ID: 1157350237

View in Genome Browser
Species Human (GRCh38)
Location 18:46877605-46877627
Sequence TTGAATATGAATAATTAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 6, 3: 36, 4: 372}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157350237_1157350240 -1 Left 1157350237 18:46877605-46877627 CCTACCTAATTATTCATATTCAA 0: 1
1: 0
2: 6
3: 36
4: 372
Right 1157350240 18:46877627-46877649 ATTTTAAACAGTAGCCAGTTGGG 0: 1
1: 10
2: 12
3: 37
4: 337
1157350237_1157350239 -2 Left 1157350237 18:46877605-46877627 CCTACCTAATTATTCATATTCAA 0: 1
1: 0
2: 6
3: 36
4: 372
Right 1157350239 18:46877626-46877648 AATTTTAAACAGTAGCCAGTTGG 0: 2
1: 10
2: 6
3: 46
4: 329

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157350237 Original CRISPR TTGAATATGAATAATTAGGT AGG (reversed) Intronic
903171947 1:21559678-21559700 TGAAATATGAAAAATTAGCTGGG - Intronic
905026048 1:34850260-34850282 TTAAATCTGAATAATTAGAAGGG + Intronic
906562021 1:46765301-46765323 ATGAAGAGGGATAATTAGGTAGG - Intronic
907754444 1:57297305-57297327 TTGAATATGAATGGTAAGTTAGG + Intronic
907930912 1:58999182-58999204 TTGAAGATGAGGAATTAGGCTGG + Intergenic
908065677 1:60401515-60401537 TGGATTATGAATAATGAGATGGG - Intergenic
908286926 1:62615579-62615601 TTGAATATGAATACTGATTTAGG - Intronic
908295757 1:62711491-62711513 TTCAAAATGAATAATTTTGTTGG - Intergenic
908374375 1:63519706-63519728 TTGATTATAAAGAAGTAGGTGGG - Intronic
911483548 1:98476052-98476074 TTGACTATGAATTATTGGGAAGG - Intergenic
911596511 1:99804209-99804231 AAGAATATGAATAATTATGGAGG - Intergenic
912033666 1:105283340-105283362 TTGAGTAGGAAATATTAGGTTGG - Intergenic
912562568 1:110561113-110561135 TTGAAAATGAATCATGAGGGTGG - Intergenic
913031152 1:114904030-114904052 TTGAAAATGAATAATAAAGTTGG - Intronic
913356383 1:117927276-117927298 CTTAATATGAATAATTGGATTGG + Intronic
913367243 1:118053401-118053423 ATGCATAGGAATAATTAAGTAGG + Intronic
913572875 1:120138996-120139018 TTTAAAATAAATAAATAGGTCGG - Intergenic
913679896 1:121179665-121179687 TAAAATATGAAAAATTAGCTGGG + Intronic
914031731 1:143967315-143967337 TAAAATATGAAAAATTAGCTGGG + Intronic
914157713 1:145100650-145100672 TAAAATATGAAAAATTAGCTGGG - Intronic
914895602 1:151669124-151669146 TGGAATCTGAAAAATTAAGTAGG - Intronic
915710043 1:157887522-157887544 TTGAATAAGAATGATTAGGGTGG - Intronic
916086262 1:161272100-161272122 ATGAATATGTACAATTAGGCAGG - Intronic
916424236 1:164665581-164665603 TTTAATCTGAAAAATTAGGCTGG - Intronic
916561556 1:165938044-165938066 GTCAATCTGACTAATTAGGTAGG - Intergenic
917953988 1:180073168-180073190 TTCAATATTATTAATTAAGTGGG + Intronic
920467207 1:206198201-206198223 TAAAATATGAAAAATTAGCTGGG + Intronic
921009228 1:211124481-211124503 TAAAATATGAAAAATTAGCTGGG + Intronic
921139059 1:212287957-212287979 TTGAATATTAAACATTTGGTTGG + Intronic
921799635 1:219387226-219387248 ATGAACATTAATAATTAGGTAGG - Intergenic
922917277 1:229269324-229269346 TGGAAAATGAAGACTTAGGTAGG - Intergenic
923312570 1:232749104-232749126 TTGAATATGGCTAATTAGGCGGG - Intergenic
924133435 1:240937101-240937123 TTGAATATGGCTAATTAGGTGGG - Intronic
1063326366 10:5107470-5107492 CTGAATATGGATAATTAGGGTGG - Exonic
1064012589 10:11746637-11746659 TTAAATATAAAAAATTGGGTCGG + Intronic
1064520616 10:16197084-16197106 TTGAATATGGCTAATTAGGCGGG - Intergenic
1064615497 10:17151043-17151065 TTAAATCTAAATTATTAGGTTGG + Intronic
1065121093 10:22530919-22530941 TTGAATATTAAAAACTTGGTGGG - Intergenic
1066505943 10:36043259-36043281 TTGAAAATGAATAATAGAGTTGG - Intergenic
1066604005 10:37141407-37141429 CTAAATATGAAAAATTAGCTGGG + Intronic
1067699641 10:48560138-48560160 TTGAAATAGAATAATTAAGTTGG - Intronic
1068746502 10:60537518-60537540 GTGACTCTGAATAATTAGGTGGG - Intronic
