ID: 1157365110

View in Genome Browser
Species Human (GRCh38)
Location 18:47057744-47057766
Sequence GAGAGGTATTTTAAGTAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 127}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157365107_1157365110 7 Left 1157365107 18:47057714-47057736 CCTTTTGATGTTTATTACTCATA 0: 1
1: 0
2: 1
3: 31
4: 290
Right 1157365110 18:47057744-47057766 GAGAGGTATTTTAAGTAGGCAGG 0: 1
1: 0
2: 0
3: 15
4: 127
1157365105_1157365110 9 Left 1157365105 18:47057712-47057734 CCCCTTTTGATGTTTATTACTCA 0: 1
1: 0
2: 2
3: 29
4: 317
Right 1157365110 18:47057744-47057766 GAGAGGTATTTTAAGTAGGCAGG 0: 1
1: 0
2: 0
3: 15
4: 127
1157365104_1157365110 20 Left 1157365104 18:47057701-47057723 CCTTCTGCAATCCCCTTTTGATG 0: 1
1: 0
2: 1
3: 18
4: 179
Right 1157365110 18:47057744-47057766 GAGAGGTATTTTAAGTAGGCAGG 0: 1
1: 0
2: 0
3: 15
4: 127
1157365106_1157365110 8 Left 1157365106 18:47057713-47057735 CCCTTTTGATGTTTATTACTCAT 0: 1
1: 0
2: 6
3: 43
4: 502
Right 1157365110 18:47057744-47057766 GAGAGGTATTTTAAGTAGGCAGG 0: 1
1: 0
2: 0
3: 15
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157365110 Original CRISPR GAGAGGTATTTTAAGTAGGC AGG Intronic
905505373 1:38475436-38475458 GAGAGGTATTTAAAGTGAACTGG + Intergenic
905552317 1:38852913-38852935 GAGTGCTATTTTAGGTAGGCTGG - Intronic
905932713 1:41800912-41800934 GGGAGGGAGTTTAGGTAGGCAGG - Intronic
907747295 1:57225984-57226006 GAGAGGTGTTTCAAGGAGGCAGG - Intronic
908504037 1:64776512-64776534 GAGAAGTAATTTAAGTAGCATGG - Intronic
909402306 1:75247716-75247738 AAAAGGTATTTTAAGGAGGTGGG + Intronic
909564206 1:77036903-77036925 GAGAGGTAGTTACAGTAGGTGGG + Intronic
923681221 1:236120234-236120256 GGGAGGCATTTTAAGGAGGGTGG + Intergenic
924088168 1:240475908-240475930 TAGAGGTATTTTAGTTTGGCTGG - Intergenic
924908275 1:248480393-248480415 GAGAGCTATTTTGAGAAGGCAGG - Intergenic
924915830 1:248567691-248567713 GAGAGCTATTTTGAGAAGGCAGG + Intergenic
1063037826 10:2304826-2304848 CAGAGATGTGTTAAGTAGGCAGG + Intergenic
1063706020 10:8431582-8431604 GGTAGTTATTTTAAGAAGGCTGG + Intergenic
1063811454 10:9713549-9713571 GAGGGCTATTTTGAGAAGGCAGG - Intergenic
1065622724 10:27599855-27599877 GAGAGCCATTTTGAGAAGGCAGG - Intergenic
1066348908 10:34618375-34618397 AAAAGCTATTTTAAGTATGCTGG - Intronic
1067452688 10:46392052-46392074 GAGAGGGATTTAAAGTCAGCTGG + Intergenic
1067584544 10:47467703-47467725 GAGAGGGATTTAAAGTCAGCTGG - Intronic
1067912523 10:50361007-50361029 TAGAGGTAGTTTTAGTAAGCTGG - Intronic
1072989134 10:100173653-100173675 GAAAGGTATTTCAAGTGGGAGGG - Intronic
1073671201 10:105592084-105592106 GAGAGCTACTTTAATTAGGAGGG - Intergenic
1074620914 10:115120675-115120697 TAGAGGTATTTTCAGTAAGTAGG + Intronic
1078846239 11:15120737-15120759 CTGAGGTATTTTAAGAAGGGAGG + Intronic
