ID: 1157365928

View in Genome Browser
Species Human (GRCh38)
Location 18:47064355-47064377
Sequence CAGTTTGTGCACATGTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 601
Summary {0: 1, 1: 0, 2: 2, 3: 64, 4: 534}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157365927_1157365928 -10 Left 1157365927 18:47064342-47064364 CCATGAGAAATTGCAGTTTGTGC 0: 1
1: 0
2: 2
3: 22
4: 176
Right 1157365928 18:47064355-47064377 CAGTTTGTGCACATGTCCTGTGG 0: 1
1: 0
2: 2
3: 64
4: 534

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157365928 Original CRISPR CAGTTTGTGCACATGTCCTG TGG Intronic
900757580 1:4447442-4447464 CACCTTGGGCACATGTCCTCAGG + Intergenic
901270046 1:7945197-7945219 CTGTTTGTACTCTTGTCCTGGGG - Intergenic
901297567 1:8172269-8172291 CAGCTTGTGCAAAGGGCCTGAGG + Intergenic
901474064 1:9477028-9477050 CAGATTCAGCAGATGTCCTGAGG - Intergenic
901474086 1:9477150-9477172 CAGATTCAGCAGATGTCCTGAGG - Intergenic
901690725 1:10971477-10971499 CAGTATGTGCAGAGGCCCTGAGG - Intronic
901864340 1:12094354-12094376 CAGCTTGTGCAAAGGCCCTGGGG + Intronic
901930622 1:12594670-12594692 CAGTTGGTGCAAAGGCCCTGGGG + Intronic
902191961 1:14770008-14770030 CAGGATGTGCAAAGGTCCTGAGG + Intronic
902264814 1:15255748-15255770 CAGTGTGTGCAAAGGCCCTGGGG + Intronic
902303467 1:15519660-15519682 CAGTCAGTGCCCATGTCCTATGG - Intronic
902386819 1:16080609-16080631 CAGCTTGTGCAAATGTCCAGAGG - Intergenic
902727421 1:18346541-18346563 CAATTGGTCCCCATGTCCTGTGG - Intronic
903050757 1:20599166-20599188 CAGCTTGTGCAAAGGCCCTGTGG + Intronic
903052452 1:20611836-20611858 CAGTATGTGCAAAGGCCCTGAGG - Intronic
903139133 1:21328123-21328145 CAGCATGTGCAAAGGTCCTGGGG - Intronic
903160933 1:21488711-21488733 CAGGGTGTGCAAATGTCCTGTGG + Intergenic
903309490 1:22443264-22443286 CACCTTGGGCACATGTTCTGAGG - Intergenic
903701114 1:25248708-25248730 CAGTTCATCCACATCTCCTGAGG + Intronic
904354001 1:29926786-29926808 CCGTGTGTGCAGATGTCCTGAGG + Intergenic
904575101 1:31500351-31500373 CTCTCTGTGCACCTGTCCTGCGG + Intergenic
904622106 1:31781858-31781880 CAGCGTGTGCCCGTGTCCTGAGG - Intergenic
905312350 1:37058576-37058598 CAGTATGTGCAAAGGCCCTGTGG - Intergenic
907201583 1:52731317-52731339 CAGCATGTGCAAATGACCTGTGG + Intronic
908314264 1:62917523-62917545 CAGTTTTTGCACATGTTAGGGGG + Intergenic
908748611 1:67398807-67398829 CACTTTGGGCACATGTCCTCCGG - Intergenic
908819169 1:68065839-68065861 CAGTTTGTGCACAAGGCTTTTGG - Intergenic
909604937 1:77498562-77498584 CAGTTTCTTCACCTGTCATGTGG + Intronic
910195907 1:84639422-84639444 CACTTTGGGCACATGTCATCAGG - Intergenic
910433854 1:87185290-87185312 CAGTGTGTGCAAAGGCCCTGAGG - Intergenic
911566937 1:99473455-99473477 CAATGTGTGGAAATGTCCTGAGG - Intergenic
911991668 1:104705900-104705922 CATCTTGGGCACATGTCCTCAGG + Intergenic
912506161 1:110157833-110157855 CAGAAAGTGCAAATGTCCTGAGG - Intronic
912629934 1:111238205-111238227 CACCTTGGGCACATGTCCTCAGG + Intronic
912647452 1:111407484-111407506 CAGTTCATGCAAAGGTCCTGAGG + Intergenic
914680876 1:149937434-149937456 CAGTTTGTGTGCAAGTCTTGGGG + Intergenic
914886964 1:151593446-151593468 CACTTTGGGCACATGTTCTCAGG + Intergenic
915208587 1:154288939-154288961 CACTTTGTGCACAGGTTCTCAGG - Intergenic
915652400 1:157325617-157325639 CACATTGGGCACATGTCCTCAGG + Intergenic
915880573 1:159667102-159667124 CACCTTGTGCACATGTTCTCAGG - Intergenic
916371103 1:164095086-164095108 CAGGTTCTGCACATGTATTGCGG + Intergenic
918105799 1:181414012-181414034 CATTTTGGGCACATCTCCAGTGG + Intronic
918864040 1:189871238-189871260 CTGGTTGTGCACTAGTCCTGGGG + Intergenic
919432960 1:197519752-197519774 CAATATGTGCAAATGTCCAGTGG + Intronic
919752755 1:201048436-201048458 GACTTTGTGCCCATGGCCTGGGG + Intronic
920052866 1:203174058-203174080 CATTTTCTGCCCATTTCCTGTGG - Intronic
920666336 1:207965200-207965222 CATTTTTTGCACGTTTCCTGAGG + Intergenic
922475395 1:225903799-225903821 CAGCTTGTGCAAAGGCCCTGAGG - Intronic
922694476 1:227721763-227721785 CATTTTGGGCACATGTTCTCAGG + Intergenic
922883142 1:228997798-228997820 TAGTGAGTGCAAATGTCCTGGGG - Intergenic
923433538 1:233947709-233947731 GAGTATGGACACATGTCCTGTGG - Intronic
923469179 1:234275222-234275244 CACTTTGTACACATAGCCTGAGG - Intronic
923619500 1:235566585-235566607 CAGTTTTTCCACAGGTCATGGGG - Intronic
924458425 1:244236879-244236901 CAGTATGTGCAAAGGCCCTGTGG + Intergenic
1063085327 10:2812786-2812808 AAGCATGTGCAAATGTCCTGGGG + Intergenic
1063106958 10:3000521-3000543 CACTTTGGGCACATGTCTTCAGG - Intergenic
1063845296 10:10121148-10121170 CAGCTTGGGCACATGTTCTCAGG - Intergenic
1064174698 10:13064490-13064512 CACCTTGGGCACATGTCGTGAGG - Intronic
1065397602 10:25256530-25256552 ATGTGTATGCACATGTCCTGTGG + Intronic
1067192601 10:44083690-44083712 AAGTGTGTGCACATGTGCTGGGG + Intergenic
1069711784 10:70494103-70494125 TAGTCTATGCAAATGTCCTGTGG - Intronic
1070573274 10:77657811-77657833 CACCTTGGGCACATGTTCTGAGG - Intergenic
