ID: 1157365544

View in Genome Browser
Species Human (GRCh38)
Location 18:47061050-47061072
Sequence CCTCAAAGGCACAATGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 159}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157365542_1157365544 -10 Left 1157365542 18:47061037-47061059 CCAGCAGAAATGTCCTCAAAGGC 0: 1
1: 0
2: 0
3: 13
4: 153
Right 1157365544 18:47061050-47061072 CCTCAAAGGCACAATGTAGATGG 0: 1
1: 0
2: 1
3: 17
4: 159
1157365540_1157365544 -3 Left 1157365540 18:47061030-47061052 CCTCTTACCAGCAGAAATGTCCT 0: 1
1: 0
2: 1
3: 14
4: 157
Right 1157365544 18:47061050-47061072 CCTCAAAGGCACAATGTAGATGG 0: 1
1: 0
2: 1
3: 17
4: 159
1157365539_1157365544 22 Left 1157365539 18:47061005-47061027 CCTTTGAAATAGTCTGACTATAA 0: 1
1: 0
2: 0
3: 20
4: 167
Right 1157365544 18:47061050-47061072 CCTCAAAGGCACAATGTAGATGG 0: 1
1: 0
2: 1
3: 17
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157365544 Original CRISPR CCTCAAAGGCACAATGTAGA TGG Intronic
905957563 1:42011695-42011717 CCTCAAAGCCTCAAGGCAGAGGG + Intronic
906678121 1:47708088-47708110 CCTCAGACGCAAAATGTAGGGGG - Intergenic
908358507 1:63345229-63345251 GCTCAAAGGCACATGGTAGTGGG - Intergenic
909377624 1:74958026-74958048 ATTTAAAGGCACAAGGTAGAAGG - Intergenic
909377642 1:74958170-74958192 CCTCCAAGTGACAATTTAGAAGG - Intergenic
909710028 1:78638580-78638602 GCTCAAAAGCAGAATGGAGAGGG - Intronic
913298485 1:117345409-117345431 ACTCCATGTCACAATGTAGAGGG + Intergenic
914703835 1:150155702-150155724 CCTTAAAGGGACATGGTAGATGG - Intronic
918552651 1:185761197-185761219 ACTCAAAGGCAAAAAGGAGATGG + Intronic
918760950 1:188406389-188406411 GCCCAAAGGCATAATGTGGAAGG - Intergenic
1063409696 10:5827885-5827907 CCTGAAAGACAGAAGGTAGACGG + Intronic
1064621390 10:17221334-17221356 CCTTAAAGGAATAAAGTAGATGG - Intergenic
1065172651 10:23047469-23047491 TCTCAAAGACACCATGCAGAAGG + Intergenic
1067725166 10:48764754-48764776 CCCCAAAGGCACATAGTAGGTGG - Intronic
1068782852 10:60940485-60940507 TCTGAAAGGCACCACGTAGATGG - Intronic
1068873622 10:61973107-61973129 CCTCAGAGGCTCATTGTGGATGG - Intronic
1069748149 10:70729021-70729043 CCACAAAGCCACATTGTAGAGGG - Intronic
1074355515 10:112779874-112779896 CCTCAACAGCACATTGTAAATGG - Intronic
1074907046 10:117874006-117874028 ACACTAAGGCACAATGTGGATGG + Intergenic
1075315584 10:121450495-121450517 CCTCTAACGCACAATGGAGCAGG - Intergenic
1081743995 11:45460282-45460304 CCTCCAAGGCAAAATGGAGTAGG + Intergenic
1083139769 11:60712322-60712344 CCTGAGAGGCACAATCTAGTAGG - Intronic
1083191290 11:61054136-61054158 CCTCAAAGACAGTATGTGGATGG + Intergenic
1086461787 11:87013068-87013090 TCTGAGAGGCACAATGTGGATGG - Intergenic
