ID: 1157353702

View in Genome Browser
Species Human (GRCh38)
Location 18:46914562-46914584
Sequence GTGTCGGGGGTGGAGTTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1026
Summary {0: 1, 1: 0, 2: 7, 3: 100, 4: 918}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157353702_1157353714 5 Left 1157353702 18:46914562-46914584 CCCCCCAACTCCACCCCCGACAC 0: 1
1: 0
2: 7
3: 100
4: 918
Right 1157353714 18:46914590-46914612 TCTGAAAAGCAAAGGCACCAGGG 0: 1
1: 0
2: 3
3: 24
4: 261
1157353702_1157353713 4 Left 1157353702 18:46914562-46914584 CCCCCCAACTCCACCCCCGACAC 0: 1
1: 0
2: 7
3: 100
4: 918
Right 1157353713 18:46914589-46914611 GTCTGAAAAGCAAAGGCACCAGG 0: 1
1: 0
2: 0
3: 24
4: 179
1157353702_1157353716 24 Left 1157353702 18:46914562-46914584 CCCCCCAACTCCACCCCCGACAC 0: 1
1: 0
2: 7
3: 100
4: 918
Right 1157353716 18:46914609-46914631 AGGGTCACCAAACCACACTGAGG 0: 1
1: 0
2: 2
3: 26
4: 157
1157353702_1157353712 -3 Left 1157353702 18:46914562-46914584 CCCCCCAACTCCACCCCCGACAC 0: 1
1: 0
2: 7
3: 100
4: 918
Right 1157353712 18:46914582-46914604 CACACAAGTCTGAAAAGCAAAGG 0: 1
1: 0
2: 0
3: 42
4: 427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157353702 Original CRISPR GTGTCGGGGGTGGAGTTGGG GGG (reversed) Intronic
900029300 1:359305-359327 GGGTCGGGGGAGGAGTGGGGAGG - Intergenic
900049902 1:588077-588099 GGGTCGGGAGAGGAGTGGGGAGG - Intergenic
900139144 1:1132188-1132210 GTGCTGGGGGTGGGGTTGTGGGG + Intergenic
900174029 1:1284128-1284150 GTGAGGGGGGTGGGGTCGGGGGG + Intronic
900346396 1:2212513-2212535 GGGCCGGGGGTGGGGGTGGGGGG - Intronic
900431699 1:2605827-2605849 GTGGCGGGGGTGGGGTGGGGAGG + Intronic
900478779 1:2888362-2888384 GGGACGGGGGTGGGGGTGGGGGG + Intergenic
900744684 1:4352942-4352964 GTGGCAGGGTGGGAGTTGGGGGG + Intergenic
901017779 1:6241790-6241812 GTGTCGGGGTTGGGGTCGGGGGG + Intergenic
901201285 1:7468821-7468843 CTGGCGGGGGTGTAGTTGGAGGG + Intronic
901635415 1:10668061-10668083 GTCCCAGGGGTGGAGGTGGGAGG + Intronic
901644126 1:10707524-10707546 TGGTCGGGGGTGGAGGAGGGAGG + Intronic
901864691 1:12096990-12097012 GGGTTGGAGGTGGAGCTGGGAGG + Intronic
902064922 1:13677075-13677097 GTGTCGGAGGTAGAGCTGGTGGG - Intergenic
903088368 1:20884913-20884935 GGGTTGGGGGTGGGGTTGAGCGG + Intronic
903365393 1:22802653-22802675 GAGTTGGGGGTGGGGCTGGGTGG - Intronic
903486108 1:23690168-23690190 GGGTCGGGTGTGGTGGTGGGGGG + Intergenic
903536555 1:24070913-24070935 GTGTTGGGGGTGGGGTTGGCAGG - Intronic
903731622 1:25500510-25500532 AAGTTAGGGGTGGAGTTGGGGGG + Intergenic
903748161 1:25602499-25602521 GTGTCTGGGGTGGGGGAGGGTGG - Intergenic
903896990 1:26613391-26613413 TTGTTGGGGGTGGGGCTGGGGGG - Intergenic
904115730 1:28160550-28160572 GTGTGGGGGGTGGCGGGGGGAGG - Intronic
904480430 1:30789804-30789826 GTGCTGGGTTTGGAGTTGGGTGG - Intergenic
904574491 1:31495354-31495376 GTGTGGTGGGCGGAGTGGGGAGG - Intergenic
905229719 1:36507527-36507549 GTGGAGGGGATGGACTTGGGGGG + Intergenic
905357019 1:37391753-37391775 GGTTGGGGGGTGGGGTTGGGGGG - Intergenic
905456523 1:38092007-38092029 GGGTCGGGGGTGGGGGTGGGGGG - Intergenic
906518817 1:46455580-46455602 GGGTCAGGGGTGGGGGTGGGTGG - Intergenic
906664020 1:47604892-47604914 GTGTGGTGGGGGGAGTGGGGAGG + Intergenic
907230080 1:52989355-52989377 CTGTTGGGAGTGGAGGTGGGGGG + Intronic
907272889 1:53301021-53301043 GTGTGGGGGGTGGGGTGGAGTGG + Intronic
907444115 1:54496910-54496932 GAATTGGGGGTGGAGTTGGGAGG + Intergenic
907460373 1:54602038-54602060 GCGTGGGCTGTGGAGTTGGGTGG + Intronic
907461031 1:54605607-54605629 CTGCTGGGGGTGGAGTTGGAAGG + Intronic
908258600 1:62321795-62321817 GTGTGGGGTGGGGAGGTGGGGGG - Intergenic
909395802 1:75169490-75169512 GAGTGGGCGGTGGAGGTGGGTGG + Intergenic
909434265 1:75622251-75622273 GTGTTGGGGGTGGGGTGAGGAGG - Intergenic
909836281 1:80259511-80259533 GTTTGGGGGGTGGGGTGGGGAGG + Intergenic
910870511 1:91829019-91829041 GTGGAGGGGGCGGGGTTGGGAGG - Intronic
911035508 1:93541580-93541602 GTGTGGGGGGTGGGGCGGGGCGG + Intronic
911348011 1:96720789-96720811 GTGTTGGGGGTGGAGGTGAAGGG + Intergenic
911449814 1:98048602-98048624 GTGTGGAGGGTGGAGAAGGGGGG - Intergenic
911725544 1:101237991-101238013 GGGTGGGGGGTGGGGTGGGGGGG + Intronic
911827894 1:102511170-102511192 TTGTGGGGGGGGGAGGTGGGAGG - Intergenic
912473994 1:109924245-109924267 CTGGCGGGGGTGCAGGTGGGGGG + Intronic
913267959 1:117063398-117063420 CTGACAGGGGTGGAGATGGGAGG - Intronic
913295186 1:117312372-117312394 CTGTGGTGGGTGGAGTGGGGTGG - Intergenic
913301436 1:117374050-117374072 ATGTGGGAGGTGGAGGTGGGAGG + Intronic
913444939 1:118941134-118941156 ATGTCGGAGGTGGTGGTGGGAGG - Intronic
913984507 1:143552780-143552802 TGGCCAGGGGTGGAGTTGGGAGG - Intergenic
914251115 1:145922217-145922239 CTGTTGGGGGTGGGGTGGGGGGG + Intergenic
915284997 1:154846925-154846947 GTGTGGGTGGTGGTGATGGGAGG - Intronic
915479618 1:156175878-156175900 GTGTCTGAGTTGGAGTTAGGTGG + Intronic
915835740 1:159173225-159173247 GGGGCGGGGGTGGAGAGGGGAGG + Intronic
915991222 1:160518760-160518782 CTGTCGGGGGTGGGGCAGGGGGG + Intronic
916432531 1:164744875-164744897 GTGGTGGGGGTGGTGGTGGGTGG + Intronic
916829510 1:168476344-168476366 GATTCGGGGGTGGGGGTGGGGGG + Intergenic
917584058 1:176406613-176406635 GAGTTGGGGGTGGTGATGGGAGG + Intergenic
917791558 1:178502506-178502528 ATGTTGGGGTGGGAGTTGGGGGG - Intergenic
918784740 1:188750812-188750834 GTGTTGGAGGTGGAGTTTAGTGG + Intergenic
918994885 1:191744539-191744561 GTGTGTGTGTTGGAGTTGGGTGG + Intergenic
919690997 1:200528271-200528293 GGGTGGGGGGTTGAGGTGGGAGG + Intergenic
920098211 1:203500142-203500164 GTGGTGGAGGTGGAGGTGGGTGG - Intronic
920098218 1:203500161-203500183 GTGGTGGTGGTGGAGGTGGGTGG - Intronic
920098253 1:203500267-203500289 GTGGTGGAGGTGGAGGTGGGTGG - Intronic
920098260 1:203500286-203500308 GTGGTGGTGGTGGAGGTGGGTGG - Intronic
920098279 1:203500346-203500368 GTGGCAGAGGTGGAGGTGGGTGG - Intronic
920567635 1:206988095-206988117 GGGTGGTGGGTGGAGATGGGAGG + Intergenic
920711854 1:208302857-208302879 CTCACAGGGGTGGAGTTGGGTGG + Intergenic
920788415 1:209064761-209064783 CAGTCTGGGGTGGAGTTGTGGGG + Intergenic
921589869 1:216990940-216990962 GTATATGGGGTGGGGTTGGGGGG - Intronic
921722519 1:218489117-218489139 GTGGCGGGGGTGGGGGGGGGGGG - Intergenic
921877391 1:220213716-220213738 GGGGCGGAGGAGGAGTTGGGGGG + Intronic
922198586 1:223381745-223381767 CTGTCGGGGGTGGGGTGGTGGGG - Intergenic
922222400 1:223618613-223618635 GTGTGGGGAGGGGAGTGGGGAGG + Intronic
922559930 1:226561998-226562020 GGGTGGGGGGTGAGGTTGGGGGG + Intronic
922811335 1:228416950-228416972 GTGGAGGGTGGGGAGTTGGGGGG + Intergenic
922832263 1:228609834-228609856 GCGGCGGGGGTGTAGGTGGGCGG + Intergenic
922832823 1:228612075-228612097 GCGGCGGGGGTGTAGGTGGGCGG + Intergenic
922833384 1:228614316-228614338 GCGGCGGGGGTGTAGGTGGGCGG + Intergenic
922833944 1:228616557-228616579 GCGGCGGGGGTGTAGGTGGGCGG + Intergenic
922834501 1:228618798-228618820 GCGGCGGGGGTGTAGGTGGGCGG + Intergenic
922835055 1:228621013-228621035 GCGGCGGGGGTGTAGGTGGGCGG + Intergenic
922835612 1:228623233-228623255 GCGGCGGGGGTGTAGGTGGGCGG + Intergenic
922836170 1:228625475-228625497 GCGGCGGGGGTGTAGGTGGGCGG + Intergenic
922836728 1:228627714-228627736 GCGGCGGGGGTGTAGGTGGGCGG + Intergenic
922837287 1:228629956-228629978 GCGGCGGGGGTGTAGGTGGGCGG + Intergenic
922837848 1:228632197-228632219 GCGGCGGGGGTGTAGGTGGGCGG + Intergenic
922838406 1:228634437-228634459 GCGGCGGGGGTGTAGGTGGGCGG + Intergenic
922838964 1:228636662-228636684 GCGGCGGGGGTGTAGGTGGGCGG + Intergenic
922839524 1:228638903-228638925 GCGGCGGGGGTGTAGGTGGGCGG + Intergenic
922840085 1:228641134-228641156 GCGGCGGGGGTGTAGGTGGGCGG + Intergenic
922840645 1:228643375-228643397 GCGGCGGGGGTGTAGGTGGGCGG + Intergenic
922841208 1:228645606-228645628 GCGGCGGGGGTGTAGGTGGGCGG + Intergenic
923041434 1:230322655-230322677 GCGTCGGGGGTGGAGAGGAGGGG + Intronic
924568961 1:245220600-245220622 GTGTGGGTGGTGGGGATGGGTGG + Intronic
924706409 1:246506651-246506673 GTGGCGGGCGTGGGGCTGGGTGG - Intronic
924951754 1:248890923-248890945 GTGTCGGGGGTGGGGAGGTGTGG - Intergenic
1062912200 10:1218621-1218643 GTGTCGGAGGTGGAATTTGGTGG + Intronic
1062957385 10:1549194-1549216 GGGTGGGGCGTGGAGCTGGGGGG + Intronic
1063138758 10:3238729-3238751 GTGTCTGAGCTGGAGCTGGGCGG + Intergenic
1065023582 10:21520466-21520488 ATGGCGGGGGTGGGGGTGGGAGG - Intronic
1065176625 10:23082447-23082469 TTGTCGGGGGGCGAGGTGGGCGG - Intergenic
1065513929 10:26506247-26506269 GTGTGGGGGGGGGGGGTGGGGGG + Intronic
1066083340 10:31954007-31954029 GTGTTGGGGGAGGAGCTGGTAGG + Intergenic
1066709899 10:38222244-38222266 GTGTGGTGGGGGGAGTGGGGAGG + Intergenic
1067271633 10:44796692-44796714 GTACCTGGGGTGGAGTAGGGAGG - Intergenic
1068201724 10:53791916-53791938 GTGTGTGGGGTGGGGTGGGGTGG - Intergenic
1068933893 10:62617725-62617747 GGGGCGGGGGTGGGGGTGGGGGG - Intronic
1069940844 10:71954247-71954269 GTGTAGTGGGTGGTGTTGGTGGG + Intergenic
1069957437 10:72060661-72060683 GAGCCGGGGCTGGAGTGGGGAGG + Exonic
1070285981 10:75084062-75084084 GTGAGGGGGGTGGAGTTGGGGGG + Intergenic
1070761330 10:79026344-79026366 GTGTCGAGGGGGGTGTTGGTGGG - Intergenic