1069346267 10:67473972-67473994 GTAAATATTAATAATTAGGAAGG + Intronic
1069466368 10:68642959-68642981 CTCAATAAGAAAAATTAGGTTGG + Intronic
1070201519 10:74210166-74210188 TTGAAAATAAAAAATTAGCTGGG + Intronic
1070584543 10:77752592-77752614 TTGAAAATGAAGACTAAGGTAGG + Intergenic
1070706657 10:78644095-78644117 TTGTATATGAATACTTAGGTGGG + Intergenic
1072546997 10:96447585-96447607 TGGAATTTGAATAACTGGGTGGG + Intronic
1073122093 10:101128367-101128389 TTTAAAATGTATAATTCGGTGGG + Intronic
1073527373 10:104196783-104196805 GTGAATATGAAAAAGTAGATTGG + Intronic
1073885964 10:108039958-108039980 TTGAATAGGGTCAATTAGGTGGG + Intergenic
1074608613 10:114999622-114999644 TTGAATTTGAATTTTAAGGTTGG + Intergenic
1075330776 10:121572456-121572478 TTAAATATAAAAAATTAGCTGGG + Intronic
1076295768 10:129383116-129383138 TCTAATATAAATAATAAGGTTGG + Intergenic
1077786158 11:5385584-5385606 TAAAAAATGAATTATTAGGTTGG + Intronic
1078728056 11:13949922-13949944 TGGAATATGGACACTTAGGTTGG - Intergenic
1079748479 11:24163351-24163373 TGGAATCTGAATAATGAGTTAGG + Intergenic
1080319701 11:30992454-30992476 TTGAATATGAAAAGTCAGGTTGG - Intronic
1080986687 11:37475678-37475700 TTGAAAATTATTTATTAGGTAGG + Intergenic
1081114242 11:39178654-39178676 TTGACTATGAATAGTGATGTAGG + Intergenic
1086224359 11:84489780-84489802 TTGAATATGGATGATTAGGAAGG - Intronic
1088280235 11:108127710-108127732 GTAAATATGACTAATGAGGTAGG + Intronic
1089658158 11:119967120-119967142 TGGAACAAGAATTATTAGGTTGG + Intergenic
1089876491 11:121726874-121726896 CTGAATTTGAATAAATAAGTAGG + Intergenic
1090295324 11:125582626-125582648 TTGAATATGTATAATGGGATCGG - Intronic
1090642252 11:128739646-128739668 TTGAATTTGATTTATTAGGGGGG + Intronic
1093120596 12:15266619-15266641 TTCAACATGAAGAATTGGGTTGG + Intronic
1093544393 12:20329276-20329298 GTGCATATGAATATTTACGTGGG - Intergenic
1093677011 12:21954322-21954344 TTGAATAGGAATAATGAGAGTGG + Intergenic
1093960848 12:25271180-25271202 ATGAATATGATGAATTTGGTGGG + Intergenic
1093974519 12:25406532-25406554 TTGAATAAGAGTGATAAGGTTGG - Intergenic
1095829252 12:46566625-46566647 TTTAATATAAAAAATTAGCTGGG + Intergenic
1097358507 12:58630551-58630573 ATGAACATGAAGAATTAAGTAGG - Intronic
1097509371 12:60517736-60517758 TTGAATATGGTTAACTAGGCAGG - Intergenic
1097575762 12:61390498-61390520 TTAAATATGCATAAATAGGCAGG + Intergenic
1097789235 12:63796674-63796696 TTGAATATGATGAATTATTTTGG + Intronic
1097815374 12:64068116-64068138 TAAAATATGAAAAATTAGCTGGG + Intronic
1098354186 12:69595021-69595043 TTGAAAATGAATGAATAGGTTGG + Intronic
1098637938 12:72807450-72807472 CTGAAAATGAAAAATTATGTTGG + Intergenic
1098702215 12:73644084-73644106 TTGAGAATAAATAATTATGTTGG + Intergenic
1099912055 12:88846214-88846236 TTAAAAAAAAATAATTAGGTGGG - Intergenic
1100483487 12:95002701-95002723 TTTAGTATGAATAATTGGATTGG - Intronic
1105558621 13:21469493-21469515 TTTAAAATGCATCATTAGGTTGG + Intergenic
1105748461 13:23399514-23399536 TTGAATATGGCTAATTAGGTGGG - Intronic
1105862864 13:24432139-24432161 TAGAATGTAAATAATCAGGTCGG + Intronic
1106005042 13:25761711-25761733 TTAAATATAAATAATTTGTTTGG + Intronic
1106280165 13:28260094-28260116 TTGATTATGAAAAATTAGTCAGG + Intronic
1106490754 13:30219314-30219336 TTGAAAATGAATAGATAGATAGG - Intronic
1106791570 13:33160960-33160982 TTGAATATGAATGTTTAGAGTGG + Intronic
1106913957 13:34491671-34491693 TTGATTATTAATTATTAGGTGGG + Intergenic
1107021104 13:35752539-35752561 TTAAAGATGAATTATTAGGTTGG + Intergenic
1107105001 13:36633594-36633616 TTCAATATGAATTATTATGAAGG - Intergenic
1108050706 13:46435214-46435236 GTGGATATGAAGAATCAGGTAGG - Intronic
1108434553 13:50388945-50388967 TTGAATCTGAATATTAATGTTGG + Intronic
1108822143 13:54365527-54365549 TTGAATAAGAATGATTATATAGG - Intergenic