1087193024 11:95275760-95275782 CCACAAAAGAACAGTGTAGAAGG - Intergenic
1088115794 11:106311317-106311339 CCAGAAAAGCACAATGTGGAAGG + Intergenic
1088162479 11:106888949-106888971 CTTCAAAGGTACAACTTAGAAGG + Intronic
1088200744 11:107330930-107330952 TTAAAAAGGCACAATGTAGAAGG + Intronic
1089319631 11:117616223-117616245 ACTCAAAGGCACTATTTGGATGG + Intronic
1091087683 11:132738613-132738635 CCTCACATGGACACTGTAGAAGG - Intronic
1093231063 12:16542558-16542580 CGTGAAAGGAACAATGAAGAAGG - Intronic
1093308718 12:17551329-17551351 CCTCTGAGGCACAATTTAAAGGG - Intergenic
1094452752 12:30599996-30600018 CCTCCAAGTCATAATGTAAATGG - Intergenic
1094838498 12:34333331-34333353 CCTCACATGCACAGTGTGGAGGG - Intergenic
1095898568 12:47305179-47305201 CCTCTAAGGGAGAATGGAGATGG + Intergenic
1096480859 12:51940030-51940052 CCTCAAAGGCAGGGTGTACATGG + Intergenic
1099024128 12:77444221-77444243 CCTCAAAAGCACAAGATATATGG - Intergenic
1100001902 12:89847238-89847260 CCTCAAAATCACAAAGTAGTTGG - Intergenic
1101776936 12:107804324-107804346 CCACAAAGACACAATGTGGAAGG + Intergenic
1101988122 12:109463164-109463186 CATCAAAGGCAGAACGTGGAAGG - Intronic
1102160553 12:110765161-110765183 CCACAAAGTCACAAAGCAGAGGG + Intergenic
1104198988 12:126568689-126568711 CCTCAAAGTCAGAGTGTGGAAGG + Intergenic
1106129848 13:26931252-26931274 CCTGAAAGGCTCCATGTTGACGG + Intergenic
1107256144 13:38428867-38428889 CCCCAAAGGAAGAATGTAAAAGG + Intergenic
1108125103 13:47233970-47233992 CCTACAAGGCAAAATGCAGATGG - Intergenic
1118453001 14:65920973-65920995 CCGCATAGACACAAGGTAGATGG + Intergenic
1120454334 14:84713117-84713139 CCTCAAAGACACAAGAAAGAGGG + Intergenic
1121223078 14:92300968-92300990 CCTAGAAGGCACATTGTAGATGG + Intergenic
1123807146 15:23886593-23886615 CCTCAAAGCCACAGAATAGAAGG + Intergenic
1128163039 15:65437107-65437129 CCCCAAAGGCACAAACTAGTCGG - Intergenic
1132878919 16:2152731-2152753 CCTCCAGGTCACACTGTAGAGGG - Intronic
1140060787 16:71568023-71568045 CCTCAAATGCACCATGTCAAGGG - Exonic
1140704747 16:77616847-77616869 TCTCAGAGACATAATGTAGAAGG - Intergenic
1141267502 16:82510221-82510243 TCACAATGGCACAAAGTAGAAGG + Intergenic
1141284237 16:82656219-82656241 GTTCAAAGGCACAGGGTAGAAGG + Intronic
1148573512 17:48690255-48690277 TGTCAAAGGAACAATGTAGGAGG - Intergenic
1149066672 17:52488974-52488996 CATGAAAGGCACACTGTAAACGG - Intergenic
1150513402 17:65780502-65780524 CCTCAAAGACCAAATGTAAATGG + Intronic
1151432401 17:74072377-74072399 CCTCAGAGGCACAGGGGAGAAGG - Intergenic
1152089047 17:78237040-78237062 GCTCCCAGGCACAATGCAGAGGG - Intronic
1153525034 18:5986786-5986808 CAGCAAAGGCACAGTGTAGTTGG - Intronic
1155155235 18:23151956-23151978 GATGAAAGGCACAATGGAGATGG + Intronic