1071712967 10:88067794-88067816 CAGCAAGTGCAAATGTCCTGAGG + Intergenic
1071715064 10:88087421-88087443 CAGTAAGTGCAAATGTCTTGAGG + Intergenic
1071863112 10:89696195-89696217 CACCTTGTGCACATGTTCTCAGG + Intergenic
1071890970 10:90006701-90006723 TAGTATGTGCAAATGCCCTGAGG + Intergenic
1071898572 10:90092589-90092611 CACCTTGGGCACATGTCCTCAGG + Intergenic
1072357087 10:94622500-94622522 CACTTTGGGCACATGTCATTAGG - Intergenic
1072755818 10:98020055-98020077 CAGTTTTTCCACCTTTCCTGTGG + Intronic
1073548555 10:104375645-104375667 CACTTTGGGCACATGTTCTCAGG - Intronic
1073583735 10:104689479-104689501 CAGCTTGTGCAAAGGCCCTGAGG - Intronic
1074124170 10:110515099-110515121 CAGCATGTGCAAAGGTCCTGAGG - Intergenic
1075605410 10:123801796-123801818 CAGTATGTGCAAAGGCCCTGGGG - Intronic
1077581609 11:3420889-3420911 CAGGATATGCACAGGTCCTGTGG - Intergenic
1078886579 11:15506420-15506442 CAGCTGGTGCAAAGGTCCTGGGG + Intergenic
1079229940 11:18641041-18641063 CACCTTGGGCACATGTTCTGAGG - Intergenic
1079321065 11:19451781-19451803 CAGCTTGTGCAAAGGCCCTGAGG + Intronic
1079483952 11:20914234-20914256 CACCTTGGGCACATGTCCTCAGG - Intronic
1079693381 11:23447718-23447740 CAGATGGTGCACATGGCATGAGG - Intergenic
1079893674 11:26091633-26091655 CACTTTGGGCACATGTTCTTGGG - Intergenic
1079950185 11:26792188-26792210 CAAATTGTGCACATGTCTGGGGG - Intergenic
1080681838 11:34484843-34484865 GAGTCTGTGCAAAGGTCCTGAGG - Intronic
1082908426 11:58340296-58340318 CAGCAAGTCCACATGTCCTGAGG + Intergenic
1083031843 11:59599762-59599784 CAGTGTGTACAAATGCCCTGAGG + Intronic
1084074447 11:66762242-66762264 CAGTTTGCGCGCGTGTTCTGCGG - Intronic
1084452167 11:69245627-69245649 CAGTGTGTGCAAAGGCCCTGAGG + Intergenic
1084464763 11:69315983-69316005 CAGTAAGTGCACTGGTCCTGAGG + Intronic
1084543714 11:69803164-69803186 CAGCATGTGCAAAGGTCCTGGGG + Intergenic
1084930675 11:72553304-72553326 CAGTTTGTGCAAAGGTCTGGAGG - Intergenic
1084980707 11:72827110-72827132 CAGCTTCTCCATATGTCCTGTGG + Intronic
1085509717 11:77082145-77082167 CAGTGTGTGCAGAGGCCCTGAGG + Intronic
1085619352 11:78026083-78026105 CACCTTGGGCACATGACCTGAGG - Intronic
1085645117 11:78217860-78217882 CAGCTTGTGCCCATGGGCTGTGG - Exonic
1086081141 11:82903063-82903085 CAGGTTGTGCAAACGTCCTGAGG + Intronic
1086287720 11:85268488-85268510 CACCTTGGGCACATGTCCTCAGG + Intronic
1086417660 11:86605314-86605336 CAGCATGTGCAGATGCCCTGAGG - Intronic
1089359942 11:117879089-117879111 CAGTATGTGCAAAGGCCCTGAGG + Intergenic
1089732671 11:120528989-120529011 CAGCATGTGCAAAGGTCCTGAGG - Intronic
1091010138 11:131993593-131993615 CAGTGTGTGCAGATTTCCTAGGG + Intronic
1091171061 11:133520153-133520175 CAGTTTATGCTGAAGTCCTGCGG + Intronic
1091293937 11:134459417-134459439 CAGCTTGTGCAGATGTGCAGCGG + Intergenic
1091334240 11:134754545-134754567 CAGTGTCTTCACAGGTCCTGGGG + Intergenic
1091951291 12:4595271-4595293 GTGTTTGTGCACAAGTCCTGAGG - Intronic
1092406319 12:8224199-8224221 CAGTTTTTGCACTTGAGCTGTGG + Exonic
1092488716 12:8925588-8925610 CAGTGTGTCCAAAGGTCCTGAGG + Intronic
1092613754 12:10197742-10197764 CACCTTGGGCACATGTCCTCAGG + Intergenic
1094539355 12:31350333-31350355 CAGTGTATGCAAAGGTCCTGTGG - Intergenic
1095347719 12:41171149-41171171 CAGTTTGTGGTCATTTGCTGGGG + Intergenic
1095407441 12:41882351-41882373 CAGTTTGTCCACATGTCCCCGGG - Intergenic
1095713579 12:45317150-45317172 CAGGTTGTGCACATGTACCCTGG - Intronic
1095791595 12:46174155-46174177 CAGTAAGTGCACAGGCCCTGAGG + Intergenic
1095896410 12:47284339-47284361 CACTTTGAGCACATGTTCTCAGG + Intergenic
1096872649 12:54603504-54603526 CTGTTATTGCCCATGTCCTGAGG + Intergenic
1096995412 12:55835057-55835079 AAGTTTGTGTGCAGGTCCTGTGG - Intergenic
1097255113 12:57667579-57667601 CACTTTGGGCACATGTCGTCAGG + Intergenic
1097752926 12:63378044-63378066 CAGATATTGCACTTGTCCTGCGG + Intergenic
1098200109 12:68045366-68045388 CACTTTGTGCACATGTACCCTGG - Intergenic
1098701983 12:73639985-73640007 CAGTATGTTCAGATGTCCTGTGG - Intergenic
1099911644 12:88841011-88841033 CACCTTGTGCACATGTCATCAGG - Intergenic
1100261544 12:92936754-92936776 CACCTTGGGCACATGTTCTGAGG + Intergenic
1100460984 12:94799022-94799044 CAGCATGTGCAAGTGTCCTGAGG - Intergenic
1101032846 12:100677117-100677139 CAGAATGTGCAAAGGTCCTGAGG - Intergenic
1101264637 12:103071154-103071176 CAGTTTCTACCCATGTCATGGGG + Intergenic
1101517201 12:105447530-105447552 CACCTTGGGCACATGTTCTGAGG + Intergenic
1101679136 12:106947755-106947777 CACTTTGGGCACATGTTCTCAGG - Intergenic
1101815795 12:108145156-108145178 CAGTATGTGCAAAGGTCCTGAGG - Intronic
1101982701 12:109421531-109421553 CAGTATGTGCAAAGGTCCTGTGG + Intronic
1102516072 12:113447777-113447799 CAGCATGTGCAAATGTCCTGAGG + Intergenic
1102756760 12:115347858-115347880 CAGTGAGTGCAAAGGTCCTGAGG + Intergenic
1102810672 12:115821412-115821434 CAGCTTGTGCAAAGGCCCTGTGG + Intergenic
1103253530 12:119521556-119521578 TAGTGTGTGCAAAGGTCCTGCGG + Intronic
1103471832 12:121188398-121188420 CAGTATGTGCAAAGGTCCTGGGG + Intergenic