1108841242 13:54618186-54618208 TTGAAAATAAAAAATAAGGTTGG - Intergenic
1108886042 13:55183089-55183111 TTGAATATGCATATTTATATAGG + Intergenic
1109543282 13:63808838-63808860 GTGGATATGAAGAATCAGGTAGG - Intergenic
1109810363 13:67505940-67505962 TTGAATATGAATTGTTAGCTTGG + Intergenic
1110608477 13:77461262-77461284 TTAAAAATGAATAAATCGGTCGG - Intergenic
1111161883 13:84405623-84405645 TTTAAAATGAAAAATTAGTTAGG - Intergenic
1111634581 13:90887545-90887567 TGGAATCTCCATAATTAGGTAGG - Intergenic
1111775878 13:92661132-92661154 TTTAATAATAATAATTAGCTGGG + Intronic
1112336062 13:98517169-98517191 TTTAATATGAATTATTATGATGG - Intronic
1112801916 13:103121052-103121074 TTTAAAATGTATAATTATGTAGG + Intergenic
1112949931 13:104981257-104981279 TTGCATGTGAATTATTATGTTGG + Intergenic
1113008319 13:105733965-105733987 TTGAATATGCATAACAAGATGGG + Intergenic
1114300662 14:21374027-21374049 TGGAATATAAAAAATTAGTTTGG - Intronic
1114336451 14:21696120-21696142 TTGAAAAAGAAAAATAAGGTGGG + Intergenic
1114641719 14:24227796-24227818 TTGAAAATGAATCATTCGGCTGG + Intronic
1114983873 14:28200837-28200859 TTAAATATAAAAACTTAGGTAGG - Intergenic
1115319329 14:32062183-32062205 GTGAATATGAAAAGTTTGGTAGG + Intergenic
1115400786 14:32957666-32957688 TAGAAAATGAATACTTAGGCCGG - Intronic
1115540948 14:34420899-34420921 TTGAATAGGGCTAATTAGGCAGG + Intronic
1116053237 14:39831298-39831320 CTGAATTGGAATAAGTAGGTTGG - Intergenic
1117312346 14:54540540-54540562 GTAAATATGAAGAATTTGGTAGG + Intergenic
1117809556 14:59532379-59532401 TTGAGTTTGAATAAGTAGGCAGG - Intronic
1118151966 14:63199452-63199474 TTGCATGTTAATAATAAGGTAGG + Intergenic
1120110091 14:80543837-80543859 TTGAATATGTAAAATGAAGTAGG - Intronic
1120444246 14:84573885-84573907 TTGCATAATAATAATAAGGTGGG - Intergenic
1120563644 14:86028218-86028240 TTAAATATGCATACTTAGGGTGG - Intergenic
1122658134 14:103275743-103275765 TTTAAAAAGAATAATAAGGTGGG - Intergenic
1122678430 14:103436772-103436794 TTAAATATGTATAATCAGGCTGG - Intronic
1123817574 15:23995407-23995429 TTGAATATGGTTAATTAGGCAGG + Intergenic
1124709465 15:31994022-31994044 TTGAAAAAGAATAATAAAGTGGG - Intergenic
1127434611 15:58944711-58944733 TTGAATATTAAAAATTTGGCTGG - Intronic
1127744300 15:61949899-61949921 TTGAACATGCATAATCAGCTTGG - Intronic
1129369374 15:75079095-75079117 TTAAATATGCCTAATTAGGCTGG - Intronic
1129583309 15:76835647-76835669 TTGAATAGGAATGGTGAGGTGGG - Intronic
1131570817 15:93533882-93533904 TTGAAAATGTATAATTATGGGGG - Intergenic
1132478855 16:155901-155923 ATGAATACAAATAATAAGGTGGG + Intronic
1133068286 16:3226349-3226371 ATTAAAAAGAATAATTAGGTCGG - Intronic
1135677628 16:24430517-24430539 TAAAATATAAATAATTAGCTGGG + Intergenic
1136475193 16:30508507-30508529 CTGTATAAGAATAATTCGGTTGG - Intronic
1136524420 16:30819646-30819668 TTGAATAAGAATAATAAGAATGG + Intergenic
1136555323 16:31004218-31004240 TTGCATAAGTATAATTATGTTGG - Intronic
1137973814 16:53012995-53013017 TAGAATATATATAATTAGGAGGG + Intergenic
1138145691 16:54609004-54609026 TTGAATAGGAATAGTTAGAGTGG - Intergenic
1138469662 16:57223609-57223631 CTGAATATAAAAAATTAGCTGGG + Intronic
1140747240 16:77991900-77991922 TTGAATATGGCTAATTAGATGGG - Intergenic
1141332671 16:83126377-83126399 TTGAATATGGCTAATTAGGCAGG + Intronic
1141899323 16:86980226-86980248 TGGATTATGAATAGATAGGTAGG + Intergenic
1143243875 17:5467222-5467244 TTGAAAAAGATTAATTAGGCAGG - Intronic
1143688777 17:8542370-8542392 TTAAACATTACTAATTAGGTAGG + Intronic
1145354346 17:22126118-22126140 TTGCATATGCATATTTAGGTTGG + Intergenic
1149520106 17:57312331-57312353 TTGAAAAAGAAAAATTAGGAAGG - Intronic
1149788850 17:59459854-59459876 TTGAAAATGAATATTTAGCTGGG - Intergenic
1151399262 17:73844923-73844945 TTGAAAGTGCATAGTTAGGTGGG - Intergenic