1156290432 18:35744850-35744872 GCTCAATGGAACAATGGAGAGGG - Intergenic
1157365544 18:47061050-47061072 CCTCAAAGGCACAATGTAGATGG + Intronic
1157983813 18:52414495-52414517 CCTCAAATGGCCAAAGTAGATGG + Intronic
1159490648 18:69129425-69129447 CCACAAAGGGAGAATTTAGACGG - Intergenic
1159823805 18:73180115-73180137 TCTCATAGGCAGAATGTAGTTGG - Intronic
1160188638 18:76696365-76696387 CAGCAAAGGCACATTGCAGAGGG + Intergenic
1160409231 18:78663876-78663898 TGTCAAAGGCTAAATGTAGAGGG + Intergenic
925084575 2:1097910-1097932 CCTCACAAGCAGAATGCAGACGG + Intronic
925707483 2:6700811-6700833 CCTCACAGTTACAATGAAGAAGG + Intergenic
925926412 2:8674111-8674133 ACTCAAAAGCACAGTGGAGAGGG + Intergenic
927183914 2:20468472-20468494 CCTCAAAGGCAGAACTGAGAAGG + Intergenic
927464357 2:23325775-23325797 CCCCAAAGGCTCAATGTAGAGGG - Intergenic
932194343 2:69770151-69770173 ATTCAAAGGCAAGATGTAGAAGG - Intronic
933376411 2:81485048-81485070 CCTTAAAGGCAGAATTTAGTTGG + Intergenic
935129494 2:100250892-100250914 CCTCAAAGGGACTGTGCAGAGGG + Intergenic
938049522 2:128155288-128155310 CATCAAAGACACAAGGTTGATGG - Intronic
939437604 2:142199016-142199038 CCTCAAAGACAAAATATGGAGGG - Intergenic
939577771 2:143916748-143916770 CCTCAAGGGCAGAAGGCAGAAGG + Intergenic
940283541 2:152011283-152011305 CCTCAAAGGAAGAAGGTGGAGGG - Intronic
941040434 2:160615849-160615871 CCCCAAATGCACTATGTAAACGG + Intergenic
942783279 2:179671603-179671625 CATCATAGGCACACAGTAGAAGG + Intronic
944158078 2:196629155-196629177 TCTCACAGTCACCATGTAGATGG + Intergenic
944920212 2:204404801-204404823 CCTCCAATGCACAAGGCAGACGG - Intergenic
944989777 2:205222301-205222323 TCTCAAAGTCACACAGTAGAAGG + Intronic
945071687 2:205995717-205995739 CTTTAAAGGCACAATATATAGGG + Exonic
946056979 2:216911170-216911192 CCTCTAAGGCACTATCCAGATGG - Intergenic
946284692 2:218694137-218694159 CCTCCAAGGCACAAAGTTGATGG - Intronic
948327514 2:237137859-237137881 CCACACAGGCAGAATGTTGAGGG - Intergenic
1170099287 20:12680977-12680999 CCTCAGAGACAGAATGAAGATGG + Intergenic
1171128765 20:22628591-22628613 CCACAAAGTCACAATGCAGTTGG + Intergenic
1171389776 20:24794105-24794127 CAGCAAAGGCACAAGGTACATGG - Intergenic
1173512674 20:43642633-43642655 CCTACAAGGCACAGTGTAGTGGG + Intronic
1173755961 20:45516259-45516281 TATCAAAAGCACCATGTAGAAGG + Intergenic
1179986529 21:44924840-44924862 TCTGAAAAGCAAAATGTAGAAGG + Intronic
949619793 3:5797852-5797874 CCTCAAAGCCACCTTGGAGAGGG - Intergenic
951800193 3:26587207-26587229 CCTCACAGGCACAAGGGAGAAGG - Intergenic
952899535 3:38100293-38100315 ACTCGAAGGCTCAATGTCGAAGG - Exonic
955243416 3:57201727-57201749 CCTAAGAGGCACAAGGCAGAAGG + Intronic
958455069 3:94320481-94320503 CTTCCATGGCATAATGTAGAAGG + Intergenic