1103938668 12:124490101-124490123 CAGTATGTGCAAAGGTCCTGAGG - Intronic
1104067323 12:125316690-125316712 CAGGAAGTGCAAATGTCCTGTGG + Intronic
1104757110 12:131276217-131276239 CACTTTGGGCACATGTCATCAGG - Intergenic
1104962483 12:132494894-132494916 CATTTTGGGTGCATGTCCTGTGG - Intronic
1106123006 13:26877485-26877507 CACTTTGGGCACATGTCATCAGG - Intergenic
1106402695 13:29444994-29445016 CAGTGTCTGCAAATGTACTGGGG - Intronic
1107038893 13:35928356-35928378 CAGTTAGTGCAGAGGGCCTGAGG - Intronic
1107618562 13:42199383-42199405 GAAATTGTACACATGTCCTGTGG + Intronic
1107652038 13:42554742-42554764 CAGTCTGCCCACTTGTCCTGCGG + Intergenic
1109198254 13:59403044-59403066 CAGTTTGTGAAAATGTACTTCGG - Intergenic
1110085173 13:71369372-71369394 CAGTTTGGGCACATGTCATCAGG - Intergenic
1112520557 13:100091018-100091040 CAGTGTATGCAAAGGTCCTGTGG + Intronic
1114229461 14:20767498-20767520 CACCTTGGGCACATGTCCTCAGG + Intergenic
1114520998 14:23335896-23335918 CACTTTGGGCACGTGTCCTCAGG + Intergenic
1114521950 14:23345119-23345141 CACTTTGGGCACGTGTCCTCAGG + Intergenic
1116471901 14:45295295-45295317 CACTTTGGGCACATGTTCTCAGG + Intergenic
1117861977 14:60101271-60101293 CACCTTGGGCACATGTTCTGAGG + Intronic
1117891800 14:60430197-60430219 CACCTTGGGCACATGTTCTGAGG - Intronic
1118198013 14:63646144-63646166 CACCTTGGGCACATGTCCTCAGG + Intergenic
1118799240 14:69173882-69173904 CATTGAGTGCAAATGTCCTGAGG + Intergenic
1119476402 14:74932555-74932577 CAGTGTGAGCAAAGGTCCTGAGG + Intergenic
1119544234 14:75460219-75460241 GAGTTTATTAACATGTCCTGAGG + Intronic
1120107556 14:80514253-80514275 CACCTTGGGCACATGTTCTGAGG + Intronic
1120389988 14:83894102-83894124 CACCTTGGGCACATGTCATGAGG + Intergenic
1120618867 14:86738512-86738534 CACCTTGTGCACATGTTCTTGGG - Intergenic
1120694866 14:87633332-87633354 CACCTTGGGCACATGTCCTCAGG - Intergenic
1120769594 14:88364649-88364671 CACCTTGGGCACATGTCCTTAGG - Intergenic
1120771321 14:88383565-88383587 CACTTTGGGCACATGTTCTCAGG - Intergenic
1121456957 14:94044376-94044398 CAGTTTGTACACTAGTCCAGAGG - Intronic
1121506935 14:94484639-94484661 CAGCATGTGCAAAGGTCCTGAGG - Intergenic
1122038418 14:98964872-98964894 CAGTGGATGCTCATGTCCTGTGG + Intergenic
1122470462 14:101962645-101962667 CAGTTTGTTCTCTTGGCCTGGGG + Intergenic
1122653827 14:103243458-103243480 CACCTTGTGCACATGTTCTCAGG + Intergenic
1124578397 15:30929209-30929231 CTGTCTGTGCACAAGTCCAGGGG - Exonic
1125249457 15:37682879-37682901 CAGCTTGTGCAAAGGCCCTGAGG - Intergenic
1126167480 15:45666136-45666158 CAGCATGTGCAAATGTCCTGGGG - Intronic
1126547045 15:49885222-49885244 CAGCCAGTGCAAATGTCCTGAGG - Intronic
1127381024 15:58430601-58430623 CAGTCTGTGCAAAGGCCCTGAGG - Intronic
1127981598 15:64039122-64039144 AACTTTGGGCACAGGTCCTGAGG + Intronic
1128156523 15:65395101-65395123 CAGTGTGTGCACCAGTGCTGGGG + Exonic
1128210280 15:65894633-65894655 CAGTTTGTGCTCAGCTCCAGAGG - Intergenic
1128255847 15:66196032-66196054 CAGTATGTGCAAAGGCCCTGAGG + Intronic
1128335384 15:66782369-66782391 CATTTTGTGGAAATGGCCTGGGG + Exonic
1128380147 15:67106343-67106365 CAGCATGTGCACAGGCCCTGAGG - Intronic
1128515670 15:68340406-68340428 CAGTTTGTGCAAAGGCTCTGAGG + Intronic
1128769571 15:70271758-70271780 CAGTGCCTGCACCTGTCCTGAGG - Intergenic
1128849790 15:70942680-70942702 CACCTTGTGCACATGTTCTTGGG - Intronic
1129276295 15:74447899-74447921 CTGTTTGTGCACATGTGTGGAGG - Intronic
1129277007 15:74452362-74452384 CACTTTGTCCACAGGTTCTGGGG + Exonic
1129479414 15:75811126-75811148 CAGCATGTGCAAAGGTCCTGAGG - Intergenic
1129797671 15:78390423-78390445 CAGCATGTGCAAAGGTCCTGTGG + Intergenic
1130711184 15:86282693-86282715 TTGTTTTTGGACATGTCCTGAGG + Intronic
1130742229 15:86613080-86613102 CACTTTGGGCACATGTTCTCAGG + Intronic
1131069725 15:89458591-89458613 CAGCCTGTGCAAAGGTCCTGAGG + Intergenic
1131546062 15:93316514-93316536 CAGTATATGCAAAGGTCCTGTGG + Intergenic
1131734373 15:95316508-95316530 CAGCTTGCACAAATGTCCTGGGG + Intergenic
1133319567 16:4904591-4904613 CAGCCTGTGCAAAGGTCCTGAGG + Intronic
1133401724 16:5492577-5492599 CAGTGTGTACAAAGGTCCTGTGG + Intergenic
1133503794 16:6390783-6390805 CAATTAGTGCAAAGGTCCTGGGG + Intronic
1133613906 16:7457942-7457964 CAGCATGTGCAAATGTCCTGGGG - Intronic
1133854517 16:9537064-9537086 CAGTTTGTGCAAAGGTCCTGGGG + Intergenic
1133907064 16:10031979-10032001 CAGTTTCAGCCCATGTCCTCAGG + Intronic
1133949592 16:10379879-10379901 CACTTTGGGCACATGTTCTCAGG - Intronic
1134198868 16:12181267-12181289 CACCTTGGGCACATGTCCTCGGG - Intronic
1134306605 16:13038524-13038546 CAGTACGTGCAAAAGTCCTGAGG - Intronic
1134830368 16:17317867-17317889 TAGTGTGTGCAAATGCCCTGAGG - Intronic
1134830969 16:17322574-17322596 CAGCATGTGCAGAGGTCCTGAGG - Intronic
1134892443 16:17853109-17853131 CAGCATGTGCAAAGGTCCTGTGG + Intergenic
1135153904 16:20035751-20035773 CAGCATGTGCAAATGTTCTGAGG + Intronic
1135160593 16:20091932-20091954 CAGTTTGTCTACATCTACTGTGG - Intergenic