1154099786 18:11461461-11461483 TTGAAAAAGAATAATAAAGTGGG - Intergenic
1155164256 18:23219872-23219894 ATGAATATTAATATTCAGGTAGG - Intronic
1156178814 18:34579279-34579301 TAAAATATGAATAGATAGGTAGG + Intronic
1156589849 18:38474054-38474076 TAGAATATGAATATATATGTGGG + Intergenic
1156856415 18:41786849-41786871 TTGGATATGAATTATTGGGAGGG + Intergenic
1156999522 18:43508453-43508475 TTGAATATGGCTAATTAGGTGGG + Intergenic
1157350237 18:46877605-46877627 TTGAATATGAATAATTAGGTAGG - Intronic
1158238511 18:55348776-55348798 TTGAATATGAAGCATAAGGAGGG + Intronic
1158681368 18:59570197-59570219 TCTGATATGAATAATTAAGTAGG + Intronic
1158829369 18:61260908-61260930 TTGAATGTGAATAATTAAATAGG + Intergenic
1159808120 18:72980435-72980457 TTGAATATACATAATTACTTTGG + Intergenic
1162816452 19:13198126-13198148 TTAAATATAAATATTTAGGTGGG - Intergenic
1164471539 19:28540012-28540034 TTGAATAAGAATAATGAGAGTGG - Intergenic
1164647203 19:29867793-29867815 AAAAATATGAAAAATTAGGTAGG - Intergenic
1165359234 19:35324597-35324619 AACAATATGAATAATTAGCTGGG + Intronic
1165674125 19:37706848-37706870 CTAAATATGAAAAATTAGCTAGG - Intronic
1168031638 19:53684378-53684400 TTAAAAATGCAAAATTAGGTGGG + Intergenic
925259072 2:2514022-2514044 TAGAATATGTATAATTAATTTGG - Intergenic
925643299 2:6008072-6008094 TTGAATATCCATAATGAGTTAGG - Intergenic
928336156 2:30400228-30400250 TTGAAAAGGAGTAATGAGGTTGG - Intergenic
928467425 2:31535415-31535437 TTGAATATGGACAATTCTGTTGG + Intronic
929554590 2:42917762-42917784 TCGAAGATGAATAATGAGGTAGG + Intergenic
929566186 2:42986663-42986685 TAGTATATGAATAATTAAGCAGG + Intergenic
930224711 2:48780501-48780523 TTTAAAATGTATAATTTGGTGGG - Intergenic
930902344 2:56522665-56522687 TTGAATATTAACAAGTAGTTTGG + Intergenic
931735723 2:65191834-65191856 TTGAAAATGAATAATAAAATGGG + Intergenic
932975848 2:76598588-76598610 GTGAATATTAATGACTAGGTTGG + Intergenic
933338384 2:80989303-80989325 TTTAACATGTATCATTAGGTTGG - Intergenic
935461871 2:103346121-103346143 TTAAATATGATAACTTAGGTTGG + Intergenic
935871556 2:107456035-107456057 ATGAATTTGAATAAGAAGGTGGG - Intergenic
936272780 2:111063481-111063503 GTTAATATGAAGAATTAGATTGG - Intronic
936398203 2:112145934-112145956 TTGAAAAGGAATAATAAAGTTGG - Intronic
936705691 2:115070985-115071007 TTGAATATTAATATTTATGAAGG + Intronic
939210314 2:139166492-139166514 TTGAATATTAATAATTTTCTTGG - Intergenic
939753703 2:146082739-146082761 TTGACTATGTAATATTAGGTTGG - Intergenic
942601844 2:177648607-177648629 TTGAAAAAGAATAATAAGGAAGG + Intronic
942809304 2:179978222-179978244 TTGAATAATAATACTTATGTTGG + Exonic
943046868 2:182870237-182870259 TAGTATATTAATAATTTGGTGGG - Intergenic
944660855 2:201920424-201920446 TTAAATATAAAAAATGAGGTGGG + Intergenic
945093605 2:206198996-206199018 TTAAATATGAAGAACTAGTTGGG - Intronic
945478920 2:210321596-210321618 TAAAATATGAAAAATTAGTTGGG + Intergenic
946221541 2:218231937-218231959 TTGTATATAAATAAATAAGTAGG + Intronic
947615897 2:231556807-231556829 TAAAATATGAAAAATTAGCTGGG - Intergenic
948744274 2:240074920-240074942 TTGAAAAAGAACAATGAGGTGGG - Intergenic
1169665136 20:8025182-8025204 TTGAAAACGAATAATGATGTAGG + Intergenic
1170997589 20:21378210-21378232 TTGGATATGAGTAATAATGTCGG + Intronic
1172594407 20:36140579-36140601 TTGAATATTAATATTCTGGTTGG + Intronic
1174966311 20:55220155-55220177 ATAAATATAAATAAGTAGGTAGG - Intergenic
1176927694 21:14769875-14769897 TTGAATTTGATTTATTAGGTTGG - Intergenic
1177294653 21:19159010-19159032 TTGAAGATGACTTATAAGGTTGG + Intergenic
1177532691 21:22382677-22382699 TTAAATATTCATAATTATGTGGG + Intergenic
1177838284 21:26209772-26209794 TTAAATATGTATATTCAGGTGGG - Intergenic
1178193932 21:30320760-30320782 TTGAATATAGATAATGAAGTTGG + Intergenic