1071239315 10:83686756-83686778 GTGTGGGGGGGGGGGGTGGGTGG + Intergenic
1071527085 10:86365229-86365251 GGGTGGGTGGTGGAGTGGGGTGG - Intronic
1071676815 10:87662552-87662574 GTATAGGGGGTGGGGGTGGGAGG - Intronic
1071877312 10:89855106-89855128 CTCTGGGGGGTGGAGGTGGGAGG - Intergenic
1071997390 10:91162301-91162323 GTGGCGGGGGTGGGGTGGGGTGG + Intergenic
1072169049 10:92842693-92842715 GTGGTGGTGGTGGAGTTGGTGGG + Intronic
1072735850 10:97879208-97879230 GTGTTGGTGGTGGTGATGGGAGG - Intronic
1072742944 10:97921158-97921180 GTCTGGAGGGTGGAGTGGGGCGG + Intronic
1072743095 10:97922140-97922162 GAGTGTGGGGTGGAGCTGGGGGG - Intronic
1072754314 10:98008415-98008437 GAGTGGGGGGTGGGGTGGGGGGG + Intronic
1072976799 10:100065824-100065846 GTGGGGTGGGTGGAGTGGGGTGG + Intronic
1073003420 10:100302451-100302473 CTGTGGGTGGTGGAGGTGGGCGG + Intronic
1073111074 10:101063284-101063306 GGGTGGGGGGTGGAGTGGAGTGG + Intronic
1073242578 10:102067763-102067785 GAGTCGGGGGTGGAGTGCTGGGG - Exonic
1074004322 10:109404310-109404332 GGTTCGGGGGGGTAGTTGGGGGG - Intergenic
1074193153 10:111155464-111155486 TTGTGGGGGGTGGAGGTTGGTGG - Intergenic
1074422205 10:113319172-113319194 GTGTGGGGGGGGGGGGTGGGTGG + Intergenic
1074543269 10:114383935-114383957 GTGACGAGGTTGGAGGTGGGAGG - Intronic
1074819699 10:117168759-117168781 GTGTCGGGGGCGGGGGGGGGTGG - Intergenic
1075036842 10:119076562-119076584 TTGTCAGGGGTGGGGGTGGGAGG + Intronic
1075641007 10:124064647-124064669 GGCTCGGGGGTGGGGTTGGGGGG - Intronic
1075787375 10:125059130-125059152 GTGTGGGCGGTGGGGGTGGGAGG + Intronic
1076024303 10:127099887-127099909 GTGTTTGGGGTGGACTTGGGTGG + Intronic
1076034350 10:127186538-127186560 GTGTCAAGGGTGGAACTGGGTGG - Intronic
1076149178 10:128149420-128149442 GTGACAGGGGTGGAGCTGGCAGG + Intergenic
1076438484 10:130462889-130462911 GTGGTGGGGGTGGGGTGGGGTGG + Intergenic
1076542821 10:131224744-131224766 GAGTAGGGGGTGGGGTTTGGGGG - Intronic
1076644277 10:131941556-131941578 GGGTGGGTGGTTGAGTTGGGTGG + Intronic
1077118473 11:896120-896142 GTGTCTGGGGTGGAGGCTGGGGG - Intronic
1077118483 11:896158-896180 GTGTCTGGGGTGGAGGCTGGGGG - Intronic
1077118493 11:896199-896221 GTGTCTGGGGTGGAGGCTGGGGG - Intronic
1077118514 11:896275-896297 GTGTCTGGGGTGGAGGCTGGGGG - Intronic
1077118552 11:896436-896458 GTGTCTGGGGTGGAGGCTGGGGG - Intronic
1077118592 11:896588-896610 GTGTCTGGGGTGGAGGCTGGGGG - Intronic
1077118602 11:896629-896651 GTGTCTGGGGTGGAGGCTGGGGG - Intronic
1077118642 11:896781-896803 GTGTCTGGGGTGGAGGCTGGGGG - Intronic
1077118663 11:896860-896882 GTGTCTGGGGTGGAGTCTGGGGG - Intronic
1077118672 11:896898-896920 GTGTCTGGGGTGGAGGCTGGGGG - Intronic
1077118682 11:896936-896958 GTGTCTGGGGTGGAGGCTGGGGG - Intronic
1077118734 11:897167-897189 GTGTCTGGGGTGGAGGCTGGGGG - Intronic
1077118744 11:897205-897227 GTGTCTGGGGTGGAGGCTGGGGG - Intronic
1077118754 11:897243-897265 GTGTCTGGGGTGGAGGCTGGGGG - Intronic
1077152290 11:1077709-1077731 GCGTCGGTGCTGGACTTGGGGGG + Intergenic
1077342013 11:2030403-2030425 CTGTGGGGGGTGGTGCTGGGTGG + Intergenic
1077405841 11:2382211-2382233 GTGCGGGGGGTGGGGGTGGGGGG - Intronic
1077426986 11:2485349-2485371 GGGTGGGGGATGGAGTGGGGAGG - Intronic
1077751453 11:4974948-4974970 CTGTCAGGGGTTGAGGTGGGGGG + Intronic
1077805226 11:5584417-5584439 GTGTGGTGGGGGGAGTGGGGAGG - Intronic
1078213153 11:9288096-9288118 GGGTCGGGGGTAGGGTCGGGGGG - Intronic
1078417613 11:11178716-11178738 ATGTAGGGGGTGGGGTGGGGGGG + Intergenic
1078908980 11:15713318-15713340 GTGTTGGAGGTGGAGTCTGGTGG + Intergenic
1079058546 11:17228277-17228299 GTGACGCCGGTGCAGTTGGGGGG + Intronic
1080508336 11:32941375-32941397 TTGTGGGGGGTGGAGGGGGGAGG - Intronic
1081605491 11:44524827-44524849 GTGTCGGGGGCGGGGGTTGGGGG + Intergenic
1081667121 11:44923170-44923192 GTGTATGGGGTGGAGCTGGAGGG + Intronic
1081736955 11:45410938-45410960 TGGTCGGGGGTCGGGTTGGGAGG - Intergenic
1081957256 11:47104280-47104302 GTATTGGGGGTGGAGATGAGTGG - Intronic
1081958135 11:47111550-47111572 GAGTGGGGTGTGGAGTGGGGTGG - Intronic
1082083894 11:48033271-48033293 GAGCTGGGGGTGGAGTGGGGTGG + Intronic
1082315992 11:50723234-50723256 GTGGTGGGGGTGGAGGGGGGAGG - Intergenic
1082828546 11:57598345-57598367 GGGACGGGGGTGGAGACGGGAGG + Intronic
1082918064 11:58460817-58460839 GTGTGGTGGGGGGAGTGGGGAGG + Intergenic
1083292249 11:61696589-61696611 GGGTTGGGGGTGGGGTGGGGTGG + Intronic
1083753495 11:64777031-64777053 GTGAGGGGAGTGGAGGTGGGTGG - Intronic
1083861032 11:65420097-65420119 GATTCCGGGGTGGAGCTGGGTGG - Intergenic
1083941923 11:65900487-65900509 GTCTCGGGGGTGGAGCCTGGAGG - Exonic
1084131939 11:67142577-67142599 GGGTTGGGGTTGGGGTTGGGGGG + Intronic
1084172536 11:67407386-67407408 CTGGCGGGGGTGGGGATGGGTGG + Intronic
1084172793 11:67408714-67408736 TTGGCGGGGGTGGGGATGGGAGG + Intronic
1084265501 11:68003499-68003521 GCGGCGGGGGTGGGGTTGGGGGG - Intronic
1084403221 11:68956627-68956649 GGGGTGGGGGTGGAGGTGGGCGG + Intergenic
1084634579 11:70382439-70382461 GTCATGGGGGTGGAGTGGGGAGG + Intronic
1084897003 11:72280115-72280137 GTGTCGGCGGTGGTGATGGCGGG + Intergenic
1085400817 11:76234499-76234521 GTGTGGGGGGTGGAAAGGGGTGG + Intergenic
1085590312 11:77753961-77753983 GTTTAGGGGAAGGAGTTGGGTGG - Intronic
1085645591 11:78220296-78220318 GTGCCTGGAGTAGAGTTGGGGGG - Intronic
1086091242 11:83007279-83007301 GGATTGGGGGTGGAGTTAGGAGG + Intronic
1086208774 11:84293139-84293161 GTGTCGGGTGTGGGGGTGTGGGG + Intronic
1087188045 11:95223153-95223175 TTTGCGGGGGTGGGGTTGGGGGG - Intronic
1087232651 11:95683618-95683640 GTGTAGGGGGTGGGCTTGGGTGG - Intergenic
1087560484 11:99783819-99783841 GTGGGGTGGGTGGAGTGGGGAGG + Intronic
1088619209 11:111664679-111664701 GTGGGGGGGGTGGTGATGGGGGG - Intronic
1088833135 11:113555067-113555089 GGGTGGGGGGTGGTGTGGGGAGG - Intergenic
1088895672 11:114076620-114076642 GGGGCGGGGGTGGGGGTGGGGGG - Intronic
1088907100 11:114163198-114163220 GGGGTGGGGGTGGGGTTGGGGGG - Intronic
1089708625 11:120299145-120299167 GTGTTGGGGTGGGAGTTGGGGGG - Intronic
1089938812 11:122394271-122394293 GTGTCAGGGATGGAGTAGGATGG - Intergenic
1090257996 11:125299266-125299288 GTGTCGGAGGTGGGGCTGGGCGG - Intronic
1090387411 11:126364998-126365020 TTCTCGGGGGTGGGGGTGGGAGG + Intronic
1090389977 11:126382196-126382218 TTCTCGGGGGTGGGGGTGGGAGG + Intronic
1090424865 11:126600565-126600587 GGGTGGTTGGTGGAGTTGGGTGG - Intronic
1090473127 11:126997440-126997462 CTGGCGGGGGTGGAATCGGGAGG + Intronic
1202824999 11_KI270721v1_random:85592-85614 CTGTGGGGGGTGGTGCTGGGTGG + Intergenic
1091403499 12:195202-195224 GTGAGTGGGGTGGAGTGGGGTGG - Intronic
1091460500 12:640870-640892 GTGGAGGGGTTGGAGTGGGGTGG - Intronic
1091605954 12:1951564-1951586 GTGTGGGGGGTGGAGGTGGGTGG + Intronic
1092239857 12:6829768-6829790 GTGTCTGGGGTAGGGTGGGGAGG + Intronic
1092243975 12:6852704-6852726 CGGCCGGGGTTGGAGTTGGGGGG + Intronic
1092253963 12:6916269-6916291 GTGTGTGGGGTGGGGGTGGGGGG + Intronic
1092581878 12:9850792-9850814 GTGGGGTGGGTGGAGTGGGGAGG - Intergenic
1093077123 12:14770021-14770043 GCGGCGGGCGTGGAGTTGGCAGG - Intronic
1093421192 12:18976926-18976948 GTTTTGGGGGAGGATTTGGGAGG - Intergenic
1094108654 12:26838585-26838607 GTGTCAGGGGTGGAGCTGAAGGG - Intergenic
1094608173 12:31967614-31967636 TTGTGGGGGGTGGGGGTGGGCGG - Intronic
1096741556 12:53697336-53697358 GAGTCGGGGCTGGGGATGGGGGG + Intergenic
1096749253 12:53748301-53748323 GTGTTGGGGATGGAGTTGGGGGG - Intergenic
1096851063 12:54437742-54437764 GTGGCGGTGGTGGGGTTGGGTGG + Intergenic
1096979419 12:55719739-55719761 GTGTCGGGGGTGGGAGTGGAAGG + Intronic
1097041387 12:56158153-56158175 GGGTCGTGGGGGGAGGTGGGGGG - Exonic
1097174221 12:57133623-57133645 GTGCGGGGGGTGGGGTGGGGGGG - Intronic
1097185687 12:57195153-57195175 GTGTGTGGGGTGGAGTTGGGTGG - Intronic
1097221298 12:57452753-57452775 TTGGTGGGGGTGGAGTGGGGTGG - Intronic
1097238530 12:57556646-57556668 GTGTGGGGGCTGGGGTGGGGTGG + Intronic
1097331908 12:58340315-58340337 GTGTTGGAGGTGGAGCTTGGTGG - Intergenic
1097556577 12:61146548-61146570 GTGTGGTGGGTGGAGGGGGGAGG - Intergenic
1098720912 12:73896302-73896324 GTGGGGTGGGTGGAGTGGGGAGG + Intergenic
1100023143 12:90096011-90096033 GTGGCGGGGGTGGGGTGGGGTGG + Intergenic
1100433888 12:94554156-94554178 GTTTCGTGGGTAGGGTTGGGTGG + Intergenic
1101735498 12:107459945-107459967 GGGGCAGGGGTGGGGTTGGGGGG + Intronic
1102290984 12:111699468-111699490 GTGTTGGGGGTGGGTGTGGGGGG + Intronic
1102386904 12:112517437-112517459 GGATCTGGGGTGGAGATGGGGGG + Intergenic
1102716067 12:114973836-114973858 TTGTTGGGGGTGGGGGTGGGGGG + Intergenic
1102823484 12:115927277-115927299 GTTTCGGGGGAGGGGGTGGGGGG - Intergenic
1103180299 12:118905553-118905575 GGGTGGGGCGTGGAGTGGGGTGG - Intergenic
1103269163 12:119657820-119657842 GTGTCGTGGGAGGAATTTGGCGG - Intergenic
1103829500 12:123767683-123767705 GTGCGAGGTGTGGAGTTGGGAGG + Exonic
1104084019 12:125458157-125458179 GTGTGGGGGATGGAGCTGAGTGG + Intronic
1104205290 12:126632710-126632732 GTGTGTGTGGTGGAGTTGGGGGG + Intergenic
1104557130 12:129811268-129811290 GTGTCAGGGATGGGGTGGGGTGG + Intronic
1104656170 12:130575216-130575238 CTGCCGGGGGTGGGGGTGGGGGG - Intronic
1104678076 12:130729286-130729308 GTGACGGGGGTGGGGAGGGGGGG + Intergenic
