862 7:83744986-83745008 CCAGCACCATGTATTAAATAGGG + Intergenic
1028158162 7:87456081-87456103 CCATCCTGAAGTTTTAAATAGGG + Intronic
1028208451 7:88044356-88044378 CCATCTGCATGTTATCATTATGG - Intronic
1028282200 7:88945322-88945344 CCAACACCATTTTTTAAATAAGG + Intronic
1028434120 7:90781650-90781672 CCAGCACCATGTATTAAATAGGG + Intronic
1028544614 7:91984363-91984385 CCAGCGCCATGTATTAAATAGGG + Intronic
1028869741 7:95756370-95756392 ACATCCCCATTTTACAAATGAGG + Intergenic
1029233560 7:99092277-99092299 TTATACCCATTTTATAAATATGG + Intronic
1029349701 7:100004398-100004420 CCATCGCCATGTTTTAAATGCGG - Intergenic
1029691529 7:102185342-102185364 TGATCCCCATTTTATAGATAAGG + Intronic
1029749977 7:102537731-102537753 CCATCCTCATTTTACAGATAGGG + Intergenic
1029767927 7:102636837-102636859 CCATCCTCATTTTACAGATAGGG + Intronic
1029780534 7:102727448-102727470 CCAGCACCATTTTTTAAATAGGG - Intergenic
1029784034 7:102767872-102767894 CAATTCCCATGCTATAAATCTGG + Intronic
1030004945 7:105108679-105108701 TCATCCCCATTTTATAGATGAGG - Intronic
1030549097 7:110935956-110935978 CCATCACCATTTATTAAATAGGG - Intronic
1030651408 7:112119729-112119751 TTATCCCCATTTTATAGATAAGG - Intronic
1030676409 7:112390379-112390401 CCATCCCCATTTTACAGATGAGG - Intergenic
1030680861 7:112432582-112432604 CTATCCCCATTTTACAAATGAGG + Intronic
1030694045 7:112565115-112565137 CCATCCCAATCTTACAGATAAGG + Intergenic
1030890292 7:114991583-114991605 CCAGCACCATGTATTAAATAGGG + Intronic
1030959105 7:115892232-115892254 CCATCACCATTTATTAAATAGGG - Intergenic
1031185571 7:118475625-118475647 TTATCCCCATTTTATAGATAAGG - Intergenic
1031382861 7:121110145-121110167 CCATCCCTATTTTATAGACATGG - Intronic
1031682485 7:124691637-124691659 CCATCCCCATGACATTAATATGG + Intergenic
1031969008 7:128050188-128050210 CCATCCACATGCTAAAAAGAGGG - Intronic
1032548282 7:132761744-132761766 TCATCCCCATTTTATAGATGGGG + Intergenic
1032911323 7:136433793-136433815 CCAACACCATGTATTAAATAGGG - Intergenic
1033189374 7:139262984-139263006 CAGTCCCTATCTTATAAATAAGG - Intronic
1033673465 7:143514814-143514836 CCATACCCATGTTATAGATGAGG + Intergenic
1034382021 7:150705645-150705667 CCATCACCATTTATTAAATAGGG - Intergenic
1035817784 8:2559941-2559963 TCATTCCCATGATATAAATGAGG - Intergenic
1035954168 8:4057767-4057789 CCAGCACCATTTAATAAATAGGG + Intronic
1035980671 8:4367292-4367314 CCAGCTCCATTTTTTAAATAGGG + Intronic
1036991074 8:13594758-13594780 CAATCTCCATATTGTAAATATGG - Intergenic
1037160760 8:15769335-15769357 CCATCACCATTTATTAAATAGGG - Intergenic
1037269037 8:17105158-17105180 TTATCCCCATGTTATAGATGAGG + Intronic
1037744411 8:21631398-21631420 CCATTCCCATTTTACAAATGAGG - Intergenic
1038628032 8:29213369-29213391 TCATCCACATTTTATAAATGAGG + Intronic
1039342597 8:36667634-36667656 CCAGCACCATTTAATAAATAAGG + Intergenic
1039658633 8:39437909-39437931 CCAGCACCATGTAATAAATAGGG - Intergenic
1039914795 8:41852014-41852036 CCATGCCCATTTTATAACTGAGG + Intronic
1039965580 8:42281377-42281399 CCATCCCCATCTTATGGATGAGG + Intronic