1178463974 21:32829610-32829632 TTAAAGATGAAAAATTAGCTGGG - Intergenic
1179056573 21:37941579-37941601 TTGAGTATGAAGAATAAAGTTGG - Intergenic
1181097529 22:20516018-20516040 TTAAAAATAAATAAGTAGGTTGG + Intronic
1181375248 22:22453004-22453026 TTGAGTATGGCTAATTAGGTGGG - Intergenic
1181376060 22:22459190-22459212 TTGAATATGGCTAATTAGGTGGG - Intergenic
949252474 3:2003462-2003484 CAGAAAATGCATAATTAGGTAGG + Intergenic
952521984 3:34170107-34170129 TTCAATATTAATAAATTGGTAGG - Intergenic
952569310 3:34694992-34695014 ATGAACTTGAATAATTTGGTGGG + Intergenic
953039971 3:39247480-39247502 TTGTCTATGAAGAGTTAGGTAGG - Intergenic
953973009 3:47361672-47361694 TTTAAAATGAATAAATAAGTAGG + Intergenic
956082599 3:65574659-65574681 TTGAAAATGAAGAATAAAGTTGG + Intronic
956964131 3:74439208-74439230 TTCAATATGTACAATTAGGCTGG + Intronic
957751038 3:84416083-84416105 TTGAATCTGAAAAATGATGTGGG - Intergenic
957988982 3:87607366-87607388 TTGAATATGGCTAATTAGACAGG + Intergenic
957990085 3:87615866-87615888 TTGAATATAGTTAATTAGGCAGG + Intergenic
958020144 3:87984621-87984643 CTGAATACAAATAATTAGCTGGG - Intergenic
958656804 3:97012481-97012503 ATGAATATACATAATTAGTTGGG - Intronic
959240792 3:103791045-103791067 TTGAATATGTAGATTTATGTGGG + Intergenic
959394376 3:105819146-105819168 GTAAATATGAATATTTAAGTTGG + Intronic
959986073 3:112572481-112572503 TTGAATTTGCATAATTTTGTTGG - Intronic
960703017 3:120455479-120455501 TGGAAAATGAGTAATTTGGTGGG + Intergenic
960912581 3:122664055-122664077 ATGAATTTAAATAATTAGGGTGG + Intergenic
961337336 3:126188974-126188996 TTGCATATGAATAAATACGTCGG - Intronic
961706794 3:128793182-128793204 CTAAATATGAAAAATTAGCTGGG - Intronic
964939495 3:162138562-162138584 TGGTATATGAATAGTTGGGTGGG + Intergenic
965134672 3:164747362-164747384 TTGAATATGAAAAATGAGGCAGG + Intergenic
965636464 3:170787010-170787032 TGGAATAAGAAGAATGAGGTTGG + Intronic
966472672 3:180309118-180309140 TGGAATATGAATATTTAATTAGG + Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
968039859 3:195579753-195579775 TGGGAGATGCATAATTAGGTGGG - Intronic
970160558 4:13184498-13184520 TTTATTATGTATTATTAGGTTGG - Intergenic
971694480 4:29881636-29881658 TTGAAAATGAATAATTGTGTAGG - Intergenic
973041944 4:45478519-45478541 TTAAATATGAAAATTTAGGATGG - Intergenic
973810544 4:54565834-54565856 TTAAATATAAAAAATTAGCTGGG + Intergenic
974605230 4:64143174-64143196 CTGTATAGGAATAATTAGGTTGG + Intergenic
975307102 4:72862836-72862858 TTGAAAATGAAGAATAAAGTGGG + Intergenic
976336536 4:83894338-83894360 TTGGCTTAGAATAATTAGGTGGG + Intergenic
976336841 4:83898407-83898429 TGGAATATCAAAAATTATGTTGG - Intergenic
976336842 4:83898427-83898449 TTAAATATCAAAAATTATGTTGG - Intergenic
977309660 4:95369800-95369822 TAAAATATGAATAAATAGGAAGG + Intronic
977388307 4:96373443-96373465 CAAAATATGAATAATTAGTTAGG - Intergenic
977437478 4:97017777-97017799 TTGAACAAAAATAATGAGGTTGG - Intergenic
978041404 4:104068130-104068152 TTGATTCTGAATCACTAGGTTGG - Intergenic
978753620 4:112280508-112280530 TAAAATATGAAAAATTAGCTGGG - Intronic
978948742 4:114530085-114530107 ATGGAGATGAAGAATTAGGTGGG + Intergenic
979012684 4:115391359-115391381 TTGAATAGGAATGATGAGGGAGG - Intergenic
979134277 4:117089425-117089447 TTCCATATGAATCATTAGGGAGG - Intergenic
979344142 4:119566367-119566389 TTGAATAGGAATAATTCAGTAGG + Intronic
979805293 4:124962655-124962677 TTGCATATGAATAAGCATGTAGG + Intergenic
980658169 4:135816886-135816908 TTGAAAATAAATAACTAAGTTGG + Intergenic
981301843 4:143196007-143196029 TTAAATATAAGTAATTAGGTTGG + Intronic
981568089 4:146122192-146122214 TGGAAGATGAACTATTAGGTTGG + Intergenic
983720721 4:170848297-170848319 TTAAATCTTAATTATTAGGTTGG - Intergenic
983742879 4:171157414-171157436 TGAAATATGAAAAATAAGGTGGG + Intergenic