1104812216 12:131626240-131626262 GGGCCGTGGGTGAAGTTGGGGGG - Intergenic
1104939653 12:132389009-132389031 CTGTTGGGGATGGAGTTGTGGGG - Intergenic
1104971007 12:132530710-132530732 GGGTGGGGGGTGGGGCTGGGGGG + Intronic
1105897169 13:24726296-24726318 CTGGCTGGGGTGGAGTTGTGGGG - Intergenic
1106278658 13:28241533-28241555 GTGGCAGGGGTGGGGTTGTGAGG + Intronic
1106473971 13:30081540-30081562 GTATGTGGGGTGGGGTTGGGGGG - Intergenic
1106620074 13:31364477-31364499 GTGTGGGAGGTGGAAATGGGAGG - Intergenic
1107133376 13:36919831-36919853 CTGTCTGGGGTGGAGTGGGGTGG - Intronic
1107376588 13:39810790-39810812 GTGTTGGGGGGGGAGGTGGGAGG - Intergenic
1107434483 13:40370243-40370265 GTGTCAGGGGTGCAGCAGGGAGG - Intergenic
1107505690 13:41030826-41030848 GGGTGGGGGGTGCAGTGGGGAGG + Intronic
1108382641 13:49868949-49868971 GTATTGGTGGTGGGGTTGGGAGG - Intergenic
1110602375 13:77389349-77389371 CTGGCGGGGGTGGAGTGGTGAGG + Intergenic
1110933306 13:81250306-81250328 GGGTTGGGGGTGGGGATGGGAGG - Intergenic
1111370207 13:87307314-87307336 GTGGGGTGGGAGGAGTTGGGAGG + Intergenic
1111512764 13:89287694-89287716 TTGTTGGGGGTGGGGTAGGGGGG + Intergenic
1112503117 13:99957221-99957243 GTGGCGGGGGTGGAGTGAGGAGG - Intergenic
1112585600 13:100716152-100716174 GTGTAGGGGGTTGAGTGGGTGGG - Intergenic
1112693071 13:101917286-101917308 GTGGAGGGGGTGTAGTGGGGTGG - Intronic
1113039190 13:106085705-106085727 GTGTGGGGGGTGGGGAGGGGGGG + Intergenic
1113104427 13:106757786-106757808 GGGTCGGGGGTAAAGTGGGGAGG + Intergenic
1113389598 13:109882670-109882692 GTGTGGGGGGGGGGGGTGGGGGG + Intergenic
1113455041 13:110442474-110442496 GTCTAGGGGGAGGTGTTGGGTGG - Intronic
1113943396 13:114030024-114030046 GTCCCGGGGGTGGAGTGGAGGGG - Intronic
1114051153 14:18920584-18920606 GTGGCGGGGGTGGTGGAGGGAGG + Intergenic
1114111409 14:19481341-19481363 GTGGCGGGGGTGGTGGAGGGAGG - Intergenic
1114140353 14:19902149-19902171 GTGTCGGAGGTGGTGCTTGGTGG + Intergenic
1114558593 14:23576307-23576329 GGGGCGGGGGTGGCGTCGGGGGG + Exonic
1114559709 14:23580960-23580982 GTGAGGGGGGTGGGGTAGGGGGG - Intergenic
1114704919 14:24715106-24715128 CTGTCTGGGATGGAGGTGGGGGG + Intergenic
1115212736 14:30984130-30984152 GTGTGTGGGGGGGGGTTGGGGGG - Intronic
1115253358 14:31372923-31372945 GTGTGGGAGGTGGGGTCGGGAGG - Intronic
1116778850 14:49213227-49213249 GGGGCGGGGGTGGGGTGGGGGGG - Intergenic
1116949337 14:50864483-50864505 GGGTCAGGGGTGGGGTGGGGTGG + Intronic
1117086455 14:52206728-52206750 GTGTAGTGGCTGGGGTTGGGAGG + Intergenic
1117145560 14:52833836-52833858 GTGGGGGGGGTGGGGTGGGGGGG - Intergenic
1117262490 14:54050451-54050473 GAGTCAGGGGCGGAGTGGGGGGG + Intergenic
1117628504 14:57665128-57665150 GTGTGCGGGGTGGTGGTGGGCGG - Intronic
1117701672 14:58420031-58420053 CTGTGGGAGGTGGAGATGGGAGG - Intronic
1117913186 14:60653402-60653424 GTGTGGGCGGTGGAGGTGGTGGG - Intronic
1118335673 14:64851860-64851882 TTGTGGGGGGTGGAGGGGGGAGG + Intronic
1119202875 14:72771490-72771512 GTGGCAGGGGTGGGGTGGGGTGG - Intronic
1119333000 14:73809479-73809501 GTGTCTTGGGTGGTGGTGGGAGG - Intergenic
1119683472 14:76611154-76611176 GGGTCGGGGTTGCAGTTGAGTGG + Intergenic
1120374499 14:83685152-83685174 GTGTCAGGGGTGGGATTAGGTGG - Intergenic
1120578829 14:86220958-86220980 GTGGCGGAGCTGGAGGTGGGTGG + Intergenic
1120618777 14:86737546-86737568 GGGTCGGGGGTGCTGTAGGGCGG - Intergenic
1120935889 14:89894420-89894442 CTGTCGGGGGCGGAGGTGGGGGG - Intronic
1121106498 14:91283352-91283374 GCGATGGGGGTGGAGTTGGAAGG + Exonic
1121227846 14:92334427-92334449 GTTTCAGGGGTGGAGTGGGATGG + Intronic
1121711225 14:96040128-96040150 GTGTCGGGGAGGGGGGTGGGGGG - Intronic
1122272274 14:100573564-100573586 GGGCCTGGGGTGGAGGTGGGAGG + Intronic
1122386742 14:101353530-101353552 GTGTTGGGGGTGGAGCTTGGTGG + Intergenic
1122446872 14:101776026-101776048 AAGGCGGGGGTGGAGTGGGGGGG - Intronic
1122670657 14:103369338-103369360 GGGTCGGGGGCGGGGTGGGGGGG - Intergenic
1122791359 14:104185454-104185476 GGGGTGGGGGTGGAGTGGGGTGG + Intergenic
1122791522 14:104185858-104185880 GTGTGGAGGATGGGGTTGGGTGG + Intergenic
1122859784 14:104577398-104577420 GGGTCGGGGGTGGGGCTGGAGGG - Intronic
1122859832 14:104577577-104577599 GTGGCCGGGGTGGAGTAGGGCGG - Intronic
1122885183 14:104707626-104707648 GGGGCGGGGGTGCTGTTGGGAGG - Exonic
1122901329 14:104783514-104783536 GTGGGTGGGGTGGTGTTGGGGGG - Intronic
1122922297 14:104885064-104885086 ATGCCGGGGGTGGAGGTGGGCGG + Intronic
1123208750 14:106738662-106738684 GTGTGGGGGGGGTAGGTGGGGGG - Intergenic
1202861927 14_GL000225v1_random:88884-88906 GGGTTGGGGGTGGGGTGGGGTGG + Intergenic
1123440728 15:20289242-20289264 GAGGAGGGGCTGGAGTTGGGTGG + Intergenic
1123690584 15:22835517-22835539 GTGTCGGGGGAGGTGTCCGGTGG + Intergenic
1124059517 15:26276651-26276673 CTTTAGGAGGTGGAGTTGGGAGG + Intergenic
1124223302 15:27868549-27868571 CTGTCGGGGGTGGAGGGAGGGGG + Intronic
1124272468 15:28295307-28295329 GTGGGGGGGGGGGAGTGGGGGGG + Intronic
1124426783 15:29570039-29570061 GGGTGGGGGGTGGGGTGGGGGGG - Intronic
1124427348 15:29572823-29572845 TTGGTGGGGGTGGGGTTGGGGGG - Intergenic
1124940202 15:34210540-34210562 GAGACGGGGGCGGAGGTGGGGGG - Intergenic
1125082772 15:35695218-35695240 GTGCTGAGGGTGGAGATGGGGGG + Intergenic
1125131839 15:36290925-36290947 CTGTCGGGAGGGGAGGTGGGGGG + Intergenic
1125453090 15:39829194-39829216 GTGTTGGGGGTTGCGTTGTGAGG - Intronic
1125613699 15:40991010-40991032 ATGTGGGTGGTGGAGGTGGGTGG + Intronic
1125651491 15:41321136-41321158 CTGTCGGGGAGGGAGGTGGGGGG + Intronic
1125702235 15:41697138-41697160 GTATGGGGGGTGGAGTTGGGAGG + Intronic
1126944371 15:53802586-53802608 GTGTGGGGGTTGTTGTTGGGGGG + Intergenic
1127305912 15:57705730-57705752 GTGGCGGGGGTGGGGGGGGGCGG + Intronic
1127548138 15:60009196-60009218 GAGGCGGGGATGGAGTGGGGTGG - Intronic
1127882055 15:63166862-63166884 GAGACGGGGGTGGGGGTGGGGGG - Intergenic
1128272537 15:66323710-66323732 GGGTCGGGGGTGAGGTTGAGAGG - Intronic
1128536084 15:68491748-68491770 GTGTGGAGGATGGAGTTGAGTGG + Intergenic
1128604716 15:69028116-69028138 GTGTCTGGGGTGGTGGTGGGGGG - Intronic
1129070577 15:72946810-72946832 GTGTCGGTGGTGGACTGGGTAGG - Intergenic
1129269000 15:74409749-74409771 GTGTTGGGGGTGGTTATGGGAGG - Exonic
1129456634 15:75679537-75679559 GTGTCTGGAGTGGAGGTGAGGGG - Intronic
1129598500 15:76983239-76983261 GTGGTGGGGGAGGAGTGGGGGGG + Intergenic
1129615830 15:77098196-77098218 GTGTCGGGGGGGGGGGTGGGGGG + Intergenic
1129851518 15:78796542-78796564 GTGGCGGGGATGGTGTTGGGGGG - Intronic
1129923035 15:79336784-79336806 GTGTAGTGGGTGGAGTTTGCTGG - Intronic
1130109238 15:80950907-80950929 GTCTCATGGGTGCAGTTGGGTGG - Exonic
1130130246 15:81134787-81134809 GTGGCAGGGTTGGAGTGGGGAGG - Intronic
1130656641 15:85795871-85795893 CTGACGGAGGTGGAGGTGGGAGG + Intergenic
1130669044 15:85894045-85894067 ATGCCGGGGGTGGTGTTGAGAGG + Intergenic
1130928520 15:88403352-88403374 GTGTTGGGGGCGGGGTGGGGGGG - Intergenic
1131279588 15:91009707-91009729 GTGGTGGGGGTGGGGTGGGGGGG + Intronic
1131435158 15:92416336-92416358 GTGGAAGGGGTGGAGGTGGGTGG + Intronic
1131455188 15:92578250-92578272 GTTTTTTGGGTGGAGTTGGGTGG - Intergenic
1131540371 15:93270366-93270388 GTGTGGGAGGTGGATTTGGAGGG + Intergenic
1131823214 15:96293773-96293795 GGGTGGGGGGTGGCGTTGGGAGG + Intergenic
1131832746 15:96364647-96364669 GTGGTGGGGGTGGGGTGGGGTGG + Intergenic
1132644284 16:991706-991728 GGGTGGGGGGGGGGGTTGGGGGG - Intergenic
1132689195 16:1174949-1174971 CTGGTGGGGGTGGAGGTGGGGGG - Intronic
1132788639 16:1672464-1672486 GGGGCGGGGGTGGAGCTGGGTGG + Intronic
1132905706 16:2281576-2281598 GGGGCGGGGGTGGATGTGGGAGG + Intronic
1132927846 16:2440843-2440865 CTGTAGGAGGTTGAGTTGGGAGG + Intronic
1132970487 16:2685893-2685915 GGGTCTGGAGAGGAGTTGGGTGG + Intronic
1133018382 16:2955266-2955288 GTGTCAGGCGTGGAGGAGGGAGG - Intergenic
1133327302 16:4949496-4949518 GTATCGGGGGTAGAGTTAGTGGG - Intronic
1133405529 16:5521348-5521370 CTGTTGGGGGTGGGGTGGGGTGG + Intergenic
1134089582 16:11384448-11384470 GAGTCCGGGGTGGAGGTGGTGGG - Intronic
1134252228 16:12582415-12582437 GGGTTGGGGTTGGGGTTGGGGGG + Intergenic
1135015914 16:18925648-18925670 GAGGCGGGGGTGGGGGTGGGGGG - Intronic
1135959242 16:26982086-26982108 GTTTGGGAGGTGGAGTTTGGAGG + Intergenic
1136363646 16:29798295-29798317 GTGTAAGGGGTGGAGTGGGGTGG - Intronic
1136685409 16:31991262-31991284 GCGTGGGGTTTGGAGTTGGGTGG + Intergenic
1136726126 16:32359148-32359170 GAGGAGGGGCTGGAGTTGGGTGG - Intergenic
1136786023 16:32934792-32934814 GCGTGGGGTTTGGAGTTGGGTGG + Intergenic
1136844458 16:33565193-33565215 GAGGAGGGGCTGGAGTTGGGTGG - Intergenic
1136883752 16:33919011-33919033 GCGTGGGGTTTGGAGTTGGGTGG - Intergenic
1137411504 16:48232170-48232192 GTGTTGGGGGTGGGTTGGGGAGG - Exonic
1137976814 16:53039075-53039097 GTTTAGAGGATGGAGTTGGGAGG - Intergenic
1138225769 16:55292960-55292982 GTGTGGGAGGTGGAGGTGTGAGG + Intergenic
1138437994 16:57016923-57016945 GTCTAGCGGATGGAGTTGGGGGG + Intronic
1138503363 16:57462881-57462903 GGGGCGGGGGTGTAGTGGGGTGG + Intronic
1138563031 16:57813461-57813483 GTGGAGGGGGTGGAGTAGCGTGG - Intronic
1138601221 16:58055760-58055782 GTGAAGGGGGTGGAGGTGGGAGG + Intergenic