1040651316 8:49451869-49451891 CCAGCCCCATTTATTAAATAGGG - Intergenic
1040702921 8:50089163-50089185 CCAGCCCCATTTATTAAATAGGG - Intronic
1040703964 8:50102793-50102815 CCAGCCCCATTTATTAAATAGGG + Intronic
1040773675 8:51012044-51012066 CCAGCACCATTTAATAAATAGGG + Intergenic
1041144247 8:54855660-54855682 TCATGCCCATGTTTTAAATAGGG - Intergenic
1041583522 8:59490366-59490388 CCAACACCATTTAATAAATAAGG + Intergenic
1043025361 8:75060711-75060733 CCAGCCCCATTTATTAAATAGGG - Intergenic
1043223229 8:77692753-77692775 CCTTCCCCATGTTAAAGACATGG - Intergenic
1043268930 8:78304105-78304127 CCATCCCCATTTTACTGATAAGG - Intergenic
1043736782 8:83757937-83757959 CCATCCCAATATTGAAAATAGGG - Intergenic
1043764624 8:84114807-84114829 ATATCCCCATTTTATAACTAAGG + Intergenic
1043970468 8:86523244-86523266 ATATCCCCATTTTATAAATTAGG + Intronic
1043999183 8:86857456-86857478 CTATTCCCATTTTATAAATTTGG - Intergenic
1044405678 8:91823397-91823419 CCAGCACCATGTATTAAATAGGG - Intergenic
1044668248 8:94652832-94652854 TCATCCCCATTTTATCACTAGGG + Intronic
1044844315 8:96365402-96365424 CCATCCCTATTTTATAGATGAGG + Intergenic
1044882601 8:96739695-96739717 CCAGCACCATGTATTAAATAGGG + Intronic
1045698252 8:104835661-104835683 TTAGCCCCATTTTATAAATAAGG - Intronic
1045698891 8:104842938-104842960 CCAACCCCATTTATTAAATAGGG + Intronic
1045796063 8:106045758-106045780 GCATCCCCATTTTAGAAAAAAGG + Intergenic
1045957566 8:107926629-107926651 CCATCACCATTTATTAAATAGGG + Intronic
1046089746 8:109487475-109487497 CCATCCTCTTGTTTCAAATAAGG + Intronic
1046281948 8:112044841-112044863 CCAACACCATTTTTTAAATAAGG - Intergenic
1046809526 8:118517369-118517391 CTATCCCCATTTTATAAATGAGG - Intronic
1047121950 8:121914611-121914633 CTATCCCCATTTTATAGATGAGG + Intergenic
1047318750 8:123758925-123758947 CTATCCCCATTTTACAGATAAGG + Intergenic
1047347985 8:124046955-124046977 CTATCCCCAATTTATAGATAGGG - Intronic
1047748022 8:127859783-127859805 TCATCCCCATGGTACAGATAAGG - Intergenic
1047774643 8:128059755-128059777 CCATCCCCATTTTACACATGGGG + Intergenic
1047797264 8:128270463-128270485 CCATCTCCATTTTACAAATGAGG + Intergenic
1048002681 8:130392568-130392590 TCATCTCCATTTTATAGATAAGG + Intronic
1048098794 8:131324324-131324346 CCATCACCATTTATTAAATAGGG - Intergenic
1048456931 8:134586907-134586929 CCATCCCCATTTTACCAATGAGG - Intronic
1048628389 8:136213012-136213034 CTATCCCTATTTTATAACTAAGG - Intergenic
1048795305 8:138144073-138144095 CTATCCCCCTGTAATAAATAAGG - Intronic
1048849384 8:138629947-138629969 TTATCCACATCTTATAAATAAGG - Intronic
1049367804 8:142249162-142249184 CCTTCCTCATGTTATAAATTGGG - Intronic
1050200760 9:3143172-3143194 CCAACACCATTTAATAAATAGGG + Intergenic
1050206497 9:3201937-3201959 ACATCCCCATTTTATAGGTAAGG + Intergenic
1051100665 9:13517467-13517489 TTATCCCCATTTTATAAATAAGG - Intergenic
1051161411 9:14212837-14212859 CTATCCCCATTTCATAGATAAGG + Intronic
1051197948 9:14584334-14584356 ACATCTCCATTTTATAGATAAGG - Intergenic
1051719308 9:20019413-20019435 CCAGCCCCATTTATTAAATAGGG + Intergenic
1052292137 9:26854276-26854298 CTATCCTCATTTTATAAATGAGG + Intronic