1135693611 16:24566506-24566528 CACTTTGTGCAGATCACCTGAGG + Intronic
1135777056 16:25266102-25266124 TAGTTTCAGCAAATGTCCTGGGG + Intergenic
1136480030 16:30535304-30535326 CACCTTGGGCACATGTCGTGAGG - Intronic
1137618676 16:49861475-49861497 CAGTGTGTGCAAAGGGCCTGGGG + Intergenic
1138457744 16:57131120-57131142 CAGTTGGTGAACATGGCCTTGGG - Intronic
1138786754 16:59855496-59855518 GAGATTCTGCACAAGTCCTGTGG + Intergenic
1139333165 16:66210023-66210045 TAGTGTGTGCAAATGCCCTGGGG - Intergenic
1140054297 16:71512031-71512053 CAGCTTGGGCACATGTTCTCAGG - Intronic
1141076579 16:81011159-81011181 CAGCATGTGCAAAAGTCCTGAGG - Intronic
1141385995 16:83623139-83623161 CATTGTGTGCAGATGCCCTGAGG + Intronic
1141807183 16:86349518-86349540 CAGCATGTGCAAAGGTCCTGGGG - Intergenic
1141843767 16:86593016-86593038 CATCTTGGGCACATGACCTGCGG - Intergenic
1143224226 17:5287001-5287023 CAGTTTTTGCATATGCCTTGAGG + Intronic
1144030557 17:11318410-11318432 CAGCTTGTGCAAAGGCCCTGTGG - Intronic
1144246760 17:13373940-13373962 CAGTGAGTGCAAAGGTCCTGAGG - Intergenic
1144620702 17:16816707-16816729 CAGCATGTGCAAATGTCCTGAGG + Intergenic
1144693193 17:17282483-17282505 CACCTTGGGCACATGTCCTGAGG + Intergenic
1144759199 17:17697887-17697909 CTGTTTGTGTGCATGTCCTGTGG + Intronic
1144884940 17:18451440-18451462 CAGCATGTGCAAATGTCCTGAGG - Intergenic
1145147281 17:20492937-20492959 CAGCATGTGCAAATGTCCTGAGG + Intergenic
1145293294 17:21567356-21567378 CATCTTGTGCACATGTTCTCAGG - Intronic
1145386675 17:22418581-22418603 CATCTTGTGCACATGTTCTCAGG + Intergenic
1146238612 17:31192270-31192292 CACTTTGGGCACATGTTCTCAGG - Intronic
1146826778 17:36029998-36030020 TAGTTTGTGCAAAAGTCTTGAGG + Intergenic
1147218477 17:38914489-38914511 CTGTTGGTGCAGATGACCTGAGG + Intronic
1147572091 17:41577605-41577627 CAGCATGTGCAAATGTCCTGAGG + Intergenic
1148518219 17:48242333-48242355 CAGTTTAGGCCCATGTGCTGGGG - Intronic
1148678285 17:49457748-49457770 CAGTATGTGCAAAAGTCCTGTGG + Intronic
1148849153 17:50546332-50546354 CAGTTTGTGCAAAGGTCCCGTGG - Intronic
1149131715 17:53310084-53310106 CACCTTGTGCACATGTACTCTGG + Intergenic
1149170427 17:53803616-53803638 CACTTTGGGCACATGTTCTCAGG - Intergenic
1150700921 17:67446262-67446284 CTCTGTGTGCGCATGTCCTGAGG + Intronic
1152588248 17:81198645-81198667 GGGTTTTTGCAGATGTCCTGGGG - Intronic
1153121875 18:1738774-1738796 CACTTTGGGCACATGTTCTCAGG - Intergenic
1153526251 18:5997719-5997741 CACCTTGGGCACATGTCCTCAGG + Intronic
1153561538 18:6376183-6376205 CAGTGAGTGCACAGGTGCTGAGG - Intronic
1154048494 18:10930542-10930564 CAGTTTGGGCACATGTTCTCAGG + Intronic
1155274055 18:24169083-24169105 CAGTTGGTGCACAGTTCCCGTGG + Intronic
1156784015 18:40887689-40887711 CAGTTTGTGTACGTGTGTTGTGG - Intergenic
1157365928 18:47064355-47064377 CAGTTTGTGCACATGTCCTGTGG + Intronic
1157689468 18:49669114-49669136 CAGTCTGTTCACGTCTCCTGAGG - Intergenic
1158311618 18:56165673-56165695 CAGTTTAGGCAAATGTCCTGAGG + Intergenic
1158444027 18:57503051-57503073 CAGTTTTTGTACATGTTATGAGG + Intergenic
1159102900 18:63974855-63974877 GAGTGTGTGCACATGTATTGTGG + Intronic
1159918460 18:74205950-74205972 CACCTTGGGCACATGTCCTCAGG + Intergenic
1161222839 19:3125969-3125991 CAGCTTGTGCAAAGGTCCTGGGG + Intergenic
1161226176 19:3146986-3147008 CAGCTTGTGCAAAGGCCCTGGGG - Intronic
1161416807 19:4151829-4151851 CAGTTTGTGCAAAGGCCCTGAGG - Intergenic
1161433749 19:4249644-4249666 CAGTGTGTGCAAAGGCCCTGGGG - Intronic
1161479926 19:4505366-4505388 CAGTGTGTGCAAAGGCCCTGGGG - Intronic
1161489085 19:4552079-4552101 CAGCATGTGCAAAGGTCCTGAGG - Intronic
1161561445 19:4974982-4975004 CAGCAAGTGCACAGGTCCTGCGG - Intronic
1161634202 19:5377102-5377124 CAGTCTGTGCAAAGGCCCTGAGG + Intergenic
1161765017 19:6202728-6202750 GAGTTTGTGCAAAGGCCCTGAGG + Intergenic
1161868855 19:6854911-6854933 CAGTGTGTGCAAAGGCCCTGGGG + Intronic
1162490519 19:10988585-10988607 CAGCCTGTGCAAAGGTCCTGGGG - Intronic
1162858112 19:13484740-13484762 CAGCATGTGCAAAGGTCCTGTGG - Intronic
1163105801 19:15122532-15122554 CAGCATGTGCAAAGGTCCTGAGG - Intronic
1163205837 19:15802129-15802151 CAGCATGTGCAAAGGTCCTGAGG + Intergenic
1163255748 19:16154774-16154796 CAGTTTGTGCAAAGGACCTGAGG - Intronic
1164431530 19:28193282-28193304 CACTTTAGGCACATGTCCTTAGG + Intergenic
1164473048 19:28551797-28551819 CATCTTGTGCACATGTTCTCAGG + Intergenic
1165249734 19:34520217-34520239 CACCTTGTGCACGTGTCCTCAGG - Intergenic
1165257136 19:34584812-34584834 CACCTTGGGCACATGTCCTCAGG - Intergenic
1165783899 19:38449719-38449741 CAGCATGTGCAAAGGTCCTGAGG + Intronic
1166592766 19:44015652-44015674 CACTTTGGGCACATGTTCTCAGG - Intergenic
1166767769 19:45262690-45262712 CAGCTTGTGCAAAGGCCCTGAGG + Intronic
1167553055 19:50174289-50174311 CAGCATGTGCAAAGGTCCTGTGG - Intergenic
1167654789 19:50756462-50756484 CAGCTTGTGCAAAGGTCCTGAGG - Intergenic
1167987507 19:53331269-53331291 CACTTTGGGCACATGTCATCAGG + Intergenic
1168264632 19:55215778-55215800 CAGTGTGTGCAAAGGCCCTGAGG - Intergenic