1139136087 16:64206233-64206255 GTGGAGGGGGTGGGGGTGGGGGG + Intergenic
1139393553 16:66621877-66621899 GGGTCCGCGGTGGAGTTGGGAGG - Intronic
1140162717 16:72515183-72515205 CTGTAGGGGGTGGAGCTGGAGGG - Intergenic
1140310898 16:73847372-73847394 GTGTCGAGGGGGGATTTGGCTGG + Intergenic
1140478840 16:75251791-75251813 GCCTCGGGGTTGGAGGTGGGGGG - Intronic
1140661988 16:77197140-77197162 GAGTCGGGGTGGGAGTTGGGGGG + Intronic
1140949885 16:79806823-79806845 GTGGCGGGGGCGGGGTGGGGGGG + Intergenic
1141028798 16:80570719-80570741 GTGGTGGGGGTGGGGTTGAGTGG - Intergenic
1141028812 16:80570752-80570774 GTGGTGGGGGTGGGGTTGAGTGG - Intergenic
1141028826 16:80570786-80570808 GTGGTGGGGGTGGGGTTGAGTGG - Intergenic
1141028831 16:80570800-80570822 GTGTGGAGGGTGGAGTGGTGGGG - Intergenic
1141174678 16:81711009-81711031 GTGGCGGGGGTGGGGTGGGGAGG - Exonic
1141609875 16:85175279-85175301 GTGTCTGGGGTGGCCTGGGGAGG + Intronic
1141902833 16:87003740-87003762 GGGCATGGGGTGGAGTTGGGGGG + Intergenic
1142267449 16:89071009-89071031 GGGGCGAGGGTGGCGTTGGGGGG - Intergenic
1142352275 16:89585891-89585913 GTGTCAGGTGAGGAGGTGGGGGG + Intronic
1203000305 16_KI270728v1_random:158608-158630 GAGGAGGGGCTGGAGTTGGGTGG + Intergenic
1203088256 16_KI270728v1_random:1196450-1196472 GCGTGGGGTTTGGAGTTGGGTGG + Intergenic
1203131907 16_KI270728v1_random:1695011-1695033 GAGGAGGGGCTGGAGTTGGGTGG + Intergenic
1203154625 16_KI270728v1_random:1865492-1865514 GAGGAGGGGCTGGAGTTGGGTGG - Intergenic
1142787210 17:2233654-2233676 GTGCCGGGGGTGGAGAAGGAGGG - Intronic
1143178994 17:4972771-4972793 GTGTCTGGGCTGGAGGAGGGTGG + Exonic
1143181521 17:4987046-4987068 GTGTCCAGGATGGAGATGGGAGG + Exonic
1143352607 17:6299680-6299702 GGGTTGGGGGTGGAGTGGGGAGG - Intergenic
1143483012 17:7238185-7238207 GTGTCTGGGGTGGGGGTGAGGGG - Intronic
1143485244 17:7250750-7250772 GTGTCAAGGGTGGAGGTGGGTGG - Intronic
1143543608 17:7583457-7583479 GTCTCCGAGGTGGCGTTGGGTGG - Intergenic
1143545024 17:7590590-7590612 GTTTAGGGACTGGAGTTGGGAGG - Intronic
1143550582 17:7627937-7627959 CTGTCGGGGGTGGGGCTTGGGGG - Intronic
1143653194 17:8277072-8277094 GTCTCAGGGGTGGGGGTGGGGGG + Intergenic
1143730815 17:8881749-8881771 GTGTGGGGTGTGCAGTAGGGAGG - Intronic
1143733571 17:8894867-8894889 GTCTCGGGGGCGGGGTAGGGCGG + Intronic
1143845589 17:9770829-9770851 GAGCTGGGGGTGGGGTTGGGAGG + Intergenic
1144170979 17:12659756-12659778 GTGTCGGGGGGTGGGGTGGGGGG - Intergenic
1144302382 17:13933928-13933950 GTGTTGGGAGGGGAGTTGGGTGG + Intergenic
1144480502 17:15625137-15625159 ATGTTGGAGGTGGAGCTGGGTGG - Intronic
1144575426 17:16426708-16426730 GTGTCGGTGCTGGGGTGGGGAGG - Exonic
1144754717 17:17672083-17672105 GTGGCGGGGGTGGGGAGGGGAGG + Intergenic
1144917808 17:18738608-18738630 ATGTTGGAGGTGGAGCTGGGTGG + Intergenic
1144967554 17:19087585-19087607 GTGGCAGGGGTGGGGGTGGGGGG + Intergenic
1144980365 17:19164480-19164502 GTGGCAGGGGTGGGGGTGGGGGG - Intergenic
1144987857 17:19213752-19213774 GTGGCAGGGGTGGGGGTGGGGGG + Intergenic
1145198763 17:20920383-20920405 GAGTTAGGGGTGGGGTTGGGGGG + Intergenic
1145748442 17:27337826-27337848 TAGTAGGAGGTGGAGTTGGGTGG + Intergenic
1146694753 17:34900013-34900035 GGGTGGGGGGTGTGGTTGGGAGG - Intergenic
1147634530 17:41955346-41955368 GTGTCAGGAGTGGGGTTGGGTGG + Intronic
1147705475 17:42422455-42422477 GCGGCTGGGGTGGGGTTGGGTGG - Intronic
1147743297 17:42680663-42680685 GTGTGGGCGGGGGAGTTGTGTGG - Intronic
1147770632 17:42865745-42865767 GGGTCGGGGGTGGAGCTAGAGGG + Intergenic
1147971744 17:44221902-44221924 GTGTCGGGGTGGGAGTTGCGGGG + Intergenic
1148566650 17:48636867-48636889 GCGTCGGAGATGGAGTTAGGAGG - Intergenic
1148578835 17:48729250-48729272 GAGTCGGGGGTGGGGCTGGGAGG + Intergenic
1148853154 17:50564502-50564524 GAGTCGGGGGAGGAGAGGGGGGG + Intronic
1149389398 17:56174117-56174139 TTGTGGGTGGTGCAGTTGGGAGG + Intronic
1149627334 17:58089045-58089067 GTGTCGGTGCTGGAGTTGCAGGG + Intronic
1149856705 17:60088948-60088970 AAGTTGGGGGTGGAGGTGGGCGG - Intergenic
1150137142 17:62702244-62702266 GTGGAGGAGGTGGAGTTGGTGGG + Intronic
1150289034 17:63971256-63971278 GGGTAGGGGGTGGAGGGGGGTGG + Intronic
1150292213 17:63988465-63988487 GTGGCCTGAGTGGAGTTGGGGGG - Intergenic
1150467075 17:65403009-65403031 ATGTCGGGGGTAGAGTGGGTAGG + Intergenic
1150727978 17:67666941-67666963 GTCTCAGGGGTGGGCTTGGGAGG - Intronic
1151087439 17:71396989-71397011 GTGTTGGGGGTGGGGGTAGGTGG + Intergenic
1151165718 17:72202009-72202031 GTGGGGTGGGGGGAGTTGGGAGG - Intergenic
1151212051 17:72551876-72551898 GTGGGGTGGGGGGAGTTGGGAGG - Intergenic
1151293531 17:73166788-73166810 GTGAAGGTGGTGGAGGTGGGAGG - Intronic
1151441031 17:74129307-74129329 GTGGCGGGGGTGGTGGCGGGAGG - Intergenic
1151459434 17:74245878-74245900 GGGTCGGGGGTGGGGAAGGGAGG - Intronic
1151475620 17:74342979-74343001 GTGACCGGGGTGGGGCTGGGAGG - Intronic
1151493625 17:74446726-74446748 GAGCCGAGGGGGGAGTTGGGGGG + Intronic
1151538300 17:74750765-74750787 TTGTGGGGGGTGGGGGTGGGTGG - Intronic
1152235798 17:79137662-79137684 GTGTCGGGGGAGGAGGCGGATGG + Intronic
1152352863 17:79793055-79793077 GAGACGGGGGTGGAGTGGAGGGG + Exonic
1152572204 17:81125798-81125820 GCCTAGGGGGTGGAGTGGGGTGG + Intronic
1152619991 17:81358338-81358360 GTGGCGGGGGTGGGGTTGCGAGG + Intergenic
1152739097 17:82011294-82011316 GGGGCGGGGGTGGGGCTGGGGGG + Intronic
1152753928 17:82079074-82079096 ATGGCGGGGGTGGGGTGGGGTGG + Exonic
1152950458 17:83227251-83227273 GGGTCGGGGGAGGAGTGGGGAGG + Intergenic
1153068442 18:1076494-1076516 CTTTCGGAGGTGGAGGTGGGAGG + Intergenic
1153294794 18:3535110-3535132 GTGTTGGGGGTGGTGGTGGCAGG + Intronic
1153379949 18:4427292-4427314 AGGTTGGAGGTGGAGTTGGGAGG + Intronic
1153385802 18:4494056-4494078 GAGGCCGGGGTAGAGTTGGGGGG - Intergenic
1153942587 18:9990741-9990763 GTGTTTGGGGTGGTGTTGGTGGG + Intergenic
1154131502 18:11740326-11740348 GTGTGGGGTGTGGAGTGGGCAGG - Intronic
1154175507 18:12085560-12085582 TTGTTGGGGGTGGAAGTGGGGGG + Intergenic
1154177437 18:12094420-12094442 GTGGTGGGGGTAGAGTTGGGTGG + Intronic
1154177545 18:12094705-12094727 GTGGTGGGGGTAGAGTTGGGTGG + Intronic
1154415944 18:14175299-14175321 TTTTGGGGGGTGGAGGTGGGGGG - Intergenic
1155498480 18:26464985-26465007 TTGTCGGGGATGGAGGTTGGGGG + Intronic
1156385387 18:36599955-36599977 GTGTTTGGGGTGGGGGTGGGGGG + Intronic
1156637191 18:39046041-39046063 GTGTCTGGGATGAAGTTGAGTGG - Intergenic
1156968649 18:43128158-43128180 GTGTAGTGAGTGGATTTGGGTGG + Intergenic
1157066105 18:44352439-44352461 GTGGGGTGGGGGGAGTTGGGAGG + Intergenic
1157353702 18:46914562-46914584 GTGTCGGGGGTGGAGTTGGGGGG - Intronic
1157399143 18:47372378-47372400 CTGCCTGGGGTGGAGTTTGGGGG + Intergenic
1158470908 18:57735970-57735992 CTGTTGGGGGTGGGGGTGGGGGG - Intronic
1158517040 18:58139280-58139302 GGGTCGGGGGAGGGGTTGGGAGG - Intronic
1158841407 18:61392173-61392195 GAGTAGGGGGTGGGGTGGGGTGG - Intronic
1158856490 18:61547709-61547731 GGGGCGGGGGTGTAGTGGGGGGG - Intronic
1158971578 18:62673083-62673105 GTCTTGGGGGAGGAGTGGGGAGG - Intergenic
1160067227 18:75586904-75586926 TTGAGGGGGGTGGAGGTGGGGGG + Intergenic
1160135763 18:76270205-76270227 GTGTTGGGGGTGGATTTGAAGGG - Intergenic
1160266424 18:77343328-77343350 GTGTTGGAGGCGGTGTTGGGAGG + Intergenic
1160266439 18:77343367-77343389 GTGTTGGAGGGGGTGTTGGGAGG + Intergenic
1160266475 18:77343457-77343479 GTGTTGGAGGGGGTGTTGGGAGG + Intergenic
1160506132 18:79427696-79427718 GTGCAGTGGGTGGGGTTGGGGGG + Intronic
1160814170 19:1027726-1027748 GCGTCGGGGGAGGGGGTGGGCGG - Intronic
1160973604 19:1781254-1781276 GTGTGGGTGGTGGAGTTGTGTGG - Intergenic
1161021487 19:2013579-2013601 GTGGCGGAGCTGGAGGTGGGTGG + Intronic
1161125295 19:2552839-2552861 GTGGGGGGGGTGGAGCCGGGAGG - Intronic
1161273708 19:3404179-3404201 GTGTTGGGGGTGGGGGTGTGGGG + Intronic
1161312714 19:3603782-3603804 GGGTGGGGAGTGGAGGTGGGGGG - Intronic
1161389028 19:4011687-4011709 GTGTGGGGTGTGGAGGTGTGTGG + Intronic
1161389033 19:4011704-4011726 GTGTGGGGTGTGGAGGTGTGTGG + Intronic
1161389038 19:4011721-4011743 GTGTGGGGTGTGGAGGTGTGTGG + Intronic
1161389043 19:4011738-4011760 GTGTGGGGTGTGGAGGTGTGTGG + Intronic
1161389048 19:4011755-4011777 GTGTGGGGTGTGGAGGTGTGTGG + Intronic
1161389053 19:4011772-4011794 GTGTGGGGTGTGGAGGTGTGTGG + Intronic
1161389058 19:4011789-4011811 GTGTGGGGTGTGGAGGTGTGTGG + Intronic
1161389063 19:4011806-4011828 GTGTGGGGTGTGGAGGTGTGTGG + Intronic
1161389068 19:4011823-4011845 GTGTGGGGTGTGGAGGTGTGTGG + Intronic
1161389092 19:4011906-4011928 GTGTGGGGTGTGGAGGTGTGTGG + Intronic
1161389097 19:4011923-4011945 GTGTGGGGTGTGGAGGTGTGTGG + Intronic
1161389102 19:4011940-4011962 GTGTGGGGTGTGGAGGTGTGTGG + Intronic
1161389107 19:4011957-4011979 GTGTGGGGTGTGGAGGTGTGTGG + Intronic
1161389112 19:4011974-4011996 GTGTGGGGTGTGGAGGTGTGTGG + Intronic
1161389117 19:4011991-4012013 GTGTGGGGTGTGGAGGTGTGTGG + Intronic
1161389122 19:4012008-4012030 GTGTGGGGTGTGGAGGTGTGTGG + Intronic
1161389127 19:4012025-4012047 GTGTGGGGTGTGGAGGTGTGTGG + Intronic
1161389132 19:4012042-4012064 GTGTGGGGTGTGGAGGTGTGTGG + Intronic
1161494711 19:4580870-4580892 GGGTTGGGGGTGGCGTTGGGGGG - Intergenic
