ID: 1157357186

View in Genome Browser
Species Human (GRCh38)
Location 18:46946725-46946747
Sequence TTCTGTGGCCAGCGATTGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157357186 Original CRISPR TTCTGTGGCCAGCGATTGGC GGG Intronic
901319210 1:8329582-8329604 CTCTGTGGCCAGGGCTGGGCTGG + Intronic
904620766 1:31773693-31773715 TTCTGTGGCGGGGGGTTGGCGGG - Intergenic
905118066 1:35659785-35659807 GTCTGCAGCCATCGATTGGCAGG + Intergenic
906045734 1:42829700-42829722 ATTTGTGGCCAGTGCTTGGCAGG + Intronic
907928172 1:58974142-58974164 TTCTGAGTCCAGCAATTGGGTGG - Intergenic
912060590 1:105663701-105663723 GTCTGTGGCCAGTGGTTGGCTGG + Intergenic
912732334 1:112119351-112119373 CTCTGTGCTCAGTGATTGGCTGG - Intergenic
919888838 1:201955364-201955386 TCCTGTGGCCAGCGTGTGGTCGG - Intergenic
920760604 1:208780493-208780515 TTCTGGGGACAGCAATTGGTGGG + Intergenic
922706414 1:227793074-227793096 TTCTGTGGCCTGAGGTTGGCTGG - Intergenic
923356096 1:233157278-233157300 TTTTGTGGCCAGTGAGTGACTGG - Intronic
1064953917 10:20885817-20885839 TTAGGTGGCCAGATATTGGCAGG + Intronic
1069651536 10:70053235-70053257 TCCTGCGGCCAGCGAGGGGCCGG + Intronic
1074360337 10:112820479-112820501 TTATGTGGCCAGCCTCTGGCAGG - Intergenic
1077065998 11:641166-641188 TCCTCTGGCCAGGGACTGGCAGG - Intergenic
1077943614 11:6870914-6870936 TTCTGTGGCCAACTATTTCCAGG + Intergenic
1080200930 11:29668923-29668945 TTCTGTGGCTAGCAACAGGCTGG - Intergenic
1082821958 11:57550125-57550147 CTCTGTGGGCAGAGATGGGCAGG + Exonic
1089104784 11:115993463-115993485 TTCTCTGGGCATCGATCGGCAGG - Intergenic
1089110676 11:116053395-116053417 TTTTGTGGCCAGCACCTGGCAGG + Intergenic
1095409347 12:41905323-41905345 TCCTGTGGCAAGAGATTGGCTGG - Intergenic
1095600259 12:44005064-44005086 TACTGTGGCCAGTCATTGTCAGG + Intronic
1099369385 12:81811592-81811614 TTCTGTTGCCAGTGGCTGGCTGG - Intergenic
1101251476 12:102939899-102939921 ATCTGTGGCCAGCACTTGACTGG + Intronic
1103059691 12:117848500-117848522 TTTTGTGGCCAGGGAATGGTAGG + Intronic
1104917602 12:132273996-132274018 TTCTCTGACCTGCGATGGGCTGG - Intronic
1104928382 12:132325535-132325557 TTCTCTGACCAGCAACTGGCTGG + Intronic
1105031565 12:132887643-132887665 CTCTGCGCCCCGCGATTGGCTGG + Intronic
1112436420 13:99394179-99394201 TTCTGTCTCTAGGGATTGGCTGG - Intergenic
1113040492 13:106099685-106099707 TTCTGTGGCCTGGGGTTGTCAGG - Intergenic
1113355658 13:109577541-109577563 TTCTGGGGGCAGCCAATGGCTGG - Intergenic
1113749572 13:112767950-112767972 TTCTGTGACCAGCGCTTGGTGGG - Intronic
1114625063 14:24123524-24123546 ATCTCTGGCCAGAGTTTGGCAGG + Exonic
1118461278 14:65989337-65989359 TTCTCAGGCCAGCCATTTGCTGG + Intronic
1119947946 14:78714661-78714683 TGCTGAGCCCAGCCATTGGCTGG - Intronic
1122062755 14:99147640-99147662 AACTGTGGCCAGAGGTTGGCAGG - Intergenic
1122610053 14:102976240-102976262 TTCTTTGACCAGCGATGGGGAGG - Intronic
1125534345 15:40434891-40434913 TTCTGAGGCCAGGGATGGCCAGG - Intronic
1128656362 15:69465013-69465035 TTCTGAGGACAGGGATTGGATGG + Intergenic
1133876706 16:9741570-9741592 TTCTATGGCCAGGGCTTGGATGG + Intergenic
1135079701 16:19423664-19423686 TTCTGTGATCAGATATTGGCGGG + Intronic
1136109541 16:28056054-28056076 TTCTGTGGGCAGCGAGAGGCCGG - Intronic
1143400470 17:6639541-6639563 TTCTGTGGACAGGGACAGGCTGG - Intronic
1145840120 17:27987705-27987727 CTCTGTGGCAAGTCATTGGCTGG + Intergenic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1150621340 17:66809850-66809872 CTCTGTGGCCATCTTTTGGCAGG + Exonic
1153952231 18:10067337-10067359 TTCTGTGGCCTGTGCTAGGCAGG - Intergenic
1157357186 18:46946725-46946747 TTCTGTGGCCAGCGATTGGCGGG + Intronic
1157833786 18:50879841-50879863 ATCTGTGGACCGGGATTGGCAGG + Intronic
1165209296 19:34220706-34220728 TTCTGAGTCCCACGATTGGCTGG + Intronic
1165994877 19:39836893-39836915 CTCTGTGGCCAGCCCTGGGCCGG + Intronic