984228792 4:177068087-177068109 TTGAAAATGAGTAATTCTGTAGG + Intergenic
984259903 4:177432593-177432615 ATCAATATGACTTATTAGGTTGG - Intronic
984283075 4:177695971-177695993 TAGATTAAGAATGATTAGGTCGG + Intergenic
984934319 4:184876988-184877010 TTAAATATTAATAATTTGGCTGG - Intergenic
985222405 4:187721992-187722014 TTGAAAATAAATAAATAGGCCGG - Intergenic
986445184 5:7815174-7815196 TTGAATAACTATACTTAGGTTGG - Intronic
988476301 5:31589083-31589105 TTGAACAGGGCTAATTAGGTGGG + Intergenic
989023278 5:37035818-37035840 TTGATTATGAAAGATTAGATTGG + Intronic
989081420 5:37626159-37626181 TTGAATAAGAATACTGAGATTGG + Intronic
989747462 5:44847131-44847153 ATGAATATAAATAACCAGGTGGG + Intergenic
990257366 5:53984810-53984832 TTGAAAATGAAGAAATAAGTGGG - Intronic
990645510 5:57839294-57839316 ATGAATATAAATAAATATGTGGG + Intergenic
991129781 5:63109255-63109277 ATGAATATGAATAATAAAATAGG + Intergenic
991348635 5:65697014-65697036 TTTAAAATGAATATTTAGATTGG + Intronic
991356549 5:65775017-65775039 TAAAATATGACTAATTAGGCTGG - Intronic
993232469 5:85254043-85254065 ATAAATATGTATAATTGGGTTGG - Intergenic
993346077 5:86784211-86784233 ATAAATATTAATAATTAGGCAGG + Intergenic
994099064 5:95875027-95875049 TTTAAAATGAAAAAATAGGTTGG - Intergenic
995801674 5:116003322-116003344 TTAATTATGATAAATTAGGTTGG + Exonic
998921842 5:147077718-147077740 TTTAAAAAGAAGAATTAGGTTGG - Intronic
999830077 5:155310380-155310402 TTGGACATGAATTATTGGGTTGG + Intergenic
1000498495 5:162017513-162017535 TTGAATGTGAGTAATGAGTTAGG + Intergenic
1000646151 5:163762677-163762699 TTGAATATGAAGAAGAATGTTGG + Intergenic
1001786416 5:174417855-174417877 TTGTATATGATTATATAGGTGGG - Intergenic
1002150706 5:177227734-177227756 TTAAATATGAATATTTAGGCCGG - Intronic
1004192647 6:13477647-13477669 TTTAATAATAATAACTAGGTTGG + Intronic
1004778172 6:18872541-18872563 TTCTATATGAATATTTAGTTGGG + Intergenic
1006099035 6:31674266-31674288 CTAAATATGAAAAATTAGCTGGG + Intergenic
1009614183 6:65984013-65984035 TTGAAAATGAATAATAAATTTGG + Intergenic
1009632639 6:66218392-66218414 TTGAAAATGAAGAATTAGTGAGG + Intergenic
1009728721 6:67570773-67570795 TTGAAAATGAAGAATAAAGTTGG + Intergenic
1010100492 6:72100494-72100516 ATGAATATGAATAACTTGTTAGG + Intronic
1012294164 6:97499136-97499158 TTGAATATCCATAATATGGTGGG + Intergenic
1012761269 6:103305389-103305411 TAGAATATAAATAATAAGCTGGG - Intergenic
1013784773 6:113767573-113767595 TTAAAAATAAATAAGTAGGTTGG + Intergenic
1014215627 6:118750152-118750174 TTGAATAGAAATAATAATGTAGG - Intergenic
1014263870 6:119252171-119252193 TTTAAGATTAATGATTAGGTGGG + Intronic
1014874304 6:126637884-126637906 TTAAATATGACTAAGCAGGTTGG - Intergenic
1015113875 6:129624010-129624032 TTGAATATAATTAAGAAGGTAGG + Intronic
1015335561 6:132033802-132033824 TTGAATATGAATATTCGTGTGGG + Intergenic
1015604917 6:134944368-134944390 TTGAATATTCAAAATTAGGGTGG - Intronic
1015722132 6:136253573-136253595 TTGAAAATGAATAATTAGGCCGG + Intergenic
1016876093 6:148866617-148866639 TGGAAAATGAATGTTTAGGTAGG - Intronic
1016961828 6:149680504-149680526 TTGAATATTAAGAAATAGCTTGG + Intronic
1017695806 6:157014752-157014774 TTAAATATGAATCTTTAGATTGG + Intronic
1018550601 6:164993185-164993207 TTTAATTTGAATTATTAGTTAGG - Intergenic
1020054043 7:5104579-5104601 TTGACTCTGATTAATTAGCTGGG - Intergenic
1020641484 7:10759504-10759526 TTGAATATGGCTACTTAGGTGGG + Intergenic
1020973098 7:14971521-14971543 TAGAATATGAAAAATTGGCTAGG - Intronic
1022147860 7:27564597-27564619 TTGAATGTGATTAATAAAGTTGG - Intronic
1022416319 7:30180512-30180534 TTGAATATGTACTATAAGGTGGG + Intergenic
1023304413 7:38809186-38809208 TTAAATATGTATAATTTGGCTGG + Intronic
1024833703 7:53491576-53491598 TTGAATTGGAAATATTAGGTAGG - Intergenic
1025821844 7:64969516-64969538 TTGAATAGGAATATTTAGAGTGG + Intergenic