1161550826 19:4911117-4911139 TTGTTGGGGGGGGAGGTGGGAGG - Intronic
1161573461 19:5042811-5042833 GTGTCGGCGGTGGGGCCGGGTGG - Intronic
1161654826 19:5507742-5507764 GTGGCTGGGGTGGAGGGGGGAGG + Intergenic
1162737231 19:12753455-12753477 CTGTCGGGGTTGGATTTGAGGGG - Intronic
1162836047 19:13318628-13318650 GGATGGGGGCTGGAGTTGGGTGG + Intronic
1163118147 19:15200366-15200388 GTGTCGGGGGCGGGGTGGGGGGG + Intronic
1163237943 19:16040188-16040210 GTGGCGGGGGTGGGGGTGGGGGG - Intergenic
1163262484 19:16199592-16199614 GTGCTGGGGGTGGGGTGGGGCGG - Intronic
1164476093 19:28577090-28577112 GTGTGAGGGGTGGGGTGGGGCGG - Intergenic
1164594634 19:29525385-29525407 GCGGCGGGGGTGGGGTGGGGTGG - Intergenic
1164656510 19:29925766-29925788 GTGTTGGGGGTGGGGTTGGAGGG + Intronic
1164694495 19:30233204-30233226 GTGTCGGGGGTTGGGGCGGGGGG + Intronic
1164767343 19:30781951-30781973 GTGCCCTGGGTGGGGTTGGGGGG + Intergenic
1165154310 19:33777926-33777948 GTGTCGGGGGTGCAGGTGTCGGG + Intergenic
1165597889 19:37026167-37026189 CTGGCGGGGGTGGGGTTGGGGGG + Intronic
1165804616 19:38572865-38572887 GAGTCAGGGCTGGAATTGGGGGG - Intronic
1166017315 19:39992332-39992354 CTGTCAGGGGTGGTGTTGGTTGG - Intronic
1166226160 19:41396838-41396860 GTGTGGGGGGTGGGGGTGGGAGG + Intronic
1166690716 19:44820170-44820192 GTGTTGGGGCTGGAGGTTGGGGG - Intronic
1166809417 19:45506858-45506880 GGGTCGGGGGTGGGGTGGGGTGG - Intronic
1166976971 19:46610468-46610490 GGGTGGGGGGTGGGGTGGGGAGG - Exonic
1167198188 19:48045056-48045078 GTGTTGGGGCTGGAGATGGTGGG + Intergenic
1167230393 19:48279439-48279461 GTGTGGGGGGCGGGGGTGGGGGG + Intronic
1167253805 19:48415503-48415525 GTGTCAGGGGCGGGGTTTGGAGG + Intronic
1167372255 19:49090184-49090206 TTGTAGGGGGTGGGGGTGGGAGG + Intronic
1167607911 19:50491323-50491345 GAGTCGGGGGTGGGGTTGGGCGG + Intergenic
1167636694 19:50659769-50659791 GTGTAGGGGGTGGGGGGGGGAGG - Intronic
1167711758 19:51115944-51115966 GTGTAGGAGGTGAAGTGGGGTGG - Intergenic
1168400541 19:56083774-56083796 GGGTGGGGGGTGGGGTGGGGGGG + Intergenic
1168564976 19:57415145-57415167 GTGGCGGCTGTGGAGGTGGGAGG + Intronic
1168567778 19:57439230-57439252 GTGGCGGTGGTGGAAGTGGGAGG + Intronic
1168719495 19:58547073-58547095 GGGTGGGGGGTGGGGTGGGGTGG + Intronic
924988104 2:288886-288908 GGGGCGGGGGCGGAGTTGAGGGG - Intergenic
925003480 2:424653-424675 GTGGAGGTGGTGGAGGTGGGTGG - Intergenic
925249875 2:2422916-2422938 TTGTGGGGGGTGGGGTGGGGCGG + Intergenic
925333838 2:3078581-3078603 GTGTGGGAGGTGGTGTTTGGGGG - Intergenic
925611453 2:5706013-5706035 GAGGCAGGGGTGGAGCTGGGGGG + Intergenic
925695309 2:6571051-6571073 GTTTTGGGGCTGGAGTAGGGAGG - Intergenic
925861783 2:8184552-8184574 GTGTGGTGTGGGGAGTTGGGAGG + Intergenic
926223032 2:10948719-10948741 GTGCCTGGTGTGGAGTTGGTGGG + Intergenic
926831168 2:16963704-16963726 GGGTTGGAGATGGAGTTGGGAGG + Intergenic
927485025 2:23482708-23482730 GAGACAGGGGTGGAGTTGGAGGG - Intronic
927913415 2:26917527-26917549 GGGTTGGGTGTGGGGTTGGGGGG + Intronic
927952823 2:27184932-27184954 TGGTTGGGGGTGGGGTTGGGAGG - Intergenic
928149546 2:28813431-28813453 GTGTTGGGGCTAGACTTGGGTGG - Intronic
928509320 2:31987240-31987262 GTGTGGGGGGCTGAGGTGGGAGG - Intronic
929294268 2:40228810-40228832 GTGTCAGGGGTGGAGGAGGGTGG + Intronic
929433366 2:41907540-41907562 GTGTCAGGGGTGGGGTAGGATGG - Intergenic
929911627 2:46094621-46094643 CTGTCGGGGATGGGGTTGGGAGG + Intronic
930027559 2:47038642-47038664 GTGTCGGGGGGGTGGGTGGGGGG - Intronic
930198548 2:48531276-48531298 GTGGGGGTGGGGGAGTTGGGAGG - Intronic
930649446 2:53950169-53950191 GGGTCGGGGGCTGAGGTGGGAGG + Intronic
930686505 2:54313666-54313688 GGGTAGGGGGAAGAGTTGGGAGG + Intergenic
931255601 2:60569480-60569502 GTGTCGGGGGTGGGGGCGCGCGG - Intergenic
931489162 2:62725611-62725633 CTGGTGGGGGTGGAGTTGGATGG + Intronic
931561162 2:63562367-63562389 CTGTCGGGGGTTGTGGTGGGAGG + Intronic
932467576 2:71933439-71933461 GTGCTGGGGGCAGAGTTGGGTGG + Intergenic
932605548 2:73163174-73163196 GTGTCGGGGGTGGGGTGGAGAGG + Intergenic
932687379 2:73883514-73883536 GTGGTGGGGCTGGAGTGGGGAGG + Intergenic
932768008 2:74483243-74483265 GAGTCGAGGGTAGAGTGGGGAGG + Intronic
932981764 2:76677197-76677219 GTGGCGTGGGGGGAGTGGGGAGG + Intergenic
933164695 2:79063269-79063291 GTGTGGGGAGGGGTGTTGGGGGG + Intergenic
934100455 2:88648395-88648417 CTTTCGGAGGTGGAGGTGGGAGG + Intergenic
935173663 2:100629567-100629589 GTGCAGGGGGTGGAGTCGAGCGG - Intergenic
935240236 2:101171596-101171618 GGGGCGGGGGTGGTGGTGGGAGG - Intronic
935492041 2:103733509-103733531 GTGGCGGGGATGTAGGTGGGTGG + Intergenic
936096640 2:109535366-109535388 GTGACTGGGAGGGAGTTGGGAGG - Intergenic
937166190 2:119820102-119820124 GTGTGGGAGGTCGAGGTGGGAGG - Intronic
937303604 2:120857766-120857788 GTGGTGGGGGTGGGGGTGGGGGG - Intronic
937899914 2:127012042-127012064 GAGGCGGGGGTGGGGGTGGGGGG - Intergenic
937955137 2:127417896-127417918 GTGTTGGGGGTGGGGATTGGGGG + Intergenic
938312330 2:130301455-130301477 GTGGTGGGGGTGGTGTGGGGAGG + Intergenic
938318527 2:130346296-130346318 GTGTCTGGGGTGGGGAGGGGAGG + Intronic
938668990 2:133569079-133569101 GTGTCGGGGGTGGTGCAGGTGGG - Intergenic
939776348 2:146392498-146392520 GGGTCGCGGGTGAAGTTGGGGGG - Intergenic
939990901 2:148875958-148875980 GTGGCGGGGGTGGGGATGGGGGG + Intronic
940538600 2:154980706-154980728 GTGGGGTGGGTGGAGGTGGGAGG - Intergenic
941226586 2:162857194-162857216 TTTTTGGGGGTGGAGTTGGGGGG + Intergenic
941930511 2:170934501-170934523 TTGTCGGAGGTGGAGGCGGGTGG - Intronic
942186232 2:173427339-173427361 ATGGCGGGGCTGGAGTTTGGGGG + Intergenic
942732124 2:179072192-179072214 GTGGCGAGGGTGGTGTGGGGTGG - Intergenic
942906474 2:181187147-181187169 TTGTCGGGGGTGGGGGTTGGAGG - Intergenic
943278795 2:185902985-185903007 GGGTCGGGGGTGGGGGTGGATGG + Intergenic
944060068 2:195563150-195563172 GGGTGGGGGGTGGCGGTGGGTGG - Intergenic
944506792 2:200420874-200420896 GTGTTGGCGGTGGGGTTGGGGGG - Intronic
944587580 2:201186133-201186155 GGGTCTGTGGTGGAGATGGGAGG + Intronic
944803514 2:203259339-203259361 GTGTTGGGGGTGGGGCTTGGTGG + Intronic
945067195 2:205957253-205957275 GTGTGTGGGGAGGAGTGGGGGGG + Intergenic
945722042 2:213429343-213429365 GTGGTGGGGGTCAAGTTGGGTGG - Intronic
945868899 2:215205761-215205783 GTGTTGGGGGTGGGGTGGGGGGG - Intergenic
946026785 2:216676699-216676721 GAGTCGGGGCTGGGGGTGGGAGG + Exonic
946151789 2:217778766-217778788 TTGCCGGGGGTGGGGTGGGGTGG - Intergenic
946306540 2:218859776-218859798 GAGCCGGGGGCGGAGGTGGGAGG - Intergenic
946631880 2:221678180-221678202 TGGTAGGGGCTGGAGTTGGGGGG + Intergenic
947196487 2:227573316-227573338 ATGATGGTGGTGGAGTTGGGAGG + Intergenic
947527418 2:230886976-230886998 GGGTGGGGGGTGGGGGTGGGAGG + Intergenic
948106688 2:235420141-235420163 GGGTGTTGGGTGGAGTTGGGTGG - Intergenic
948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG + Intronic
948563794 2:238870940-238870962 GTGTGGGGTGTGGGGTTTGGGGG - Intronic
948563913 2:238871517-238871539 GTGTGGGGTGTGGGGTTTGGGGG - Intronic
948572007 2:238923591-238923613 GTGGCGGGGGTTGGGTGGGGAGG - Intergenic
948656716 2:239480723-239480745 GTGGCGGGTGTGGAGTGGGCAGG - Intergenic
948695679 2:239732073-239732095 GGGTTGGGGGTGGAGTGGGAGGG - Intergenic
948716987 2:239871490-239871512 GGGTCGGGGAGGGAGATGGGGGG - Intergenic
948791401 2:240379240-240379262 GTGTTGTGGGTGGAGCTTGGGGG - Intergenic
948988971 2:241542169-241542191 GCTTCGGGGGTTGGGTTGGGTGG - Intergenic
949079891 2:242088506-242088528 GTGCCGGGCGTGGAGGTGTGGGG - Intergenic
1169934361 20:10866882-10866904 GTGGTTGGGGTGGAGGTGGGTGG - Intergenic
1171795658 20:29564244-29564266 GTGAGGTGGGTGGGGTTGGGGGG + Intergenic
1171852773 20:30320217-30320239 GTGAGGTGGGTGGGGTTGGGGGG - Intergenic
1172252592 20:33490223-33490245 GTGTCGCGGGTAGAGGCGGGCGG + Intronic
1172636060 20:36410773-36410795 GTGTTGGAGGTGGGGTTTGGTGG - Intronic
1173292255 20:41725203-41725225 GAGATGGGGGTGGAGTGGGGAGG - Intergenic
1173455241 20:43196427-43196449 GTGTGTGGGGAGGGGTTGGGAGG - Intergenic
1173738543 20:45378986-45379008 CTGTGGGAGGTGGAGGTGGGCGG - Intronic
1173846599 20:46192565-46192587 GAGTGGGGGGTGGAGTGGGAGGG + Intronic
1173985060 20:47254718-47254740 GTGGTGGGGGTGGGGTGGGGTGG + Intronic
1173988691 20:47283038-47283060 GTGTTGGGGGTGGGGTTGGTGGG - Intronic
1174127240 20:48315604-48315626 GTGTGGGGTGTGGGGTGGGGAGG + Intergenic
1174339624 20:49887720-49887742 GTGTCTAGGGAGGAGGTGGGAGG - Intronic
1174444115 20:50579033-50579055 GTGTTGGAGGTGGGGCTGGGTGG - Intronic
1174925721 20:54757123-54757145 GTGGGGTGGGTGGAGTGGGGAGG + Intergenic
1175074951 20:56364389-56364411 GTGTCGGGGAGGGGGTTGTGAGG - Intronic
1175234275 20:57499069-57499091 GTGACGGGGGGGGGGTGGGGGGG + Intronic
1175251127 20:57610809-57610831 GTCTCGGGGGTGGAGGGGGCGGG - Intronic
1175413402 20:58786089-58786111 GGGCGGGGGGTGGAGGTGGGTGG - Intergenic
1175463774 20:59175224-59175246 GTGGTGGGGGTGGGGGTGGGTGG + Intergenic
1175491584 20:59384037-59384059 GTGATGGGGGAGGAGGTGGGGGG + Intergenic
1175979183 20:62728374-62728396 GAGGAGGGGGTGGAGCTGGGTGG + Intronic
1176026125 20:62986481-62986503 GTGCAGGGGGTGCAGGTGGGCGG + Intergenic
1176027191 20:62991949-62991971 GTGTTGGAGGTGGAGCTTGGTGG + Intergenic