1079409672 11:20175309-20175331 GAGAGGGATTTTAACCAGACTGG + Intergenic
1088791955 11:113233994-113234016 GAGTGGAATTGGAAGTAGGCTGG + Intronic
1089309158 11:117546536-117546558 GACTGGTCTTTTAAGTAGGTGGG + Intronic
1090681199 11:129059233-129059255 GAGAGGTTTAATAAGTAGTCAGG - Intronic
1092745757 12:11670943-11670965 GAGAGGGATATTAAGTGAGCAGG + Intronic
1094795554 12:33967445-33967467 GAGAGGTAACTTAATTGGGCAGG + Intergenic
1095048319 12:37534349-37534371 AAAAGGTATTTTGGGTAGGCTGG + Intergenic
1095108189 12:38260472-38260494 GAGAGGTAACTTAATTGGGCAGG + Intergenic
1098487726 12:71041082-71041104 TAGAGGTTTTTAAAATAGGCAGG - Intergenic
1108098121 13:46926157-46926179 GAGAAGTATTTTAAATAGAGTGG + Intergenic
1109095474 13:58108209-58108231 GGGAGATATTTAAAGTAGGCAGG - Intergenic
1109106463 13:58257945-58257967 GAAAGGTATTTTAAGCAAGTAGG + Intergenic
1117795971 14:59394892-59394914 CAGGGGAATTTTAAGTAGGGTGG - Intergenic
1118422182 14:65618841-65618863 GAGGGCTCTTTTAAGAAGGCAGG - Intronic
1120323118 14:82991260-82991282 GAGAGGTAATTTAATAAGGGGGG - Intergenic
1128826798 15:70725745-70725767 CAGAGGTATATTAAGAAGGAAGG + Intronic
1130879270 15:88041197-88041219 CAGAGCTATTTTATGTGGGCTGG - Intronic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1131539196 15:93261875-93261897 CACAGGTATGTTAACTAGGCTGG + Intergenic
1142798611 17:2329214-2329236 TAGAGGTATTTTCAGTACTCTGG - Intronic
1143743256 17:8969721-8969743 GAGAGGTATTTTAAGCAGAGAGG - Intergenic
1144997226 17:19278532-19278554 GAGAGGTAATTGAATTATGCGGG - Intronic
1146274086 17:31504013-31504035 AAAAGGTATTTTAACTAGGATGG - Intronic
1146396377 17:32470928-32470950 GGGAGGTTTTTTGAGTAGGCTGG + Intronic
1148234123 17:45956081-45956103 GAGACGCATTTTAAGTGGCCAGG + Intronic
1151029459 17:70719314-70719336 TGAAGGTATTTTATGTAGGCAGG + Intergenic
1156445843 18:37236238-37236260 GCAAGATATTTTAGGTAGGCTGG - Intergenic
1157365110 18:47057744-47057766 GAGAGGTATTTTAAGTAGGCAGG + Intronic
1158619497 18:59019988-59020010 GAGAGCTATTTTGAGTTTGCTGG + Intergenic
1161863676 19:6818200-6818222 GAGTGGGATTTTAAATAGGGTGG + Intronic
1164830463 19:31316218-31316240 GAAAGGCATTTTAAGTAGCAGGG - Intronic
929227425 2:39525073-39525095 GAGAGGTAAATTCAGCAGGCTGG + Intergenic
929813719 2:45213755-45213777 GAGAGGTAGGTTAAGAATGCAGG + Intergenic
930954069 2:57182794-57182816 CAGAGTTATTTTAAGAATGCAGG - Intergenic
931838605 2:66126376-66126398 GAGAGGTGTTGAAAGGAGGCTGG - Intergenic
932826835 2:74948527-74948549 GAGATGTCATTTAAGGAGGCTGG - Intergenic
934879954 2:97967906-97967928 GAGAGGTTTTTTAAGGTGGGAGG + Intronic
935197895 2:100830932-100830954 GAGAGGTTTTTTGAGGAGGTGGG + Intronic
935889998 2:107666218-107666240 GAAAGATATTTAGAGTAGGCTGG - Intergenic
936581180 2:113701934-113701956 GAGAGGTATTGTTGGCAGGCAGG - Intergenic