1026001175 7:66559687-66559709 CTTAATAAGAATAAATAGGTCGG + Intergenic
1026989291 7:74574296-74574318 TTAAATAAGAATAATGAGGCCGG - Intronic
1027889098 7:83947875-83947897 TTAAATATGAATACATAGATAGG + Intergenic
1027937173 7:84621844-84621866 TTGAATATCAATAATTTACTAGG - Intergenic
1028476638 7:91261016-91261038 TTGAATGTGGATAATTAGCAGGG - Intergenic
1028557636 7:92140534-92140556 TTGAAAATGAATAAGAAAGTTGG - Intronic
1028715998 7:93969495-93969517 GTGGATATGAATAATCAGGAAGG + Intronic
1030537084 7:110781794-110781816 TAAAATAAGTATAATTAGGTAGG - Intronic
1030740890 7:113108583-113108605 TTGAAAATGAAGAAGTAGTTTGG + Intergenic
1032130047 7:129220480-129220502 TAAAATATGAAAAATTAGCTCGG + Intergenic
1032465779 7:132143913-132143935 CTGAATATGAAAAACCAGGTAGG - Intronic
1033711026 7:143944714-143944736 TTGAAGAAGAATAATAAAGTTGG - Intergenic
1033711065 7:143945445-143945467 TTGAAGAAGAATAATAAAGTTGG - Intergenic
1033818082 7:145099721-145099743 TCTAATATCATTAATTAGGTAGG + Intergenic
1035919233 8:3658922-3658944 TTAAATATGCATTATTTGGTAGG - Intronic
1036993192 8:13623650-13623672 TTGAATAAGAAAAGTCAGGTGGG + Intergenic
1037699303 8:21259439-21259461 TTGAATAGGAGTAATGAGATGGG - Intergenic
1037941266 8:22952742-22952764 TTAAATATGAAAAATTAGCCGGG + Intronic
1038559546 8:28560039-28560061 TTGGGAATGAATGATTAGGTTGG + Intronic
1039035527 8:33355196-33355218 TGGAATATAAATAATCTGGTTGG - Intergenic
1039438002 8:37573907-37573929 TTGAATAAGAATAACTAGCATGG + Intergenic
1040372013 8:46786548-46786570 TTGAATATGAAATTTCAGGTTGG + Intergenic
1040710327 8:50180666-50180688 TAGAAAAGGAATAATTAGGATGG - Intronic
1040750987 8:50707904-50707926 TTTACTATGAAAAATTAGGCTGG + Intronic
1041420059 8:57657164-57657186 TTGAAAAAGAAGAATTAAGTTGG - Intergenic
1041754074 8:61293650-61293672 TTGAATATGAATTTTTACCTAGG - Intronic
1041991287 8:63995043-63995065 TTGAAGATGAATAAGTATGAAGG + Intergenic
1042231346 8:66558215-66558237 GTGAATATGGATATTTTGGTGGG + Intergenic
1042358942 8:67860453-67860475 TTGAAAATGAATAGTGAGGGAGG + Intergenic
1042540743 8:69905101-69905123 TTAAAAATAAATAAATAGGTGGG + Intergenic
1042588765 8:70373946-70373968 TTGAAAATGAAGAATAAGGTTGG - Intronic
1042679523 8:71367159-71367181 TTTAATATAAATAATAAGTTGGG - Intergenic
1042770347 8:72374056-72374078 TAGAAAGGGAATAATTAGGTAGG - Intergenic
1042963174 8:74323709-74323731 TTGAATATGAAGATTTGGGGAGG + Intronic
1043304234 8:78774034-78774056 TAGAACATGATTAATAAGGTTGG - Intronic
1043331111 8:79120047-79120069 TTGAATATGGCAAGTTAGGTGGG - Intergenic
1044175951 8:89122553-89122575 TTTAATATTAGTAATTAGATGGG + Intergenic
1044446706 8:92286022-92286044 AAGACTATGAATTATTAGGTTGG + Intergenic
1045172182 8:99683877-99683899 TTGAGTATGAATAATAAGAAGGG + Intronic
1046437725 8:114215169-114215191 TTTAAAAGGAAAAATTAGGTTGG - Intergenic
1046874635 8:119240316-119240338 TTGAATATGAATACTTACTGAGG - Exonic
1046954007 8:120044976-120044998 TTAAATAAGATTTATTAGGTAGG - Intronic
1047357849 8:124140303-124140325 TAAAATAGGAATAATTAGGGAGG - Intergenic
1048959564 8:139564661-139564683 TTGAATGTGGCTAATTAGGCAGG + Intergenic
1049921715 9:370762-370784 TGGAACATGAATAATAGGGTGGG - Intronic
1051450068 9:17186880-17186902 TTGCATATAAAAAATTAAGTAGG - Intronic
1051921954 9:22276887-22276909 TAGATCATGAATAATTAGGAGGG + Intergenic
1052400112 9:27989365-27989387 TTGAAGATGAAGCAATAGGTAGG - Intronic
1052688058 9:31778652-31778674 TTGTATAGGACTAATCAGGTTGG - Intergenic
1052987016 9:34495139-34495161 TCTGATCTGAATAATTAGGTAGG + Intronic
1053439293 9:38102876-38102898 TATAATAAAAATAATTAGGTGGG + Intergenic
1054800739 9:69345902-69345924 TTTAATAAGAATAAGAAGGTAGG - Intronic
1055049825 9:71967450-71967472 ATGAAAATGAAAAATGAGGTTGG - Intronic