1176859859 21:14004457-14004479 GGGTTGGGGGTGGAGCGGGGTGG + Intergenic
1176867207 21:14060228-14060250 GGGGGGGGGGTGGAGGTGGGGGG - Intergenic
1177140229 21:17350592-17350614 GTGTCGGGGGATGAGATGGAAGG - Intergenic
1177790090 21:25713554-25713576 GTCTGGGGGGTGGGGTGGGGCGG + Intronic
1177871910 21:26583845-26583867 CAGTCTTGGGTGGAGTTGGGGGG - Intergenic
1178140230 21:29674529-29674551 GTGTCGGGGGGGAACTTGGTGGG + Intronic
1178189002 21:30258549-30258571 GTGTCCTAGGTGGGGTTGGGAGG - Intergenic
1178261202 21:31101139-31101161 GTGAGGGGAGTGGGGTTGGGGGG + Intergenic
1178340671 21:31783524-31783546 GTTTCGGGGGTGGGGGTGGAGGG - Intergenic
1178798638 21:35770299-35770321 CTTTGGAGGGTGGAGTTGGGAGG + Intronic
1179141539 21:38730202-38730224 GGGGCTGGGGTGGAGTTGGTGGG - Intergenic
1179512288 21:41881003-41881025 GTGGTGGGAGTGGGGTTGGGCGG - Intergenic
1179590218 21:42403218-42403240 GAGGCGGGGGTGGTGGTGGGTGG - Intergenic
1179721098 21:43316396-43316418 GTGTCGGGGGTGTCGGAGGGGGG + Intergenic
1180084325 21:45501000-45501022 GTGTTGGGTGTGGAGTGTGGGGG + Intronic
1180084342 21:45501076-45501098 GTGTTGGGTGTGGAGTGTGGGGG + Intronic
1180308011 22:11145477-11145499 GAGGAGGGGCTGGAGTTGGGTGG + Intergenic
1180469628 22:15642959-15642981 GTGGCGGGGGTGGTGGAGGGAGG + Intergenic
1180546487 22:16507290-16507312 GAGGAGGGGCTGGAGTTGGGTGG + Intergenic
1180995758 22:19964464-19964486 CTGTGGTGGGTGGAGATGGGTGG + Intronic
1181953249 22:26570163-26570185 GTGTGTGGGGTGGAGTGGGGCGG - Intronic
1182110702 22:27721201-27721223 GTGGCGGGGGGGGTGTTGGGGGG - Intergenic
1182212702 22:28690089-28690111 GAGGAGGGGCTGGAGTTGGGTGG - Intronic
1182776017 22:32831496-32831518 ATGTGGGGGTCGGAGTTGGGGGG + Intronic
1182924680 22:34111176-34111198 GTGTTAGGGGTGGGTTTGGGTGG + Intergenic
1183189269 22:36311359-36311381 GTTTCGGGGGGGGAGGTGCGGGG - Intronic
1183232590 22:36592238-36592260 GGGTGGGGGGTGGAGCGGGGAGG + Intronic
1183521461 22:38298284-38298306 GTCCCAGGGGTGGGGTTGGGTGG - Intronic
1183699792 22:39444791-39444813 GTGGCTGGGGTGGAGATGGGAGG - Intergenic
1183848218 22:40561161-40561183 GTGGTGGGGGTGGATGTGGGTGG + Intronic
1183917427 22:41133157-41133179 GTTTCCGGGGTGGGGGTGGGGGG - Intronic
1183990556 22:41594440-41594462 GTGGCGGGGGTGGGGGTGGGGGG + Intergenic
1184647335 22:45903396-45903418 GTGGCGGGGCTGGGGCTGGGTGG + Intergenic
1184667701 22:45997375-45997397 GGGGAGGGGGTCGAGTTGGGAGG - Intergenic
1184805919 22:46794790-46794812 GTGTCAGTGGTGCTGTTGGGAGG + Intronic
1185012226 22:48320750-48320772 GTGTCAGGGCTGGGCTTGGGAGG - Intergenic
949309970 3:2686392-2686414 GTGTCGGGGGTAGGGTTGGGTGG - Intronic
949943686 3:9173751-9173773 ATGGCAGGGGTGGAGGTGGGTGG - Intronic
949995336 3:9612108-9612130 GTGTGGGGGGGGGGGATGGGGGG + Intergenic
950070048 3:10144548-10144570 GTGTGGAGGCTGGAGTTTGGTGG + Intronic
950903945 3:16520572-16520594 GGGTGGGGGGTGGGGTGGGGAGG + Intergenic
952157935 3:30663975-30663997 TTTTGGGGGGGGGAGTTGGGGGG + Intronic
953043573 3:39276108-39276130 GTGAAGATGGTGGAGTTGGGAGG + Intronic
953367526 3:42358857-42358879 GGGTCGGGGGTGGTGCAGGGAGG + Intergenic
953449897 3:42997253-42997275 GTGTCTGGGGTTGAGTTGCTGGG + Intronic
953633866 3:44644993-44645015 ATGTCAGGTGTGGAGTTGGGCGG + Exonic
953714642 3:45306950-45306972 GAGCCGGGGGTGGGGTGGGGGGG - Intergenic
953932005 3:47010114-47010136 GTCTCGGGGTTGGGGGTGGGGGG + Intergenic
954080921 3:48211971-48211993 CTGTCGGGGAGGGAGGTGGGGGG + Intergenic
954458460 3:50612386-50612408 GTGTCGGGTGTCGGATTGGGTGG + Intronic
954461211 3:50628007-50628029 GTGTTGGGGGTGGGGATGGAAGG + Intronic
954924877 3:54225095-54225117 GTGGGGTGGGTGGAGTGGGGAGG - Intronic
954945171 3:54417792-54417814 GTGTGGGGGGGGGGGTGGGGGGG + Intronic
955213376 3:56962633-56962655 TTGGAGGGGTTGGAGTTGGGGGG + Intronic
955782717 3:62503055-62503077 GTCTCGGTGGTGGTGGTGGGTGG - Intronic
956171663 3:66438062-66438084 GTGGCTGGTGTGGAGTGGGGAGG + Intronic
956555789 3:70521065-70521087 CAGTCGGGGGTGGGGGTGGGTGG + Intergenic
956718096 3:72095920-72095942 GGGTGGGGTGGGGAGTTGGGAGG + Intergenic
956787475 3:72654528-72654550 GTGTCGGGGGTGGGGGGGTGTGG - Intergenic
956915372 3:73865458-73865480 GGGTCAGGGGTGAAGTGGGGAGG + Intergenic
957763236 3:84587271-84587293 TTGTTGAGGGTGGAGGTGGGAGG - Intergenic
959223606 3:103553378-103553400 GTGTGGGGGGTGGGCTGGGGGGG + Intergenic
959370763 3:105522575-105522597 GTGTCAGGAGTAGGGTTGGGAGG - Intronic
959604508 3:108227425-108227447 TGGTCGGGGGTGGGGGTGGGTGG + Intergenic
963500432 3:146119061-146119083 GTGCTGGAGGTGGGGTTGGGTGG + Intronic
963759366 3:149271673-149271695 GTCTGGGGGGTGAAGGTGGGAGG - Intergenic
964175249 3:153820199-153820221 GTGATGGGAGTGGAGTGGGGTGG - Intergenic
964196458 3:154070526-154070548 GTGTTGGAGGTGGAGCTTGGTGG - Intergenic
965519820 3:169661296-169661318 GTGTGGGGGGGGGAGTTGGCGGG - Intronic
966322846 3:178720122-178720144 GTGGGGTGGGTGGAGTGGGGAGG - Intronic
966592894 3:181701001-181701023 GTGTAGGGGGTGGAGTAGGAAGG + Intergenic
966696268 3:182793460-182793482 GGGGCGGGGGTGGGGTTGCGGGG + Intergenic
966753749 3:183348404-183348426 GGGTCGGGGGTCGGGTAGGGGGG + Intronic
966818602 3:183908291-183908313 GGGTCCGGGGTGGGGTGGGGTGG + Intergenic
966821513 3:183928559-183928581 GTGTGGGCGGTGGGGTTGAGAGG + Intronic
967171975 3:186828760-186828782 GGGGCGGGGGTGGGGGTGGGGGG + Intergenic
967803421 3:193690305-193690327 GTGTGTGGGGTGGGGTGGGGGGG - Intronic
968107893 3:196015303-196015325 GTGTGGGGGGTGGGGAAGGGAGG - Intergenic
968613869 4:1568739-1568761 GTGGCGCGGGTGGGGTGGGGTGG - Intergenic
968613881 4:1568765-1568787 GCGGCGCGGGTGGAGTGGGGTGG - Intergenic
969460799 4:7327806-7327828 TTGCCGGGGGCGGGGTTGGGGGG - Intronic
969589003 4:8110653-8110675 GTGGCGGGGGTGGGGTGTGGGGG + Intronic
971532803 4:27710276-27710298 GTGGCAGTGGTGGAGATGGGTGG + Intergenic
972118941 4:35676986-35677008 GTGGGGTGGGTGGAGTTGGGAGG - Intergenic
972747718 4:41955249-41955271 GGGTAGGGGGAGGAGTTGTGGGG + Exonic
973570481 4:52233943-52233965 GTGTGGGGGGGGGAGGGGGGTGG + Intergenic
973619266 4:52711492-52711514 GTGTTGGGGGTGGAGCAGGAAGG - Intergenic
973634839 4:52852281-52852303 GAGCCGGGGCTGGAGTGGGGAGG - Intergenic
973699855 4:53525823-53525845 GTGTTGGGGTTGGTGTGGGGAGG + Intronic
973765238 4:54156164-54156186 GTGTTGCGGGTGGAGTCTGGTGG - Intronic
973960418 4:56104283-56104305 GTTTGGTGGGTGGAGGTGGGAGG + Intergenic
974339560 4:60598044-60598066 GTGTAGGGTGTGGGGGTGGGCGG - Intergenic
975689780 4:76951156-76951178 GTATCTGGGGAGGAGTTAGGCGG - Intronic
975708354 4:77133888-77133910 GTGTGGGTAGTTGAGTTGGGGGG - Intergenic
976142968 4:82012097-82012119 CTGTTGGGGGTGGAGGTGGCAGG + Intronic
976556181 4:86453571-86453593 GTGGTGGGGGTGGGGTGGGGGGG - Intronic
976953662 4:90866775-90866797 GTATCGGGGGTGGAGCAGGGTGG + Intronic
978532634 4:109730134-109730156 GGGGCGGGGGCGGGGTTGGGGGG + Intergenic
978977210 4:114892737-114892759 TTGTGGGGGTGGGAGTTGGGAGG + Intronic
979086944 4:116425253-116425275 GTGGGGTGGGGGGAGTTGGGAGG - Intergenic
979349520 4:119628277-119628299 GGGTCGGGGGTGAGGGTGGGAGG + Intronic
979570671 4:122220109-122220131 GTGTCCGGGTTGCAGTGGGGTGG + Intronic
979713691 4:123811067-123811089 GTGTGGGGGGGGGTGTGGGGGGG - Intergenic
981115107 4:140980558-140980580 GTGTAGTGGGAGGAGCTGGGTGG + Intronic
981542858 4:145863717-145863739 GGGTGGGGGGTGGAGGTGGTGGG + Intronic
981698153 4:147579894-147579916 GTGTGGTGGGTGGAGGTGAGAGG - Intergenic
982078804 4:151766574-151766596 GACTCGGGGGTGGGGTTGTGGGG + Intergenic
982329935 4:154170154-154170176 GTGTGGTGGGGGGAGTGGGGAGG - Intergenic
982436554 4:155387608-155387630 GTGTGGTGGGAGGAGCTGGGTGG - Intergenic
982655074 4:158137718-158137740 CTGGCGGGGGTGGAGCAGGGGGG - Intronic
982840238 4:160175087-160175109 GAGTCGGGGGTGGGTGTGGGTGG - Intergenic
984031821 4:174613354-174613376 GTGTGGGAGGTGGGGTTTGGTGG - Intergenic
984199383 4:176698584-176698606 GTGTGTGTGGGGGAGTTGGGGGG + Intronic
985469831 5:33370-33392 GTGTGGGGGGTGGGGAAGGGAGG - Intergenic
986695632 5:10352774-10352796 GTGTGAGCGGTGGAATTGGGAGG - Intergenic
986775564 5:11011041-11011063 GTGTGTGGGGTGGAGTGGAGGGG + Intronic
986780784 5:11063797-11063819 GTGAGGGGGGTGGGGTTGGGGGG + Intronic
986864909 5:11974764-11974786 GTGTCGGGGGTAGTGCCGGGTGG - Intergenic
986897252 5:12385258-12385280 GTGGCAGGGGTGGAGTCTGGGGG + Intergenic
987076432 5:14386307-14386329 GGGACGGGGGTGCTGTTGGGTGG + Intronic
987114952 5:14718817-14718839 GGGGGGGGGGTGGTGTTGGGAGG - Intronic
988051444 5:26036245-26036267 ATGTCGGAGGTGGGGTTTGGTGG - Intergenic
988077130 5:26367311-26367333 GTGTCGGTGGTGGTGATGGATGG + Intergenic
988298415 5:29393254-29393276 GTGTAGTGGGTGGTGTTGGAGGG - Intergenic
988550976 5:32200609-32200631 GGGAGGGGAGTGGAGTTGGGAGG + Intergenic
988855835 5:35227392-35227414 ATGTGGGGTGTGGGGTTGGGGGG + Intronic
990974319 5:61544335-61544357 GGGTGGGGGGTGGGGATGGGAGG + Exonic
991346238 5:65671640-65671662 GGGGCGGGGGTGGGGGTGGGGGG + Intronic
991587319 5:68214942-68214964 GAGTCGGGGGCGGGGTTGGCGGG - Intergenic
991654762 5:68892892-68892914 GTGTCTGTGTTGGGGTTGGGTGG - Intergenic
991733476 5:69610832-69610854 GTGTTGGGGGTGTTGGTGGGGGG - Intergenic