1168321001 19:55509389-55509411 CTCTTTGTGCCCATGTCCTTAGG - Intronic
925121782 2:1424093-1424115 CATCTTGGGCACATGTCCTCAGG - Intronic
926208544 2:10851290-10851312 CATCTTGGGCACATGTCTTGAGG + Intronic
926236799 2:11051756-11051778 CAGCTCATGCAAATGTCCTGAGG + Intergenic
926412994 2:12624522-12624544 CACTCTGGGCACATGTCCTCAGG - Intergenic
926623603 2:15070694-15070716 CAGGGTGTGCACTTGTCCTCAGG + Intergenic
926979979 2:18558970-18558992 CACCTTGGGCACATGTCCTCAGG + Intronic
927494718 2:23544762-23544784 CAGTGTGTGCAAAGGTCCTGAGG + Intronic
927892825 2:26763137-26763159 CACTTTGGGCACATGTTCTCAGG + Intergenic
928350456 2:30548300-30548322 CACTTTGGGCACATGTTCTCAGG - Intronic
928682138 2:33713640-33713662 CACCTTGGGCACATGTCCTCAGG - Intergenic
928716109 2:34062813-34062835 CACCTTGGGCACATGTTCTGAGG - Intergenic
929005925 2:37392651-37392673 CAGCCTGTGCAAAGGTCCTGAGG - Intergenic
929211662 2:39364508-39364530 CACTTTGGGCACATGTTCTCAGG - Intronic
931541425 2:63333763-63333785 CACTTTGGGCACATGTCCTCAGG + Intronic
932184983 2:69686832-69686854 AAGTTTGTGCACATGGGCTCTGG + Intronic
932549281 2:72751177-72751199 CAGCTTGGGCACATGTCATCAGG - Intronic
932746056 2:74334388-74334410 CAGTAAGTGCAAAGGTCCTGAGG - Intronic
932762954 2:74451541-74451563 CACTTTGGGCACATGTTCTCAGG + Intergenic
933066832 2:77808234-77808256 CACCTTGGGCACATGTCCTCAGG + Intergenic
933196820 2:79399979-79400001 CACTTTGGGCACATGTCATGAGG - Intronic
933992067 2:87640928-87640950 CAGCTTGTGCAAAGGCCCTGGGG + Intergenic
935079773 2:99781143-99781165 CAGTAGGTGCAAAGGTCCTGAGG - Intronic
935746105 2:106191701-106191723 CAGTGTGTGCAGAGGTCCTGCGG - Intronic
935808557 2:106772904-106772926 CACCTTGGGCACATGTCCTCAGG - Intergenic
936301776 2:111309890-111309912 CAGCTTGTGCAAAGGCCCTGGGG - Intergenic
938546230 2:132334668-132334690 CACTTTGGGCACATGTCGTCAGG - Intergenic
938592733 2:132755168-132755190 CAGATTGTCCTCATGGCCTGGGG - Intronic
939012296 2:136860936-136860958 CAGTAAGTGCTGATGTCCTGAGG - Intronic
940144701 2:150533760-150533782 CATTTTTTGAACATGCCCTGTGG + Intronic
940209626 2:151243046-151243068 CATTTTGTGCACATGGAGTGGGG + Intergenic
940775953 2:157884200-157884222 CAGTTTGGGCAGATCACCTGAGG + Intronic
940892417 2:159047742-159047764 CACTTTGGGCACATGTCATCAGG + Intronic
941285052 2:163601057-163601079 CAGGCTGTGCTCATGGCCTGGGG + Intronic
942097800 2:172549738-172549760 CACCTTGGGCACATGTTCTGAGG - Intergenic
942174438 2:173318474-173318496 CACTTTGGGCACATGTTCTCAGG - Intergenic
943260450 2:185653506-185653528 CACCTTGCGCACATGTCCTCAGG - Intergenic
944303769 2:198156302-198156324 CACCTTGAGCACATGTCCTTAGG + Intronic
945530188 2:210944065-210944087 CAGTGAGTGCAAATGTCTTGAGG + Intergenic
945624034 2:212178027-212178049 CAGTATGTGCAAATGGTCTGTGG + Intronic
946374461 2:219299718-219299740 GAGCATGTGCACATGTCCTCAGG - Exonic
947287953 2:228538632-228538654 CACTTTGGGCACATGTCATCAGG + Intergenic
947929561 2:233952489-233952511 CAGCATGTGCAAAGGTCCTGAGG + Intronic
948428122 2:237901535-237901557 CAGCATGTGCAAAGGTCCTGAGG + Intronic
948445408 2:238029031-238029053 CAATTTGAGCATATGTGCTGCGG + Intronic
948819730 2:240535145-240535167 CACCTTGGGCACATGTTCTGAGG - Intronic
949030089 2:241791118-241791140 CAACTTGGGCACATGTTCTGAGG + Intronic
949076564 2:242062790-242062812 CACCTTGTGCACATGTCGTCAGG - Intergenic
1168957945 20:1847962-1847984 CAGCTGGTGCAAAGGTCCTGGGG + Intergenic
1169324046 20:4661032-4661054 CACCTTGTGCACATGTGCTCAGG - Intergenic
1169424458 20:5485407-5485429 CAGATTTTGGACATTTCCTGAGG + Intergenic
1169912859 20:10661453-10661475 CAGCATGTGCAAAGGTCCTGAGG + Intronic
1170074495 20:12404871-12404893 CACTTTGGGCACATGTTCTCAGG - Intergenic
1170248270 20:14248627-14248649 CATTTTATGCACATAGCCTGAGG - Intronic
1170253342 20:14311469-14311491 CATTTTTTGAACATATCCTGTGG + Intronic
1170426740 20:16242698-16242720 CAGTCAGTGCAAAGGTCCTGGGG + Intergenic
1170930637 20:20767147-20767169 CACCTTGGGCACATGTCCTCAGG - Intergenic
1171170859 20:23014296-23014318 CAGTGTGTGCAAAGGCCCTGGGG + Intergenic
1171250851 20:23645908-23645930 CAGTTTGTGCAAAGGCCCTGAGG - Intergenic
1171875093 20:30567400-30567422 CACTTTGGGCACATGTCGTCAGG - Intergenic
1172051035 20:32118335-32118357 CACTTTCTGCACATCTTCTGTGG + Intronic
1172231083 20:33336552-33336574 CAGAATGTGCAAAGGTCCTGGGG + Intergenic
1173102487 20:40099785-40099807 CAGTTTGTGCAAAAGTCCTATGG + Intergenic
1173445004 20:43109821-43109843 AAGTATGTGCAAAGGTCCTGGGG + Intronic
1173966416 20:47115935-47115957 CAGTGTGTGCAAAGGCCCTGTGG - Intronic
1174323588 20:49761596-49761618 CACCTTGTGCATATGTCCTCAGG + Intergenic
1174643146 20:52062625-52062647 CAGTGTGTGCAAAGGTCCTGAGG + Intronic
1175058362 20:56218780-56218802 CACCTTGGGCACATGTCCTCTGG - Intergenic
1175275185 20:57763627-57763649 CAGTTTGTGCAAAAATCCTGAGG + Intergenic
1175367638 20:58466931-58466953 CAGGGTGCGCAAATGTCCTGAGG + Intronic
1175785944 20:61711902-61711924 CAGTCAGTGCAAGTGTCCTGGGG + Intronic