1055131660 9:72782413-72782435 TTGAATAAGAATAGTGAGGGTGG - Intronic
1056134600 9:83619651-83619673 TTGAATCTGTATAATTTGGAGGG + Intergenic
1056614813 9:88155211-88155233 TTGAATATGAGTAGTAAGTTTGG + Intergenic
1056878272 9:90360244-90360266 TTGAAAATGAGGAATGAGGTGGG - Intergenic
1058280945 9:103113990-103114012 TTAAATATGAATAATTTATTAGG - Intergenic
1058368613 9:104237936-104237958 TTGAAAATAATTAATTATGTAGG - Intergenic
1058496080 9:105560310-105560332 TAGATTATGAATCAGTAGGTGGG + Intronic
1059042298 9:110827822-110827844 TTAAAAATGAATAAATGGGTTGG + Intergenic
1059136282 9:111809588-111809610 TTAAATATTAATATTTAGCTGGG - Intergenic
1060831216 9:126718319-126718341 ATAATTATGAATTATTAGGTTGG - Intergenic
1061703442 9:132433842-132433864 TAAAAGATGAATAAATAGGTTGG - Intronic
1203703910 Un_KI270742v1:19603-19625 CTGAATATAAAAAATTAGCTGGG - Intergenic
1186883650 X:13891167-13891189 TTGAATAGCAAGTATTAGGTTGG - Intronic
1187351886 X:18526490-18526512 TTGAATATGACTTATGAGGTGGG + Intronic
1188163905 X:26837815-26837837 TTTTAAATGAATTATTAGGTTGG - Intergenic
1188755601 X:33957694-33957716 TAGAATAAAAATAATTAGGTTGG - Intergenic
1188938060 X:36201825-36201847 TTAAATATGAATCACTAGGAGGG + Intergenic
1189527136 X:41834898-41834920 TTGAGTCTGAAGAATTAGATGGG - Intronic
1189614609 X:42770343-42770365 TTGAAAAAGACTAATTAGGCAGG - Intergenic
1190176064 X:48150721-48150743 TTGAAAAAGAAGAATAAGGTGGG + Intergenic
1190182074 X:48201233-48201255 TTGAAAAAGAAGAATAAGGTGGG - Intronic
1190201220 X:48363025-48363047 TTGAAAAAGAAGAATAAGGTGGG - Intergenic
1190202483 X:48375152-48375174 TTGAAAAAGAAGAATAAGGTGGG - Intergenic
1190202656 X:48376858-48376880 TTGAAAAAGAAGAATAAGGTAGG + Intergenic
1190207882 X:48418552-48418574 TTGAAAAAGAAGAATAAGGTAGG - Intergenic
1190208055 X:48420258-48420280 TTGAAAAAGAAGAATAAGGTGGG + Intergenic
1190210686 X:48444302-48444324 TTGAAAAAGAAGAATAAGGTGGG + Intergenic
1190429040 X:50360647-50360669 TTGAATAAGAGTTATTAGGGAGG - Intergenic
1190596183 X:52054096-52054118 TTGCAGAGGAATAATTAAGTTGG - Exonic
1190612641 X:52199977-52199999 TTGCAGAGGAATAATTAAGTTGG + Exonic
1190661655 X:52660168-52660190 TTGAAAAAGAAGAATAAGGTGGG - Intronic
1190669300 X:52725742-52725764 TTGAAAAAGAAGAATAAGGTGGG - Intergenic
1190670117 X:52732662-52732684 TTGAAAAAGAAGAATAAGGTGGG + Intergenic
1190798552 X:53767564-53767586 TTAAAAATAAAAAATTAGGTGGG + Intergenic
1192089149 X:68134326-68134348 TAGAATATGAATCATAAGTTAGG + Intronic
1193501786 X:82285362-82285384 TTAAATATAAATAATAAGGAAGG + Intergenic
1193923685 X:87460714-87460736 TTGATTATGAAGAACTAGATGGG - Intergenic
1195536754 X:106016255-106016277 TTGAAAATCAAGAATTACGTAGG - Intergenic
1195789630 X:108568996-108569018 TTAAACATGTATAATTAGCTGGG + Intronic
1196064831 X:111452489-111452511 TTTAATGTGAATAATTAATTTGG + Intergenic
1196087295 X:111697837-111697859 TTGGATGTGAAAACTTAGGTAGG + Intronic
1196132348 X:112170784-112170806 TTGAATATGAATAGTGAGAGAGG + Intergenic
1197282124 X:124549612-124549634 TTAAATATGAAACATTAGCTTGG - Intronic
1197321710 X:125040235-125040257 ATGAATGTGAATATTTAGGAGGG - Intergenic
1197374682 X:125667665-125667687 TTGAATAGGAATAATAAGAATGG - Intergenic
1197508471 X:127339547-127339569 TTTAAGATGCATCATTAGGTTGG + Intergenic
1197576799 X:128222979-128223001 TTGAATTAGAAGAATCAGGTAGG + Intergenic
1198381769 X:136090805-136090827 TTGAAGAAGAACAATAAGGTGGG + Intergenic
1198633900 X:138674028-138674050 TTCAAAATAATTAATTAGGTTGG + Intronic
1199147574 X:144387418-144387440 TTGAATATAAATAATTGTGGTGG - Intergenic
1199305965 X:146268132-146268154 TTGAAAATGAGTTATTAGGTGGG - Intergenic
1199907514 X:152248705-152248727 ATGCATATTTATAATTAGGTAGG + Intronic
1200353466 X:155523592-155523614 TTGAAAATGAAGAATTAAGTGGG - Intronic