991809910 5:70465978-70466000 GTGTTGGGGGTGTTGGTGGGGGG - Intergenic
991861478 5:71017018-71017040 GTGTTGGGGGTGTTGGTGGGGGG + Intronic
991945558 5:71895334-71895356 ATGTCTGGGGTGGAGCTGGCAGG + Intergenic
992147776 5:73869212-73869234 GTGTGTGGGGTGGAGGGGGGTGG + Intronic
992369394 5:76127228-76127250 GTGTTGGGGGTTGTGTAGGGTGG + Intronic
992768804 5:80028180-80028202 GTGGCGGAGGTGGGGTGGGGTGG - Intronic
993658179 5:90598071-90598093 GTGTGGAGGGCGTAGTTGGGAGG + Intronic
994283811 5:97939049-97939071 GTGTCGGAGGAGGAGTCTGGTGG + Intergenic
994631963 5:102297287-102297309 GTGATGGGGGTGGGGTGGGGTGG - Intergenic
994798343 5:104335932-104335954 ATGTGGGGGGTGGAGGTGGATGG + Intergenic
995429481 5:112058261-112058283 GGGTCTGGGGCAGAGTTGGGAGG + Intergenic
995763918 5:115595347-115595369 GTTTAGTGGGTGGAGTTGTGGGG - Intronic
996231617 5:121070077-121070099 GTGGGGTGGGTGGAGTGGGGAGG + Intergenic
996949561 5:129109560-129109582 TTGTCTGGGGTGGATTTGGAAGG + Intronic
997108587 5:131048854-131048876 GTGTCGGGGGTGGAGAGGCAAGG + Intergenic
997141415 5:131385045-131385067 CTGGAGGGGGTGGAGGTGGGAGG - Intronic
997692604 5:135836964-135836986 GTGTGGGGGGGGGGGGTGGGGGG - Intronic
998093007 5:139381856-139381878 GTGGCGGGGGACGGGTTGGGGGG + Intronic
998166810 5:139848756-139848778 GGGTTGGGGGTGGGGTAGGGTGG + Intronic
998429139 5:142055267-142055289 GGTTGGGGGGTGGAGTGGGGGGG + Intergenic
998843990 5:146287125-146287147 GGGTGGGGGGTGGAGGTGGGAGG + Exonic
999393537 5:151212014-151212036 TGGTGGGGGGGGGAGTTGGGAGG + Intronic
999948762 5:156626031-156626053 TTGGTGGGGGTGGAGGTGGGGGG + Intronic
999990770 5:157047854-157047876 GTGTGTGTGGTGGGGTTGGGAGG + Intronic
1000164530 5:158635106-158635128 GGGTGGGGGGTGGTGATGGGTGG - Intergenic
1000192610 5:158925777-158925799 GTGTGGTGGGTGGAGATGAGTGG + Intronic
1000326362 5:160175584-160175606 GTGTGGGCGGCGGAGGTGGGGGG - Intergenic
1000558429 5:162755990-162756012 GGGGCGGGGGTGGGGTGGGGGGG - Intergenic
1001357370 5:171041890-171041912 CTGTCGGGGGTGCAGTGGGAGGG - Intronic
1001400072 5:171441114-171441136 GAGTTGGTGGTGGAGCTGGGAGG + Intronic
1001897185 5:175392645-175392667 GTGATGGAGGTGGGGTTGGGGGG - Intergenic
1001924210 5:175624492-175624514 GACTCTGGGGAGGAGTTGGGAGG - Intergenic
1002058881 5:176614465-176614487 GTGTGGGGGGGGGAGGGGGGAGG + Intergenic
1002064277 5:176644284-176644306 GGGTCGGATGAGGAGTTGGGAGG + Intronic
1002097553 5:176840363-176840385 GAGTCGGGGGAGGGGCTGGGCGG + Intronic
1002744690 5:181461066-181461088 GGGTCGGGGGAGGAGTGGGGAGG + Intergenic
1202772758 5_GL000208v1_random:26871-26893 GTGTGGTGGGGGGAGGTGGGAGG + Intergenic
1003128697 6:3376970-3376992 GTGTCGGGGGAAGGGCTGGGTGG + Intronic
1003510890 6:6779509-6779531 GTGTCGGGGGAGTGGTTGGGGGG - Intergenic
1003581872 6:7347500-7347522 GGGTGGGGGGGGGGGTTGGGGGG + Intronic
1003917938 6:10805066-10805088 GTGTCGGGGGGGGGGTGGGGAGG + Intronic
1004193633 6:13486240-13486262 GTGTGGGGGGGGGGGATGGGGGG - Intronic
1004229080 6:13814587-13814609 GCGCCGGGGGTGGGGTGGGGCGG + Intergenic
1005509037 6:26495661-26495683 GTGTAGGGTGTGGGGTTGGGGGG - Intergenic
1005982548 6:30847525-30847547 GTGTGGGGGTGGGGGTTGGGAGG + Intergenic
1006108408 6:31730000-31730022 GTGTGGGGGCCGGAGTTTGGGGG - Intronic
1006328665 6:33373500-33373522 TTTATGGGGGTGGAGTTGGGGGG - Intergenic
1006345002 6:33473845-33473867 GTGTGGGGGGTGGTGGGGGGTGG - Intergenic
1006441491 6:34056389-34056411 GCACCTGGGGTGGAGTTGGGAGG - Intronic
1006811119 6:36821241-36821263 GTGACTGGAGTGGAGTGGGGAGG + Intronic
1007053040 6:38852385-38852407 CTGTCGGGGGAGGAGGGGGGAGG + Intronic
1009504175 6:64453856-64453878 GTGGCGTGGGGGGAGTGGGGAGG + Intronic
1009680254 6:66882321-66882343 GTGTTGGAGGTGGGGCTGGGTGG - Intergenic
1009833363 6:68967599-68967621 GGGGCGGGGGTGGAGGTGGGGGG - Intronic
1010609192 6:77932035-77932057 GGGTTGTGGGTGGAGATGGGAGG + Intergenic
1010900723 6:81424044-81424066 GTGTGTGGGGAGGTGTTGGGGGG + Intergenic
1011696512 6:89918054-89918076 GTGCTGGGGGTGCAGTTGGGTGG + Intergenic
1011874315 6:91938435-91938457 CTGTCGGGGGTGGGGTGAGGTGG - Intergenic
1012160904 6:95885094-95885116 ATGTGGGTGGAGGAGTTGGGAGG + Intergenic
1012316515 6:97787517-97787539 GAAGCGGGGGTGGGGTTGGGGGG + Intergenic
1012382697 6:98639449-98639471 GTGATGGGGGTGGGGGTGGGGGG - Intergenic
1013007015 6:106083209-106083231 GTGTGGGGGGTGAGGGTGGGTGG + Intergenic
1013073791 6:106752523-106752545 GTGGCGGGGGGGTAGTGGGGAGG + Intergenic
1013292653 6:108732491-108732513 GCGTCGGGGGTGGGGGTGGGGGG - Intergenic
1013538997 6:111088550-111088572 GGGCGGGGGGTGGAGTTTGGAGG + Intronic
1013844460 6:114433299-114433321 GTGGGGTGGGTGGAGTGGGGAGG - Intergenic
1015264396 6:131276039-131276061 ATGATGAGGGTGGAGTTGGGTGG + Intronic
1015329556 6:131961649-131961671 GTGTTGGAGGTGGAGCTGGTGGG + Intergenic
1016346261 6:143117206-143117228 GTGTATGGGGTGCAGTTAGGGGG + Intronic
1016421349 6:143886787-143886809 ATGGAGGGGGTGGAGGTGGGAGG - Exonic
1016862947 6:148739729-148739751 GTGTGGGAGGTGGAGGTGGGTGG - Intergenic
1017140609 6:151186276-151186298 GTGGCGGGGGTGGAGGGGGGAGG - Intergenic
1017446600 6:154511755-154511777 GGGTTGGGGGGGGTGTTGGGGGG - Intergenic
1017631095 6:156397182-156397204 TGGTCGGGGGTGGGGGTGGGGGG - Intergenic
1017692028 6:156976405-156976427 TTATGCGGGGTGGAGTTGGGGGG + Intronic
1018046431 6:159969657-159969679 GAGTCGGGGGTGGCTTTGTGCGG + Intronic
1018159907 6:161029240-161029262 TTGGCGGGGGTGGTGTTGGGGGG + Intronic
1018650548 6:165988445-165988467 GGGGCGGGGGTCGGGTTGGGGGG - Intergenic
1018760938 6:166893923-166893945 TAGTTGGGGGAGGAGTTGGGGGG - Intronic
1018862631 6:167722179-167722201 AAGACTGGGGTGGAGTTGGGCGG + Intergenic
1019151451 6:170008680-170008702 GAGCCGGGGGTGGAGTTAGGTGG - Intergenic
1019249601 6:170734607-170734629 GGGTTGGGGGAGGAGTGGGGAGG + Intergenic
1019347930 7:539682-539704 GCGCCGGGGGTGGGGTGGGGTGG + Intergenic
1019405447 7:881345-881367 GTGCCGGGGATGGGGTGGGGTGG - Intronic
1020035300 7:4959997-4960019 GTGTTGGGGGGGGAGTGAGGGGG + Intergenic
1020080919 7:5285258-5285280 GGGTTGGGGGTGGGGTGGGGTGG - Intronic
1020807382 7:12807511-12807533 CTGTGGGAGGTGGAGGTGGGAGG - Intergenic
1021381298 7:19969956-19969978 GGGGGGGGGGTGGTGTTGGGGGG - Intergenic
1021664548 7:22962761-22962783 GGGGCGGTGGTGGGGTTGGGTGG - Intronic
1021912120 7:25396624-25396646 GGGTGAGGGGTGGAGTGGGGGGG + Intergenic
1021926019 7:25534601-25534623 CTCTGGGGGGAGGAGTTGGGAGG - Intergenic
1022339698 7:29456617-29456639 GTGTTGGTGGTGGTGGTGGGGGG - Intronic
1022650131 7:32266897-32266919 GTGGCGGGGGCGGGGTGGGGGGG + Intronic
1022770547 7:33467560-33467582 GTGGAGGTGGCGGAGTTGGGGGG - Intronic
1022784444 7:33624322-33624344 GGGTTGAGGGTGGAGGTGGGTGG - Intergenic
1023473650 7:40552756-40552778 GTGGTGGGGGTGGGGATGGGGGG - Intronic
1023850585 7:44147830-44147852 GTGCCTGGGGTGGAGGTCGGGGG + Exonic
1023921778 7:44635520-44635542 GTGGCTGAGGTGGAGTAGGGAGG + Intronic
1024894235 7:54238783-54238805 GTTTGGTGGGTGGATTTGGGAGG + Intergenic
1025197991 7:56946908-56946930 GGGTTGGGGGTGGGGTGGGGGGG + Intergenic
1025238106 7:57248483-57248505 GTGTGGGGTGGGGAGTGGGGAGG + Intergenic
1025673956 7:63630027-63630049 GGGTTGGGGGTGGGGTGGGGGGG - Intergenic
1026050390 7:66941749-66941771 GTGTTGGGGGGTGAGCTGGGTGG - Intronic
1026060123 7:67018430-67018452 ACGTAGGAGGTGGAGTTGGGAGG + Intronic
1026611642 7:71865171-71865193 GTGTCGGAGGTGGGGTCTGGAGG + Intronic
1026717993 7:72806757-72806779 ACGTAGGAGGTGGAGTTGGGAGG - Intronic
1027162980 7:75815686-75815708 GAATCGGGGGTGGAGTGAGGTGG - Intronic
1027164706 7:75826122-75826144 GTGTTGGGGGTGGGGATGGCAGG - Intergenic
1027246815 7:76373253-76373275 GGTTAGGGGGTGGAGGTGGGAGG + Intergenic
1027353766 7:77337286-77337308 GGGGCGGGGGTGGGGTGGGGGGG + Intronic
1028399012 7:90404273-90404295 GGGGCGGGGGAGGGGTTGGGGGG + Intronic
1028808623 7:95058721-95058743 GGATCGGGGGTGGAGCGGGGTGG + Intronic
1029150131 7:98474381-98474403 GTGGTGGGGGTGGGGTGGGGTGG + Intergenic
1029200993 7:98839116-98839138 GTGTTGGGGGCGGGGTGGGGGGG - Intergenic
1029424387 7:100487030-100487052 GTGTCGGGGGTGGCCCTGGCGGG + Exonic
1030123429 7:106133038-106133060 GTGTGGGGGGGGGGGTTGGGGGG + Intergenic
1030130504 7:106195557-106195579 GTGTGAGGGGTGGCGTAGGGTGG - Intergenic
1030330830 7:108268609-108268631 GGGGCGGGGGTGGGGGTGGGGGG + Intronic
1030881282 7:114882780-114882802 GTATGGGAGGTGGAGTTGGAAGG + Intergenic
1031955073 7:127934608-127934630 GAGTGGGGGGTGGTGTTGAGTGG + Intronic
1032340585 7:131069095-131069117 GGGTGGGGGGGGGGGTTGGGAGG - Intergenic
1032403200 7:131638059-131638081 GAGGTGGGGGTGGAGGTGGGGGG - Intergenic
1032716760 7:134515373-134515395 GTGTCGGGGCGGGGGGTGGGGGG + Intergenic
1033167141 7:139049800-139049822 GTTACGAGGGTGGAGTTGGTAGG - Intronic
1033374416 7:140743572-140743594 GTGGGGTGGGTGGAGTGGGGAGG + Intronic
1033402352 7:141038445-141038467 GTGGGGTGGGTGGAGTGGGGAGG + Intergenic
1033639874 7:143252117-143252139 GTGTCGGAGGTGGGGTCTGGTGG + Intronic
1034174704 7:149091151-149091173 GTCTCGGGGGCGGCTTTGGGAGG - Intergenic
1034405844 7:150901934-150901956 GGGTGGGGGGTGGATTAGGGAGG + Intergenic
1035062582 7:156080068-156080090 GTGCTGGGGGTGGGGTGGGGTGG - Intergenic
1035498495 8:73049-73071 GGGTCGGGGGAGGAGTGGGGAGG - Intronic