938836739 2:135111336-135111358 GAGAGGAATTTTCAGTATACAGG + Intronic
940667018 2:156621269-156621291 GAGAGGAAATTGAACTAGGCTGG - Intergenic
941948504 2:171127741-171127763 GAGAGGTATTTTAAATTAGTGGG - Intronic
942330234 2:174816021-174816043 GAGAGGTATTGCAGGTAGGGTGG + Intronic
943091655 2:183382627-183382649 GAGAGCAATTTGAAGTAGCCAGG - Intergenic
944334950 2:198521310-198521332 GAGAGGTATTTGAAGGACACTGG + Intronic
947911070 2:233801332-233801354 GAGAGGGATTATAATTAGTCGGG + Intronic
1171307843 20:24121106-24121128 GAGAGGTATGTTAAGGCGACTGG + Intergenic
1171845894 20:30274471-30274493 AAAAGGTATTTTGGGTAGGCTGG + Intergenic
1171972883 20:31575308-31575330 GAAAAGTTTTTTAATTAGGCTGG + Intronic
1172110842 20:32544090-32544112 TAGAGGGATTTTAAGCAGGCGGG + Intronic
1172927459 20:38551812-38551834 GAGAAGAATTTTAAGAAGTCGGG + Intronic
1173391380 20:42637563-42637585 AAGAGCGATTTTAAGTAGGATGG - Intronic
1177077603 21:16596706-16596728 GAAAGGAATTTAAAGCAGGCGGG + Intergenic
1179325579 21:40340137-40340159 TAAAAGTATCTTAAGTAGGCTGG + Intronic
951200279 3:19868726-19868748 AAGAGGTATTTTAAGAAGGAGGG - Intergenic
953743551 3:45556490-45556512 GGGTGGTATTTTATGTAGGATGG - Intronic
954858150 3:53664375-53664397 GAGAGGTAGTTCAAGAATGCTGG - Intronic
956945828 3:74222239-74222261 GAGAGGTTTTCTAAGTAGAAAGG - Intergenic
961060454 3:123824021-123824043 GAGGGGTATTTTATATAGGATGG - Intronic
963280883 3:143383916-143383938 CAGAGGTATTTTAAACAGGCGGG - Intronic
965373482 3:167893142-167893164 AAGAGGAATTTCAAGTAGGCAGG + Intergenic
965440591 3:168708443-168708465 GGGAGGTATTTTCAGGTGGCTGG - Intergenic
966095704 3:176199759-176199781 GAGATGTATTTTAATTAGTACGG - Intergenic
966455687 3:180113497-180113519 GAAAGGTATTTTCAGTAGTTGGG - Intergenic
970246122 4:14065793-14065815 GAGAGGTATTTTACATAGGGTGG + Intergenic
970946748 4:21701998-21702020 AAAAAGTATTTTTAGTAGGCCGG - Intronic
974760468 4:66267105-66267127 GAGATGTCATTTAAGGAGGCTGG - Intergenic
975629395 4:76385013-76385035 GCCAGGTATTTTAAGTGGGTAGG - Intronic
977045512 4:92064447-92064469 GAGAGCTGCTTTAAGAAGGCAGG + Intergenic
977251894 4:94698153-94698175 CAGAGGTATCTTAACTTGGCTGG + Intergenic
977295487 4:95204376-95204398 CAGAGGCATGTGAAGTAGGCAGG + Intronic
978249443 4:106612633-106612655 GAGAGGAATTCTAACTAGACTGG + Intergenic
978826158 4:113026576-113026598 TAGAGGTATTTTCAGTGGACAGG + Intronic
979340153 4:119513154-119513176 GAGAGGTATTAAAGATAGGCTGG - Intronic
979514907 4:121596468-121596490 TTGAGGTATTTTATGTAGGCAGG - Intergenic
984103937 4:175521283-175521305 GAGAGCCATTTTGAGAAGGCAGG + Intergenic
984173804 4:176391480-176391502 GGGAGGTATTTTAAATAGGAAGG + Intergenic
984829807 4:183961935-183961957 GAGAGGCCTTTGAAGTGGGCTGG + Intronic
985201661 4:187490561-187490583 GAAAGATATTTCAAGTTGGCTGG + Intergenic