1177814529 21:25961325-25961347 CACTTTGGGCACATGTCATCAGG + Intronic
1178118012 21:29437064-29437086 CACTTTGGGCACATGTCATCAGG - Intronic
1179170002 21:38965609-38965631 CATCTTGGGCACATGTCCTCAGG + Intergenic
1180106506 21:45622414-45622436 CACATTGTGCACATGTACTCCGG + Intergenic
1180128871 21:45812278-45812300 CACTTTGGGCACATGTTCTCAGG - Intronic
1181928127 22:26376805-26376827 CAGCATGTGCAAAGGTCCTGAGG + Intronic
1182621216 22:31619820-31619842 CTGTTTGTGTGCAGGTCCTGTGG + Exonic
1182649588 22:31840322-31840344 CAGTTTGTGCAAAGGCTCTGTGG + Intronic
1183097342 22:35560997-35561019 CAGCATGTGCAAAAGTCCTGTGG - Intergenic
1183457191 22:37929319-37929341 CACTATGTCCACATGACCTGTGG - Intronic
1183944750 22:41318873-41318895 CAGTGAGTGCAAAGGTCCTGAGG - Intronic
1184419299 22:44370277-44370299 CAGTTTGTGCAAAAGCCCTGAGG + Intergenic
1184724303 22:46334693-46334715 CAGTTTGAGCACGTGTTCTCAGG - Intronic
1184917287 22:47578659-47578681 CACCTTGGGCACACGTCCTGAGG + Intergenic
949530991 3:4954959-4954981 CACCTTGGGCACATGTCCTCTGG - Intergenic
949575504 3:5335150-5335172 CAGTATGTGCAAAGGTCCTAAGG + Intergenic
949699176 3:6736169-6736191 CACCTTGAGCACATGTCCTCAGG - Intergenic
949886248 3:8696906-8696928 CACATGGTGCACATGCCCTGTGG + Intronic
950464054 3:13142900-13142922 CAGCTGGTGCACATCTCCTGAGG - Intergenic
950532662 3:13561529-13561551 CAGTATGTGCAAAAGCCCTGAGG - Intronic
950774265 3:15336208-15336230 CAGCATGTGCAAAGGTCCTGAGG + Intronic
951612293 3:24504017-24504039 CAGTGTGTGCAAAGGTCCTGAGG - Intergenic
951773308 3:26282543-26282565 CACTTTGAGCACATGTTCTCAGG - Intergenic
952112234 3:30137439-30137461 CACATGGTGCACATGCCCTGTGG - Intergenic
952276333 3:31880710-31880732 CAGCATGTGCAAAGGTCCTGTGG - Intronic
953147676 3:40293762-40293784 CACTTTGGGCACATGTTCTCAGG + Intergenic
955069162 3:55557773-55557795 CAGCATGTGCAAAGGTCCTGTGG - Intronic
955416358 3:58695712-58695734 CACCTTGGGCACATGTCCTCAGG - Intergenic
955796698 3:62644684-62644706 CAGCTTGTGCAAAGGTCCTGTGG - Intronic
955961566 3:64346263-64346285 CAGCTGGTGCAAAGGTCCTGTGG + Intronic
956372699 3:68581133-68581155 CACTTTGTGCACATGTACCCTGG - Intergenic
957393839 3:79615444-79615466 CACCTTGGGCACATGTTCTGAGG + Intronic
957571317 3:81950436-81950458 CAGCATGTGCACATGTCATCAGG - Intergenic
959298160 3:104564802-104564824 GTCTTTGTGCACATGTGCTGGGG - Intergenic
959690269 3:109190626-109190648 CACCTTGGGCACATGTCCTTAGG + Intergenic
960712790 3:120547545-120547567 CACCTTGGGCACATGTCCTCAGG - Intergenic
961270956 3:125688182-125688204 CACATGGTGCACATGCCCTGTGG + Intergenic
961356908 3:126345059-126345081 CAGTATGTGCAAATGGCCTGTGG - Intronic
962076762 3:132090328-132090350 CAGCTGGTGCAAAGGTCCTGAGG - Intronic
962306871 3:134295379-134295401 AAGCTTGTGCAAATGTCCTGTGG + Intergenic
962371871 3:134827589-134827611 TAGTTCCTGCACAAGTCCTGAGG + Intronic
962647081 3:137451034-137451056 CAGCATGTGCAAAGGTCCTGAGG + Intergenic
962749654 3:138424521-138424543 CAGCATGTGCATATTTCCTGTGG + Intergenic
963068457 3:141282245-141282267 CAGTTTGTGCAAAGGCCCTGAGG - Intronic
963080110 3:141383874-141383896 ATGTTTGTGCACATGCCCCGAGG + Intronic
964127017 3:153244600-153244622 AAGTGTGTGCACATGTACAGTGG + Intergenic
966073668 3:175909126-175909148 CACATTGTGCACATGTACTGTGG + Intergenic
966537558 3:181051485-181051507 CACTTTGGGCACATGTTCTCAGG - Intergenic
967820194 3:193832946-193832968 CTGCTTGTGCAAATGTCCCGTGG + Intergenic
968182261 3:196604692-196604714 CAGGCTGTGCACCTGTGCTGGGG - Intergenic
969079974 4:4610718-4610740 GGGTATGTGCACATGTCCTCAGG - Intergenic
969454041 4:7291092-7291114 CAGCATGTGCAAAGGTCCTGAGG + Intronic
969480485 4:7444488-7444510 CAGCCTGTGCAAAGGTCCTGTGG + Intronic
969498903 4:7541308-7541330 CAGCATGTGCCCAGGTCCTGGGG - Intronic
969759809 4:9173784-9173806 CAGTTTTTGCACTTGAGCTGTGG - Exonic
970289255 4:14553537-14553559 CAGAATGTGCAAAGGTCCTGTGG - Intergenic
971323383 4:25623500-25623522 CTGTTTGTGCAAATCTCCTCAGG - Intergenic
971851626 4:31992530-31992552 CAACTTGTGCACATGTTCTCAGG - Intergenic
973055981 4:45658364-45658386 CATTGTGTACACATCTCCTGAGG - Intergenic
974166772 4:58214437-58214459 AAGCTTGTGCAAATATCCTGAGG - Intergenic
976116946 4:81738045-81738067 CAGCTTGTGCAAAGGCCCTGTGG - Intronic
976321575 4:83722832-83722854 CTCTTTGTGGACCTGTCCTGAGG + Intergenic
976507669 4:85868022-85868044 CACTTTGAGCACATGTTCTTAGG - Intronic
977895708 4:102362404-102362426 CAGCATGTGCAAAGGTCCTGAGG - Intronic
978575272 4:110183452-110183474 CACCTTGTGCACATGTTCTCAGG + Intronic
979715233 4:123829738-123829760 CAGTTTGTGGTCATTTACTGTGG + Intergenic
980081809 4:128351955-128351977 CACTTTGGGCACATGTTCTCAGG + Intergenic
980545367 4:134254961-134254983 CAGTTTTTGCAGATGTTCTTTGG + Intergenic
980962489 4:139489812-139489834 CAGCATGTGCAAAGGTCCTGAGG + Intergenic
981047547 4:140279115-140279137 CAGCTTGTGCAAAGGCCCTGTGG - Intronic
981523313 4:145687381-145687403 CACCTTGGGCACATGTCCTCAGG + Intronic