1035622135 8:1042803-1042825 GTGTGGGTGGTGGATGTGGGTGG + Intergenic
1035622149 8:1042842-1042864 GTGTGGGTGGTGGATGTGGGTGG + Intergenic
1035622176 8:1042920-1042942 GTGTGGGTGGTGGATGTGGGTGG + Intergenic
1035622206 8:1043018-1043040 GTGTGGGTGGTGGATGTGGGTGG + Intergenic
1035622242 8:1043149-1043171 GTGTGGGTGGTGGACGTGGGTGG + Intergenic
1035622264 8:1043214-1043236 GTGTGGGTGGTGGATGTGGGTGG + Intergenic
1035622278 8:1043253-1043275 GTGTGGGTGGTGGATGTGGGTGG + Intergenic
1035979070 8:4348605-4348627 GTGTTGGGGGTGGGGGAGGGAGG + Intronic
1037130173 8:15399078-15399100 GTGTTGTGGGAGGAGTTCGGTGG + Intergenic
1038295411 8:26287554-26287576 GTGTTGGGGGTGGGGTTGGCAGG + Intergenic
1038355991 8:26829955-26829977 GTCTGGGGGGTGGGGGTGGGTGG + Intronic
1038397110 8:27254784-27254806 GTGTAGGGGGTGGGGTGGGGTGG + Intronic
1039453746 8:37695369-37695391 GTGTCCGAGGTGGGGTGGGGTGG - Intergenic
1039555158 8:38469871-38469893 GGGTTGGGTGAGGAGTTGGGTGG - Intergenic
1041303740 8:56438726-56438748 GTGGGGGGGGTAGTGTTGGGGGG + Intronic
1042529354 8:69798636-69798658 GTGTTGGAGGTGGAGCTTGGTGG - Intronic
1042748582 8:72133928-72133950 GTGTAGTGGGTGGTGTTGGAGGG + Intergenic
1042981647 8:74536253-74536275 CTGTTGGGGGTGGAGGTGGTGGG - Intergenic
1043064243 8:75546513-75546535 TTGTTGGGGAGGGAGTTGGGAGG - Intronic
1043291367 8:78605699-78605721 GTGGTGGGGGTGCAGGTGGGTGG - Intergenic
1043520045 8:81035036-81035058 GTGTCGGTGGTGGCGGTGGGTGG + Intronic
1043833221 8:85015186-85015208 GTGGGGTGGGTGGAGTGGGGAGG + Intergenic
1043887448 8:85618187-85618209 GTGGGGTGGGTGGAGTGGGGAGG - Intergenic
1044448173 8:92302423-92302445 GAGTCGGGGATGGAGTGGGAAGG + Intergenic
1045190461 8:99877102-99877124 GTTTGGGAGGTGGAGGTGGGAGG - Exonic
1045554040 8:103197870-103197892 GTGTTGGAGGTGGGGCTGGGTGG - Intronic
1045684097 8:104693236-104693258 GTATCGGGGGCGGGGGTGGGGGG + Intronic
1047180723 8:122585178-122585200 GTGTCGGCTGTGGGGTGGGGGGG - Intergenic
1047219978 8:122911301-122911323 GTGAAGTGGGTGGAGTTGCGTGG + Intronic
1047266969 8:123315690-123315712 CCGTCCGGGATGGAGTTGGGGGG + Intergenic
1047930954 8:129727997-129728019 CTGTCTGGGGTGGAGTGGAGAGG - Intergenic
1047947610 8:129897689-129897711 GTTTGGGAGGTGGAGGTGGGAGG + Intronic
1047963003 8:130024511-130024533 GTGGCGGGGGTGGGGGTTGGGGG - Intergenic
1047997624 8:130351783-130351805 GTGTCGGAGGTGGGGCTTGGTGG - Intronic
1048375898 8:133822207-133822229 GGGTCTGGGGTGGAGTTGATGGG + Intergenic
1048389510 8:133948156-133948178 GTGTATGGGGTGGGGGTGGGGGG + Intergenic
1048651740 8:136485690-136485712 GTGTTGGAGGTGGGGTTTGGTGG - Intergenic
1048786034 8:138051343-138051365 GTGTGTGGCGGGGAGTTGGGGGG + Intergenic
1048851987 8:138654168-138654190 GGGTCAGGGGTGGAGATGGCTGG + Intronic
1049275364 8:141717579-141717601 GTGTTGTGGGTGGAGCTGCGTGG - Intergenic
1049341462 8:142114818-142114840 GTGTTGGGGCTGGAGGCGGGAGG - Intergenic
1049405857 8:142451573-142451595 GTGTTGGGGAGGGAGCTGGGAGG + Intronic
1049543215 8:143218007-143218029 GTGTTGGGGGTGGTGTTGAGGGG - Intergenic
1049756182 8:144312195-144312217 TTTTCAGGGGTGGAGGTGGGCGG - Exonic
1049790102 8:144468508-144468530 GTGACAGGGGTGGGGTTGGGCGG + Intronic
1051371565 9:16363642-16363664 GTGTCAGGGGAGGACTTGAGAGG + Intergenic
1051524681 9:18030396-18030418 GTGTGGTGGGGGGAGTGGGGAGG + Intergenic
1051779937 9:20679169-20679191 GTGTTGGGGATGGAGGTGTGTGG + Intronic
1052860941 9:33437290-33437312 GTGGGTGGGGTAGAGTTGGGTGG - Intergenic
1052867378 9:33472727-33472749 GTTTGGGAGGTGGAGCTGGGCGG + Intronic
1053323226 9:37118974-37118996 GTGGTGGGGGTGGGGGTGGGGGG + Intergenic
1053419954 9:37970996-37971018 CTGTATGGGGTGGAGTTGGCTGG - Intronic
1053425502 9:38007469-38007491 GCGTCAGGGTGGGAGTTGGGTGG - Intronic
1053790568 9:41683497-41683519 GTGAGGTGGGTGGGGTTGGGGGG - Intergenic
1054085741 9:60741960-60741982 GGGTCGGGGGGGCAGTGGGGAGG - Intergenic
1054178913 9:61895196-61895218 GTGAGGTGGGTGGGGTTGGGGGG - Intergenic
1054474366 9:65562380-65562402 GTGAGGTGGGTGGGGTTGGGGGG + Intergenic
1054658624 9:67685635-67685657 GTGAGGTGGGTGGGGTTGGGGGG + Intergenic
1054971588 9:71094080-71094102 CTGTCAGGGGTGGGGGTGGGGGG + Intronic
1055226816 9:74007077-74007099 CTGTGGGTGGTGGAGTTGAGGGG - Intergenic
1055512954 9:77013346-77013368 GTGGTGGTGGTGGAGTTGGGGGG - Intergenic
1055689647 9:78815935-78815957 GTGTGGGGGGGGGGGTGGGGGGG - Intergenic
1056280803 9:85039652-85039674 GGGTTGGGGGTGGGGTGGGGCGG - Intergenic
1056305142 9:85283089-85283111 GTGAGGGGGATGGTGTTGGGGGG - Intergenic
1056343230 9:85660184-85660206 TTGTGGAGGGTGGAGTGGGGTGG + Intronic
1056512122 9:87316076-87316098 GGGCAGAGGGTGGAGTTGGGGGG + Intergenic
1056725159 9:89107724-89107746 GGGTTGGGGGTGGGGTGGGGTGG + Intronic
1057146754 9:92764146-92764168 GAGTGTGGGGTGGGGTTGGGAGG - Intronic
1057293598 9:93822651-93822673 ATGTTGGGGGAGGATTTGGGTGG - Intergenic
1057383632 9:94589731-94589753 GGGTGGGGGTTGGTGTTGGGGGG - Intronic
1057411034 9:94816683-94816705 GAGTTGGAGGTGGAATTGGGTGG + Intronic
1057961852 9:99464760-99464782 GAGGTGGGGGTGGAGTAGGGGGG + Intergenic
1059163477 9:112057129-112057151 GTGGTGGGGATGGAGTGGGGAGG - Intronic
1059414897 9:114156269-114156291 GGGTCGGGGGTGGGGGTGGGTGG + Intronic
1059464597 9:114459913-114459935 GTGTTGGAGGTGGGGCTGGGAGG + Intronic
1059717559 9:116927724-116927746 ATCTCGGGGCTGGAGGTGGGGGG + Intronic
1060234156 9:121850538-121850560 GTGAAGGGGGAGGAGTGGGGAGG + Intronic
1060404679 9:123367439-123367461 GTGTGGGGTGTGGGGTGGGGGGG - Intronic
1060856039 9:126915280-126915302 GGGCCGGGGGGGCAGTTGGGCGG + Intronic
1060974275 9:127755286-127755308 TTGTCGGGGGAGGAGCGGGGAGG + Intronic
1061044980 9:128160140-128160162 GTGGTGGGGGTGGAGTCTGGAGG + Intergenic
1061212484 9:129201900-129201922 GTATGGGGGGTGGGGTGGGGTGG + Intergenic
1061392067 9:130322589-130322611 GTGTGGGGGATGCGGTTGGGCGG - Intronic
1061450165 9:130663469-130663491 AGGTCGGGGGTCGAGATGGGCGG - Intergenic
1061757108 9:132823105-132823127 TTATGGGGGGTGGTGTTGGGGGG - Intronic
1061837068 9:133336423-133336445 GTGTCGGGGTTGGGGGTGAGGGG - Intergenic
1062050891 9:134446563-134446585 GTGAGGGGGAAGGAGTTGGGGGG - Intergenic
1062661079 9:137633742-137633764 GTGTCGGGGGTCGGGGAGGGAGG - Intronic
1203767975 EBV:36410-36432 GTGGTGGGGGTGGTGGTGGGGGG - Intergenic
1203610501 Un_KI270748v1:91545-91567 GGGTCGGGGGAGGAGTGGGGAGG + Intergenic
1185641601 X:1591882-1591904 GTGACGGGGCTGGGGTTGGGGGG + Intronic
1185672556 X:1824460-1824482 GTGTTGGCGGTGGGGCTGGGTGG - Intergenic
1185742862 X:2547760-2547782 ATGTGGGGGGTGGGGTGGGGGGG + Intergenic
1185969601 X:4647811-4647833 GTGTAGTGGGAGGAGTTGGTGGG - Intergenic
1186441505 X:9590985-9591007 GTGTGGGGGGGATAGTTGGGGGG + Intronic
1186484847 X:9926088-9926110 GTGTGGGAGATGGAGTTGCGTGG - Intronic
1186507433 X:10104187-10104209 GGGTGGGGTGTGGAGTGGGGTGG + Intronic
1186514446 X:10156209-10156231 GTGTGGGGAGTGGGGGTGGGGGG - Intergenic
1186630302 X:11341057-11341079 GTGGTGGGGGTGGGGGTGGGGGG + Intronic
1186705052 X:12132139-12132161 GTGGTTGTGGTGGAGTTGGGAGG + Intergenic
1187246063 X:17553755-17553777 GTTTCGGGGGCGGGGTAGGGGGG + Intronic
1187362312 X:18640435-18640457 GTGTTGGGGGTGGGGGGGGGGGG - Exonic
1188034181 X:25297993-25298015 GGGTGGAGGGAGGAGTTGGGGGG + Intergenic
1189324198 X:40103088-40103110 GTGCGGGGGGTGGGGTGGGGGGG + Intronic
1189425611 X:40897334-40897356 GGGTTGGGGGTGGAGGTGGGGGG - Intergenic
1189496988 X:41517557-41517579 CTGTGGGGAATGGAGTTGGGTGG + Intronic
1189581939 X:42415420-42415442 TTGCCGGGGCTGGAGGTGGGTGG + Intergenic
1192204940 X:69089491-69089513 GTGTGGGGGTGGGAGTGGGGGGG - Intergenic
1192313699 X:70036037-70036059 GTGGCTGGGGTGGAGTGGGAAGG + Exonic
1192317695 X:70065693-70065715 CTGGCAGGGGTGGAGTTGGGTGG + Intergenic
1192334914 X:70210545-70210567 GTGACGTGGGGGGAGTGGGGAGG - Intergenic
1192694368 X:73398975-73398997 GAGTTGGGGGTGGGGTGGGGTGG + Intergenic
1192761349 X:74098624-74098646 CTGTCCGGGATGGAGGTGGGGGG + Intergenic
1193194239 X:78611147-78611169 GGGGTGGGGGTGGAGGTGGGCGG - Intergenic
1194296964 X:92138005-92138027 CTGTCGGGGGTGGAGAGGAGGGG - Intronic
1194753030 X:97705570-97705592 GTATGGGGGATGGAGTTGGGGGG - Intergenic
1194802905 X:98293710-98293732 GAGTTGGGGGAGGAGATGGGAGG + Intergenic
1194817550 X:98462848-98462870 AAGCCGGGGGTGGGGTTGGGGGG - Intergenic
1196211005 X:112995823-112995845 GGATGGGGTGTGGAGTTGGGTGG + Intergenic
1196280127 X:113814263-113814285 GTGTGGTGGGGGGAGTGGGGAGG + Intergenic
1196339099 X:114575572-114575594 GTGTGTGGGGGGGAGTGGGGGGG - Intergenic
1196871411 X:120116229-120116251 GGGTAGCGGGTGGAGATGGGAGG + Intergenic
1197261958 X:124329054-124329076 GTGGTGGGGGTGGAGGTGGGAGG + Intronic
1197274501 X:124462430-124462452 GTGGGGGGGGTGGGGGTGGGGGG + Intronic
1199000706 X:142632859-142632881 CTGGCGGGGGTGGGGTGGGGGGG + Intergenic
1199230991 X:145436439-145436461 GCGTCGGGGAGGGAGGTGGGGGG + Intergenic
1200614475 Y:5362580-5362602 CTGTCGGGGGTGGAGAGGAGGGG - Intronic
1200787222 Y:7271774-7271796 GTGGGGGGGGTGGCGCTGGGGGG + Intergenic
1201187283 Y:11416525-11416547 GAGGAGGGGCTGGAGTTGGGTGG + Intergenic
1201941758 Y:19467654-19467676 GTGGCGTGGGGGGAGTGGGGAGG - Intergenic