1052415964 9:28177799-28177821 GCATCCCCATTTTATAGATGAGG + Intronic
1053020813 9:34692659-34692681 CCATTCCCATTTTACAAATAAGG - Intergenic
1053291857 9:36885414-36885436 TCCTCCCCATTTTATAGATAAGG - Intronic
1053295071 9:36906855-36906877 CTATCCCCATTTTATAGATGAGG + Intronic
1053350268 9:37409390-37409412 CCATCCCCATCTTACAGATAAGG - Intergenic
1053446906 9:38159594-38159616 CCATCCCCATTTAACAAATGAGG + Intergenic
1054784719 9:69199889-69199911 CCATCCCCATTTTACAAATAGGG - Intronic
1055426423 9:76201380-76201402 CTATCTCCATTTTACAAATAAGG + Intronic
1055677684 9:78681415-78681437 CCATCTCCATTTTTTAATTAGGG + Intergenic
1055962975 9:81837771-81837793 TCATCTCTATGTTATAAATGAGG + Intergenic
1057096393 9:92313895-92313917 CCATCCTCATACTATAAATCTGG + Intronic
1057295914 9:93840582-93840604 CCAGCCCCATTTATTAAATAGGG + Intergenic
1057339909 9:94191153-94191175 CCAGCACCATGTATTAAATAGGG + Intergenic
1057396480 9:94684945-94684967 TCATTCCCATGTTACAGATAAGG + Intergenic
1057750240 9:97786963-97786985 TCATCCCTACTTTATAAATAGGG - Intergenic
1058352510 9:104042540-104042562 CCATCTCCATGTTATAGACTTGG + Intergenic
1058420051 9:104824795-104824817 CCATCCCCATTTTAGAGATGAGG + Intronic
1058551544 9:106120463-106120485 ATATCCCCATTTTATAAGTAAGG - Intergenic
1058779956 9:108323460-108323482 TCTTCTCCAGGTTATAAATAAGG + Intergenic
1059239867 9:112795276-112795298 CTATACCCATTTTATAAATGAGG + Intronic
1059362643 9:113757516-113757538 CTATCCCCATTTTATAGATAAGG + Intergenic
1059643523 9:116240679-116240701 CTATCCCCAGATTATATATAGGG + Intronic
1059757201 9:117304719-117304741 CCAGCACCACGTCATAAATAAGG - Intronic
1059991733 9:119871739-119871761 TTATCCCCATGTTATAAATAGGG + Intergenic
1060131374 9:121103306-121103328 CCATCACCATTTATTAAATAGGG - Intronic
1060482426 9:124024544-124024566 TCATCCCCATTTCATAGATAAGG - Intronic
1060766753 9:126299944-126299966 TCATCCCTATGTTACAAACAAGG - Intergenic
1061226951 9:129285974-129285996 CCATCCCCATTTTATAGACAAGG + Intergenic
1061571418 9:131479800-131479822 CCTTCCCCATGTTAAGAAAAGGG - Intronic
1186444152 X:9611826-9611848 CCATCCCCATTTTATATGTGAGG + Intronic
1186755200 X:12663427-12663449 CCAACACCATGTATTAAATAGGG + Intronic
1187373089 X:18726542-18726564 TCATCTCCATGTTACACATAAGG - Intronic
1187378432 X:18778551-18778573 CCATCCCCATTTTGCAAATTGGG + Intronic
1187482612 X:19671711-19671733 TTATCCCCATTTTATAGATAAGG - Intronic
1187898296 X:24003228-24003250 TTATCCCCATTTTATAGATAAGG - Intronic
1188540143 X:31240804-31240826 TCAATCCCATTTTATAAATAAGG + Intronic
1189027383 X:37410249-37410271 ACAACCCTATGTTGTAAATAGGG + Intronic
1189254777 X:39629468-39629490 CCATTCCCATTTTATAGATGTGG - Intergenic
1189346728 X:40247578-40247600 CCATCCCCATTTTACAGATGGGG - Intergenic
1189624508 X:42881960-42881982 CAAACCCCCTGTTGTAAATAAGG + Intergenic
1189721425 X:43923133-43923155 CCAACACCATTTTTTAAATAGGG + Intergenic
1189916323 X:45859229-45859251 CCTACTCCATGGTATAAATAGGG + Intergenic
1190489404 X:50966347-50966369 CCATCTCCATTTTACAAATGAGG - Intergenic