982982135 4:162152132-162152154 CTGTTTCTCTACATGTCCTGAGG - Intronic
983827134 4:172277160-172277182 TAGTTTGTGTAAATGCCCTGAGG - Intronic
984055097 4:174918429-174918451 CTGTTCCTGCACATTTCCTGAGG + Exonic
984580773 4:181507551-181507573 CATTTTTTATACATGTCCTGTGG + Intergenic
984823288 4:183903320-183903342 CAGTCTGTGCAAAGGCCCTGGGG - Intronic
986265229 5:6184850-6184872 CAGCCTGTGCACCTCTCCTGAGG + Intergenic
987265753 5:16253342-16253364 CACTTTGGGCACATGTTCTCAGG - Intergenic
988183731 5:27833552-27833574 CACTTTGGGCACATGTTCTCAGG - Intergenic
989329414 5:40238770-40238792 CAGTTGATGCACAGATCCTGGGG + Intergenic
989664912 5:43842672-43842694 CAGTGTGTGCAAAGGCCCTGAGG + Intergenic
990048722 5:51468415-51468437 CAGATTGTGCAAGTGTCCTAGGG + Intergenic
990141647 5:52711423-52711445 GAGTTTGGGGTCATGTCCTGTGG - Intergenic
990176133 5:53110246-53110268 CACCTTGGGCACATGTCCTCAGG - Intergenic
991465241 5:66905622-66905644 CACCTTGGGCACATGTTCTGAGG - Intronic
992622650 5:78609216-78609238 CAGTTTGGGCAGATCACCTGAGG + Intronic
992699211 5:79323761-79323783 CATTTTATACATATGTCCTGTGG + Exonic
992887963 5:81177843-81177865 CAGTATGTGCAAAGGCCCTGGGG + Intronic
993027677 5:82665035-82665057 CAGTGTTTGCACAGGTGCTGTGG + Intergenic
995248048 5:109958243-109958265 GAGTCAGTGCAAATGTCCTGAGG + Intergenic
995285722 5:110386081-110386103 CACTTTGGGCACATGTTCTCAGG + Intronic
996628219 5:125596418-125596440 CACCTTGGGCACATGTCCTCAGG + Intergenic
997158841 5:131585999-131586021 CACCTTGAGCACATGTCATGAGG + Intronic
998384127 5:141746573-141746595 CAGTTTGTGCAAAGGCCCTGTGG + Intergenic
998389337 5:141777322-141777344 CAGTATGTGCAAATGCCCTGTGG + Intergenic
998881117 5:146645920-146645942 CAGTGTGTACAGAGGTCCTGTGG - Intronic
999088919 5:148918172-148918194 CACTTTGTGCACATGTACCCTGG - Intergenic
999483018 5:151966233-151966255 CAGCATGTGCAAAGGTCCTGAGG + Intergenic
999870078 5:155740939-155740961 CACTTTGGGCACATGTTCTCAGG - Intergenic
999957711 5:156720425-156720447 GTGTTTGTGCAAAGGTCCTGAGG + Intronic
1000166161 5:158650691-158650713 CAGTTAGTACAAAGGTCCTGAGG - Intergenic
1000200330 5:159003712-159003734 AAGTTTGAGCACATGGCTTGTGG - Intronic
1000226957 5:159272024-159272046 CAGTCTCTGCACAAGACCTGTGG - Exonic
1000574133 5:162954794-162954816 CACTTTGGGCACATGTCGTCAGG - Intergenic
1001303934 5:170557683-170557705 CAGTTTGTACAAAGGCCCTGAGG + Intronic
1001531461 5:172465196-172465218 CAGCATGTGCAAAGGTCCTGAGG + Intergenic
1001742413 5:174064952-174064974 CAGCTTGTGCAAAGGCCCTGAGG + Intronic
1002063542 5:176640840-176640862 CAGTATGTGCAAATGCCCTGGGG - Intronic
1002455384 5:179343411-179343433 GAGTGTGTGCACATGTGTTGTGG - Intronic
1002521969 5:179797124-179797146 CAGTGTGTGCAAAGGCCCTGAGG + Intergenic
1002997093 6:2297077-2297099 CCTTTTGTGATCATGTCCTGTGG + Intergenic
1003195163 6:3907876-3907898 CACCTTGGGCACATGTCCTCAGG + Intergenic
1003396535 6:5758071-5758093 CAGTTATGGCACATGTCTTGTGG - Intronic
1004063825 6:12223572-12223594 CAGTGTGTGCAAAGGCCCTGAGG - Intergenic
1004433522 6:15567716-15567738 CACTTTGGGCACATGTCCTCAGG + Intronic
1004481132 6:16020245-16020267 CACCTTGTGCACATGTCATCAGG + Intergenic
1004583572 6:16977788-16977810 AATTTTGTGCATATGTACTGGGG + Intergenic
1004776071 6:18846509-18846531 CAACATGTGCAAATGTCCTGTGG + Intergenic
1005621601 6:27625546-27625568 CACTTTGGGCACATGTCATCAGG - Intergenic
1009053173 6:58303246-58303268 CAGTATGTGCACTAATCCTGCGG - Intergenic
1010181062 6:73086923-73086945 CAGCTTGTGCAAAGGCCCTGAGG + Intronic
1013039216 6:106417336-106417358 AAGGTTGTGCAAATGACCTGAGG + Intergenic
1013348560 6:109285898-109285920 AAGTTTGTACACATGTACTAGGG + Intergenic
1013993153 6:116278096-116278118 CAGTATGGGCACATGCCCTGTGG - Exonic
1014239012 6:118994017-118994039 CAGTGTGTGCACAGCCCCTGAGG - Intronic
1014252536 6:119129239-119129261 CACTTTGAGCACATGTTCTCAGG + Intronic
1015209947 6:130685672-130685694 CAGCTTGTGCAAAGGTCCTGGGG + Intergenic
1015454146 6:133405915-133405937 CAGCATGTGCAAAGGTCCTGAGG + Intronic
1017863395 6:158420979-158421001 CACTTTGGGCACATGTTCTCAGG - Intronic
1018305449 6:162449973-162449995 CAGTCCGTGCACATGGCATGTGG + Intronic
1018899188 6:168042760-168042782 AAGTGTGTGCACATGTCCTGGGG - Intronic
1019099703 6:169619470-169619492 CACTTTGGGCACATGTTCTGAGG - Intronic
1019823173 7:3261364-3261386 CAGGTTGAGCACATGTCATCAGG - Intergenic
1020002567 7:4764209-4764231 GAGGTTCTGCACTTGTCCTGGGG - Exonic
1020112734 7:5456587-5456609 CAGCTTGTGCAAAGGCCCTGGGG + Intronic
1021788057 7:24172436-24172458 CACTTTGGGCACATGTTCTCAGG + Intergenic
1021978291 7:26030282-26030304 CACTTTGGGCACATGTTCTCAGG - Intergenic
1023308588 7:38857766-38857788 CACCTTGGGCACATGTTCTGAGG - Intronic
1023411681 7:39894426-39894448 CACTTTGGGCACATGTTCTCAGG + Intergenic
1023765402 7:43505633-43505655 CAGCATGTGCAAAGGTCCTGTGG - Intronic
1024632459 7:51261101-51261123 CAGCATGTGCACATCTCCTGCGG - Intronic
1024780173 7:52838398-52838420 CCCCTTGTGCACATGCCCTGAGG - Intergenic