1166806994 19:45493278-45493300 CTCTGTGGACAGCCATTGGCTGG - Exonic
1167523214 19:49969285-49969307 TCCTGTGGGCAGGGATTGGATGG + Intergenic
929920503 2:46168085-46168107 TCCTGTGGCCTGGGATTGGGAGG + Intronic
935954165 2:108358668-108358690 TTCTGTGACCAGGGATTGAAGGG + Intergenic
941080122 2:161051038-161051060 TTGTGTGGACAGGGATTGGTGGG - Intergenic
946416468 2:219542533-219542555 TGGTGTGTCCAGCGTTTGGCTGG - Intronic
948722982 2:239912989-239913011 TTCTGTGGAAAGCAAGTGGCAGG + Intronic
1168900942 20:1364316-1364338 TTCTGTGGCCAGCCATTTCCTGG + Intronic
1172128084 20:32637037-32637059 TTCTGTGGCCTGGCCTTGGCAGG - Intergenic
1172128886 20:32642715-32642737 TTCTGGGGCCAGAGGCTGGCAGG - Intergenic
1174399170 20:50266828-50266850 TTCTGTGTCCAGACATGGGCAGG - Intergenic
1176123652 20:63465466-63465488 TGCTGAGGCCAGCGGTCGGCAGG + Intronic
1177264902 21:18769942-18769964 TTCTGTGGTCAGAAATTGGAGGG + Intergenic
1182357467 22:29728793-29728815 TTCTGGAGCCAGTGAATGGCTGG + Intronic
1183095760 22:35551433-35551455 TTCTGTGGCCAGAGGAGGGCAGG + Intronic
1183354225 22:37349864-37349886 TTCTGTGCCCAGGGGTTGGCTGG - Intergenic
1184189262 22:42884131-42884153 TGCTTGGGCCAGCAATTGGCCGG + Intronic
1184499194 22:44861687-44861709 TCATGTGGCCAGCCAGTGGCAGG - Intronic
1184590209 22:45476974-45476996 TTCTGTGGGCAGAGATGGGAGGG - Intergenic
950187307 3:10953036-10953058 TTCTGAGGCCAGGGCTGGGCTGG - Intergenic
953919538 3:46942592-46942614 TTGTGTGGCCAAGGAATGGCAGG - Intronic
956511519 3:69998856-69998878 TTCCGTGGCCAGCCATTTCCTGG - Intergenic
956657110 3:71563119-71563141 GACTGTGGCCAGGGAGTGGCTGG + Intronic
958154898 3:89743929-89743951 TACTGTGCTCAGCCATTGGCTGG - Intergenic
958917822 3:100069379-100069401 TTATGTGGGCAGCTAATGGCTGG - Intronic
963705769 3:148686635-148686657 TGCTGAGGCCAGGGCTTGGCTGG - Intergenic
964820406 3:160762688-160762710 TTCTGTAGACAGCGATTGGGTGG + Intronic
967884716 3:194325659-194325681 TTCTGTGGCCACAGGGTGGCAGG + Intergenic
969316319 4:6383302-6383324 TTCTGTGGTCTGGGCTTGGCTGG - Intronic
969322657 4:6422203-6422225 TTCAGTGCCCTGCTATTGGCTGG - Intronic
972309726 4:37868963-37868985 TTCTGTGGCAAGCAACAGGCTGG + Intergenic
977871297 4:102093668-102093690 CTCTGTGCCCAGGTATTGGCTGG - Intergenic
978431528 4:108638046-108638068 TTCTGTGGCCAGAGTAGGGCAGG - Intergenic
985329159 4:188808239-188808261 TTCTGTGACCAGCAATTACCTGG - Intergenic
989352639 5:40504066-40504088 TTCTGTGTCCATTGATTGTCAGG - Intergenic
994353743 5:98773496-98773518 CTCTGGGTCCTGCGATTGGCAGG + Intronic
997170459 5:131714117-131714139 TACTGTGTTCAGCCATTGGCTGG - Intronic
1001402255 5:171452375-171452397 TGCTGTGGCCAGAGATGTGCAGG - Intronic
1008911805 6:56742081-56742103 TTCTGTGGACAACAATAGGCAGG + Intronic
1011651073 6:89506706-89506728 TTCTCTGGGCAGCTTTTGGCTGG - Intronic
1022766511 7:33418392-33418414 GTGTGTGGCCAGTGTTTGGCAGG + Intronic
1029445745 7:100612048-100612070 TTCTGTCGTCTGCGATTGGCTGG - Intergenic
1029713701 7:102314250-102314272 TTATGTGGCCAGGCAGTGGCTGG - Intronic
1031152090 7:118065846-118065868 TTCTGTGTCCAGTGAATGGAGGG - Intergenic
1032591187 7:133193832-133193854 TTCTGTGGGCAGCCAAGGGCGGG + Intergenic
1036188547 8:6648121-6648143 TTCTGTGCCCACGTATTGGCTGG - Intergenic
1036669138 8:10768588-10768610 TTGTGTGGCCAGCACTTTGCTGG - Intronic
1038822964 8:30969806-30969828 TTCTGTGGCTAGCCATCGCCTGG + Intergenic
1044089814 8:87985558-87985580 TGCAGTGGGCAGTGATTGGCAGG + Intergenic
1044728948 8:95214939-95214961 TTCTGAGGCAAGCAATTGGAGGG - Intergenic
1046542887 8:115609538-115609560 TACTGTGGCCAGCGAATCTCAGG - Intronic
1047693819 8:127383611-127383633 TTCCCTGGCCAGCGCTGGGCTGG + Intergenic
1049746757 8:144266316-144266338 TTCTGTGGCCACGCTTTGGCGGG - Intronic
1062419422 9:136472656-136472678 TTCTGTGGCCACGAATTGGTTGG - Intronic