1190544703 X:51513553-51513575 CCAGCACCATTTTTTAAATAGGG + Intergenic
1190601925 X:52101807-52101829 CCAGCACCATTTAATAAATACGG + Intergenic
1191176408 X:57506635-57506657 CCAGCACCATTTTTTAAATAGGG - Intergenic
1191188328 X:57637579-57637601 CCAGCACCATTTTTTAAATAGGG - Intergenic
1191651558 X:63543834-63543856 CCAGCACCATTTTTTAAATAGGG - Intergenic
1191774479 X:64798591-64798613 CCAGCACCATTTTTTAAATAGGG + Intergenic
1191984245 X:66961336-66961358 CCATCACCATTTATTAAATAAGG + Intergenic
1192157935 X:68760283-68760305 CCATCCCCATTTTACAGATGAGG - Intergenic
1192160230 X:68780584-68780606 CCAGCACCATGTATTAAATAGGG - Intergenic
1192549596 X:72043457-72043479 CCATCCCCATTTTACACACAAGG + Intergenic
1192837600 X:74818380-74818402 CCATCACCATTTTTTGAATAGGG - Intronic
1192879345 X:75266347-75266369 CCAGCACCATGTATTAAATAGGG - Intergenic
1192943154 X:75934766-75934788 CCATCACCATTTGTTAAATACGG - Intergenic
1193213199 X:78832703-78832725 TTATCCCCATTTTATACATAAGG + Intergenic
1193623609 X:83788973-83788995 CCAACACCATGTATTAAATAGGG - Intergenic
1193843059 X:86433058-86433080 CCATCCCCATTTTACAGATTAGG - Intronic
1194262452 X:91714219-91714241 TCATTCCCATTTTACAAATAAGG + Intergenic
1194545568 X:95229597-95229619 CCAGCACCATTTTTTAAATAGGG - Intergenic
1195434071 X:104822482-104822504 CCAACACCATTTAATAAATAGGG + Intronic
1195521613 X:105836811-105836833 TTAGCCCCATTTTATAAATAAGG - Intronic
1195579775 X:106488358-106488380 CCAACCCCATTTATTAAATAGGG + Intergenic
1196513412 X:116541787-116541809 CCACCACCATTTTTTAAATAGGG + Intergenic
1197269491 X:124410277-124410299 CCATCACCATTTATTAAATAGGG - Intronic
1197283039 X:124560431-124560453 TCAACCCCATTTTAGAAATAAGG + Intronic
1197450911 X:126616220-126616242 TCATCCCTATATTACAAATAAGG + Intergenic
1197519903 X:127484725-127484747 CCAGCACCATGTATTAAATAGGG + Intergenic
1197547508 X:127843335-127843357 CCAGCACCATGTATTAAATAGGG - Intergenic
1197782967 X:130175117-130175139 TCATTCCCATTTTATAGATAAGG + Intronic
1198050526 X:132948402-132948424 CTATTGCCAAGTTATAAATATGG + Intronic
1198464510 X:136892779-136892801 CTATCCCCATTTTGTAAATGAGG - Intergenic
1198653978 X:138893449-138893471 CCACCCCCATTTTAAAGATAGGG + Intronic
1198878202 X:141250061-141250083 CCATCACCATTTATTAAATAGGG + Intergenic
1198960645 X:142178969-142178991 CCATCACCATTTATTAAATAGGG + Intergenic
1200331277 X:155300811-155300833 CCAGCACCATTTAATAAATAGGG + Intronic
1200757194 Y:7001059-7001081 TCATCCCCATTTTATAAGTGAGG + Intronic
1201246769 Y:12012353-12012375 CCAGCACCATGTATTAAATAGGG - Intergenic
1201535428 Y:15042682-15042704 CCAACACCATTTTTTAAATAGGG + Intergenic
1201535991 Y:15048924-15048946 CCAGCACCATTTTTTAAATAGGG + Intergenic
1201553077 Y:15239210-15239232 AAATCTCCATGTTAAAAATAAGG - Intergenic
1201717486 Y:17062156-17062178 CCAGCACCATTTTTTAAATAGGG + Intergenic
1201721181 Y:17099019-17099041 CCAGCACCATTTTTTAAATAGGG + Intergenic
1201909171 Y:19115924-19115946 CCATCACCATTTATTAAATAGGG + Intergenic
1201946743 Y:19518781-19518803 CCATCACCATTTGTTAAATAGGG - Intergenic