959651866 3:108758042-108758064 CCTCATGGTCACAAGGTAGAAGG + Intergenic
959865343 3:111261963-111261985 TCTTAAAGACACAATATAGATGG - Intronic
962151734 3:132900897-132900919 ACCCAAAGGCAAAATGTAGCTGG - Intergenic
962169694 3:133087900-133087922 TCTCAAAGGCACCACGTAGTTGG - Intronic
962957431 3:140279120-140279142 TCTCATAGGCATAATGTTGAGGG - Intronic
963024999 3:140910914-140910936 CCTCAGAGGCACAATGTTTCTGG - Intergenic
963317873 3:143779927-143779949 CCTCAAAAGTACAAAGTAAATGG - Intronic
964543145 3:157802389-157802411 ACTCAAAGGCTCAAAATAGAGGG - Intergenic
965442995 3:168739297-168739319 CCACCATGGCACAATGTAGCTGG + Intergenic
968022922 3:195410890-195410912 CCTCAATGGCAGAAGGTGGAAGG - Intronic
968171274 3:196512006-196512028 CCTCATAAGGACAATGTAGGTGG - Intronic
970122292 4:12769782-12769804 CATAAAAGGTATAATGTAGATGG - Intergenic
970419294 4:15890288-15890310 CCTCAAAGGCACCATCTTGGAGG - Intergenic
972778424 4:42264845-42264867 CCACAATTGCACAATGTAGGAGG + Intergenic
974361890 4:60891664-60891686 CCAAAAAGGCAGAATATAGAAGG + Intergenic
974862202 4:67535979-67536001 GCTCAAAGGCATTATGTACATGG - Intronic
977214483 4:94263387-94263409 CCTGAAAAGCACAAAGTAGGGGG + Intronic
979981227 4:127257816-127257838 TCTCAAGGCCACAGTGTAGAAGG - Intergenic
982555236 4:156853305-156853327 CCTGAAAGACACAATGTGAAGGG + Intronic
984275310 4:177602571-177602593 CCTTAAAAGCACAATGTATATGG + Intergenic
985889005 5:2701202-2701224 CCTCAAATGCACATTGTGAAAGG - Intergenic
986345352 5:6829894-6829916 CCTGAAAAGCAGAATGGAGATGG - Intergenic
987817666 5:22923888-22923910 TCTCAAAGGGCCAGTGTAGATGG + Intergenic
988694860 5:33611090-33611112 CCTCAAAAGCATAATGTTGAGGG + Intronic
989299059 5:39867100-39867122 CTCCAAAGGCACAATGGAGTAGG + Intergenic
993163931 5:84326807-84326829 TCTCAAAGAGAGAATGTAGAAGG - Intronic
993779529 5:92049327-92049349 ACTCAAAGACTCAATGTAAAGGG - Intergenic
993876739 5:93316323-93316345 TCACAAAGACAAAATGTAGAAGG - Intergenic
994552591 5:101256468-101256490 TCTCTGAGGCACAATGTAAAAGG + Intergenic
995229114 5:109738571-109738593 GCTCAAAGCCACACAGTAGATGG - Intronic
995605082 5:113845520-113845542 CCTCAAAGGCACAGGGCTGAAGG - Intergenic
999718447 5:154380714-154380736 CCTTAAAAGCCCAATGCAGAGGG + Intronic
999909545 5:156182723-156182745 CTGCAAAGTCACAATGTAAATGG - Intronic
1003566881 6:7229746-7229768 CCTCAAAGGCTCAGTGGAGGCGG + Exonic
1003672102 6:8169328-8169350 CGTCAAGGGCAAAATGTATATGG + Intergenic
1004330657 6:14717542-14717564 AGTCATAGGCACCATGTAGAGGG - Intergenic
1005441440 6:25873490-25873512 CCTCAAGGCCAGAATGGAGAAGG - Intronic
1005944476 6:30585422-30585444 ACTCACAGGCACAGTGGAGAAGG - Intronic
1012251127 6:96982417-96982439 CCCCAAAGGCTCAATGTAAAGGG - Intronic
