ID: 1157349831

View in Genome Browser
Species Human (GRCh38)
Location 18:46874483-46874505
Sequence CCCTGGCACTCACCTTCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157349824_1157349831 11 Left 1157349824 18:46874449-46874471 CCAGCTATTAGAAATAAGATGGG No data
Right 1157349831 18:46874483-46874505 CCCTGGCACTCACCTTCATCAGG No data
1157349822_1157349831 12 Left 1157349822 18:46874448-46874470 CCCAGCTATTAGAAATAAGATGG No data
Right 1157349831 18:46874483-46874505 CCCTGGCACTCACCTTCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157349831 Original CRISPR CCCTGGCACTCACCTTCATC AGG Intronic