987060886 5:14242900-14242922 GAGAGGGATTTAGAGAAGGCAGG - Intronic
991328953 5:65470660-65470682 TATAGGTAGTTTAAGTAGGAAGG - Intronic
992670787 5:79058884-79058906 GAGAGGTTTGTTAAGGAGACAGG - Intronic
993573019 5:89566548-89566570 GAGAGCTATTATAATTAGGATGG + Intergenic
995853452 5:116570961-116570983 CAGTTGTATTTTGAGTAGGCGGG - Intronic
995957281 5:117793058-117793080 TAGTGGTATTTTCATTAGGCAGG - Intergenic
996487724 5:124056495-124056517 CAGAGGTATTTTCAGTTGGTGGG + Intergenic
997522277 5:134530599-134530621 GAGAGGTCTTTAAAGGGGGCTGG + Intronic
999269087 5:150286018-150286040 GAGAGGTCTTTGGAGAAGGCTGG + Intronic
1001158291 5:169291913-169291935 AAGAGTTATGTGAAGTAGGCAGG - Intronic
1001842230 5:174887766-174887788 AAGTGGTGTTTTAAGTAAGCTGG + Intergenic
1009274755 6:61661613-61661635 GAGAGGTTTTTTAAATAAGATGG + Intergenic
1020935112 7:14453501-14453523 GAGACTTATTTTAAGTAGCATGG - Intronic
1022766724 7:33420812-33420834 GAGAAGTATTTTGTGTATGCTGG + Intronic
1025294238 7:57762934-57762956 AAAAGGTATTTTGGGTAGGCTGG + Intergenic
1031095361 7:117412141-117412163 GATAGCTATTTTAAGTAGTTTGG - Intronic
1033514125 7:142089504-142089526 GAAAGTTATTAAAAGTAGGCCGG + Intronic
1036920883 8:12853913-12853935 GACAGCTATTATAAATAGGCAGG + Intergenic
1040781199 8:51111658-51111680 CAGAGGTATTTTGAGCAGGGAGG - Intergenic
1041118318 8:54562389-54562411 AAGAAATATTTTAAGTAGGCTGG + Intergenic
1041245020 8:55880766-55880788 GAGAGTTATTTTAAGAATTCAGG + Intronic
1044410490 8:91876867-91876889 TGGAGGAATTTTAAGTAGGATGG - Intergenic
1044954883 8:97469849-97469871 AATAGGTATTTTAAATTGGCTGG + Intergenic
1048716404 8:137275484-137275506 GAAAGGTATTTTAAGTACAGGGG - Intergenic
1049434738 8:142581281-142581303 GAGGGGAATTTAAACTAGGCTGG + Intergenic
1050711096 9:8464690-8464712 GAGAGATATTGTAGATAGGCAGG - Intronic
1052967142 9:34348717-34348739 GAAAGCTATTTGAAGGAGGCAGG - Intergenic
1054162184 9:61681371-61681393 AAAAGGTATTTTGGGTAGGCTGG - Intergenic
1055884479 9:81044371-81044393 AAGAGGTACTTGACGTAGGCTGG - Intergenic
1059165874 9:112076018-112076040 GAGATGAATTAGAAGTAGGCAGG + Intronic
1187096251 X:16151548-16151570 GAGAGGCTTTTCAAGTAGGAAGG - Intronic
1190579737 X:51880841-51880863 GAGAAGTATTTGAAGTAAGAGGG - Intronic
1191031709 X:55980894-55980916 TAAAATTATTTTAAGTAGGCCGG + Intergenic
1192033231 X:67537354-67537376 GAGAGGTAGTTGAAGTAGAGTGG + Intergenic
1198530210 X:137545106-137545128 GAGAGGTGTTTGTGGTAGGCTGG + Intergenic
1200696354 Y:6364483-6364505 AAAAGGGATTTTGAGTAGGCTGG - Intergenic
1200911016 Y:8531472-8531494 AAAAGGTACTTCAAGTAGGCTGG + Intergenic
1200964551 Y:9024319-9024341 AAGAGGTACTTCAGGTAGGCTGG - Intergenic
1201037760 Y:9800217-9800239 AAAAGGGATTTTGAGTAGGCTGG + Intergenic
1201072229 Y:10157899-10157921 GAGAGTCATTTTGAGAAGGCAGG + Intergenic