1013577160 6:111494975-111494997 CATCAAATGATCAATGTAGAGGG - Intergenic
1013590337 6:111614368-111614390 CCTGAAGGGCACAATGTAATGGG - Intergenic
1013744675 6:113331590-113331612 ACACAAAGGCACAATCTAGGTGG - Intergenic
1014504938 6:122243186-122243208 CCTGAAAGGCACACTGAAGAAGG + Intergenic
1015986574 6:138890350-138890372 CCTCAAAGGCACAGGGTAGCAGG + Intronic
1016673233 6:146732491-146732513 CCTCACGGGCTCAATGTAGCTGG + Intronic
1017696208 6:157018921-157018943 CCTCAAAGGGCAAATGTACAGGG + Intronic
1018309048 6:162489721-162489743 CCACAAGGGTACAAAGTAGAAGG - Intronic
1020247802 7:6443593-6443615 GCTCATAGGAGCAATGTAGAGGG - Intronic
1020405477 7:7828696-7828718 CTTCAAAGGCAAAAAGGAGAAGG - Intronic
1021645149 7:22782397-22782419 CCTGACAGGCAGAGTGTAGAAGG - Intergenic
1023661294 7:42473512-42473534 CCTCATAGACAAAATGAAGAAGG + Intergenic
1023687361 7:42749975-42749997 CCTGAAAGTCACAAGGTAGAAGG - Intergenic
1027844617 7:83356833-83356855 CCTCAAATGCAGAAAGAAGAAGG + Intergenic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1031947135 7:127854026-127854048 CCTGAAAGGCAGAAAGCAGATGG - Intronic
1039690234 8:39856020-39856042 CCTCAAAGGAACAATAATGAAGG + Intergenic
1040811957 8:51463400-51463422 ACTCAAAGGCTCAAAGTAAAAGG + Intronic
1043293890 8:78640009-78640031 TCTCAAAGGCATTATGCAGAGGG - Intergenic
1043674942 8:82939109-82939131 TCCCATAGGCTCAATGTAGATGG + Intergenic
1044288455 8:90438590-90438612 CCTCAAAGGCTTACTGTTGATGG - Intergenic
1044387107 8:91602105-91602127 CCTCAAATGCACAATATAGTTGG + Intergenic
1044744033 8:95355039-95355061 TCTCAAAGGCAAAATATAGAGGG + Intergenic
1045357381 8:101401912-101401934 CCTCAGAGACAGAATGCAGAGGG - Intergenic
1047885077 8:129241244-129241266 CATCAGAGGCACATTGTGGATGG + Intergenic
1048443400 8:134476392-134476414 CCTCAAGGGCATAAGGTAGTGGG - Intergenic
1052063863 9:23992699-23992721 CATCAAAGACAAAAGGTAGATGG + Intergenic
1052672845 9:31580498-31580520 CGTCAAAGGGAAAATGTACATGG + Intergenic
1055789225 9:79903776-79903798 CCTAAAATGCAAAATGTAAAAGG - Intergenic
1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG + Intergenic
1060279246 9:122204848-122204870 CCTCAAAGGCACAGAGAAGAAGG + Intronic
1186269083 X:7865513-7865535 CCTCCAGGGTACAATGGAGATGG + Intergenic
1188580032 X:31700355-31700377 GCTCAAAGTCACAATGTGTATGG + Intronic
1190567683 X:51747405-51747427 ACACAAAGGGACAATGTAGAAGG - Intergenic
1194481836 X:94436255-94436277 CTTCAAAGACACAGTGTTGAAGG + Intergenic
1195151448 X:102074218-102074240 CCCCAAAGGCACAAAGTAAAGGG + Intergenic
1195413263 X:104592340-104592362 ACTGATAAGCACAATGTAGAAGG - Intronic
1199491783 X:148407949-148407971 TATCAAAGGGAGAATGTAGATGG - Intergenic