1025003245 7:55335859-55335881 CAGCTTGGGCACATGTCATCAGG - Intergenic
1025067327 7:55868521-55868543 CACTTTGGGCACATGTCATCGGG - Intergenic
1025849227 7:65232149-65232171 CACCTTGTGCACATGTCATCAGG - Intergenic
1026496617 7:70909123-70909145 CAGCTTGGGCACATGTTCTCAGG - Intergenic
1027772400 7:82423869-82423891 CAGTTTGTGCACTTTTCTTGTGG - Intronic
1029441917 7:100591536-100591558 CTGTTTGTTCCCCTGTCCTGGGG + Intronic
1029880134 7:103799508-103799530 CAGCATGTGCAAATGTTCTGAGG - Intronic
1030141321 7:106306995-106307017 CACTTTATGCAAGTGTCCTGAGG + Intergenic
1032420352 7:131774387-131774409 CACTTTGGGCACATGTTCTCAGG + Intergenic
1032801332 7:135319400-135319422 CACCTTGGGCACATGTCCTCAGG + Intergenic
1032872691 7:136003011-136003033 ACGTTTGTGCAAAGGTCCTGAGG - Intergenic
1033162955 7:139013318-139013340 CACCTTGGGCACATGTTCTGAGG + Intergenic
1033434864 7:141323993-141324015 CAGCAAGTGCAAATGTCCTGAGG + Intronic
1033458877 7:141527512-141527534 CAGTGTGTGCAAAGGCCCTGAGG - Intergenic
1033626956 7:143119723-143119745 CACTTTGGGCACATGTTCTCAGG - Intergenic
1034418413 7:150977049-150977071 CAGATTAGGCAAATGTCCTGGGG - Intronic
1035687043 8:1531914-1531936 CACCTTGGGCACATGTCCTCAGG - Intronic
1036004564 8:4647273-4647295 CAGTTTGTGCACATGTATCCCGG - Intronic
1036263405 8:7257515-7257537 CAGTTTTTGCACTTGAGCTGTGG - Intergenic
1036264708 8:7265137-7265159 CAGTTTTTGCACTTGAGCTGTGG - Intergenic
1036266007 8:7272759-7272781 CAGTTTTTGCACTTGAGCTGTGG - Intergenic
1036267309 8:7280381-7280403 CAGTTTTTGCACTTGAGCTGTGG - Intergenic
1036268612 8:7288003-7288025 CAGTTTTTGCACTTGAGCTGTGG - Intergenic
1036269916 8:7295625-7295647 CAGTTTTTGCACTTGAGCTGTGG - Intergenic
1036289227 8:7472736-7472758 CACCTTGGGCACATGTCCTCAGG - Intronic
1036297978 8:7551429-7551451 CAGTTTTTGCACTTGAGCTGTGG + Intergenic
1036299283 8:7559078-7559100 CAGTTTTTGCACTTGAGCTGTGG + Intergenic
1036300588 8:7566727-7566749 CAGTTTTTGCACTTGAGCTGTGG + Intergenic
1036301892 8:7574372-7574394 CAGTTTTTGCACTTGAGCTGTGG + Intergenic
1036303189 8:7582021-7582043 CAGTTTTTGCACTTGAGCTGTGG + Intergenic
1036315449 8:7716054-7716076 CAGTTTTTGCACTTGAGCTGTGG - Intergenic
1036316757 8:7723702-7723724 CAGTTTTTGCACTTGAGCTGTGG - Intergenic
1036318064 8:7731350-7731372 CAGTTTTTGCACTTGAGCTGTGG - Intergenic
1036319371 8:7738998-7739020 CAGTTTTTGCACTTGAGCTGTGG - Intergenic
1036320680 8:7746645-7746667 CAGTTTTTGCACTTGAGCTGTGG - Intergenic
1036321990 8:7754293-7754315 CAGTTTTTGCACTTGAGCTGTGG - Intergenic
1036323299 8:7761941-7761963 CAGTTTTTGCACTTGAGCTGTGG - Intergenic
1036324594 8:7769588-7769610 CAGTTTTTGCACTTGAGCTGTGG - Intergenic
1036332254 8:7838791-7838813 CACCTTGGGCACATGTCCTCAGG + Intronic
1036351440 8:8014719-8014741 CAGTTTTTGCACTTGAGCTGTGG + Intergenic
1036352746 8:8022365-8022387 CAGTTTTTGCACTTGAGCTGTGG + Intergenic
1036354037 8:8030013-8030035 CAGTTTTTGCACTTGAGCTGTGG + Intergenic
1036658603 8:10693215-10693237 CAGCTTGTGCAAAGGCCCTGTGG - Intronic
1036846699 8:12175138-12175160 CAGTTTTTGCACTTGAGCTGTGG + Intergenic
1038423342 8:27448200-27448222 CAGTTCTTGCACTTGTCCTGTGG - Intronic
1039761684 8:40583657-40583679 CACTTTGGGCACATGTCCTCAGG - Intronic
1041022314 8:53650176-53650198 CAATCAGTGCATATGTCCTGGGG - Intergenic
1043763819 8:84104183-84104205 CAGTATGTTCAAAAGTCCTGTGG + Intergenic
1044083133 8:87909407-87909429 CTGTTTGGGCACATGTTCTCAGG + Intergenic
1044725522 8:95191501-95191523 TGCTTTGTGCAGATGTCCTGGGG + Intergenic
1045036127 8:98177926-98177948 CAGTTCGTGCAGAAGCCCTGCGG + Intergenic
1045672708 8:104574573-104574595 CTGTATGTAAACATGTCCTGTGG - Intronic
1046040302 8:108895354-108895376 AAGTTTGTGAAAATGTCATGAGG + Intergenic
1047695774 8:127402176-127402198 CAGGTAGTGCACCTGTCCAGTGG - Intergenic
1047764228 8:127977266-127977288 CAGGGTGTGTACATTTCCTGGGG + Intergenic
1047784538 8:128141319-128141341 CAGCATGTGCAAATGTCCTGAGG - Intergenic
1048383287 8:133887755-133887777 TAGTTTGAGAACATGTTCTGAGG - Intergenic
1048514060 8:135089248-135089270 CAGTGAGTGCAAATGTCCTGAGG - Intergenic
1048841845 8:138573382-138573404 CAGTATATGCAAATTTCCTGTGG - Intergenic
1049475657 8:142795920-142795942 AAGTTTGTGCCCATCACCTGGGG + Intergenic
1049832586 8:144711561-144711583 CCGTTTGTGCATAGGTCTTGAGG + Intergenic
1050118518 9:2284970-2284992 CAGTATGTGCAAAGGCCCTGAGG - Intergenic
1050174621 9:2856860-2856882 CAGCAAGTGCAGATGTCCTGAGG + Intergenic
1050229070 9:3498666-3498688 CTGTTTGTGCACAGGACTTGTGG - Intronic
1050330210 9:4538173-4538195 CACCTTGGGCACATGTCCTCAGG - Intronic
1050495767 9:6240201-6240223 CACTTTGAGCACATGTTCTCAGG - Intronic
1050797407 9:9561367-9561389 CAGTGTGGGCACATGTTCTCAGG + Intronic
1050944173 9:11497696-11497718 CACCTTGGGCACATGTTCTGAGG - Intergenic
1055790019 9:79913724-79913746 CACCTTGTGCACATGTCATCAGG + Intergenic
1056705353 9:88947904-88947926 GAGTTTTTGCACATGTTCTCAGG + Intergenic
1056707136 9:88960714-88960736 CAGCTAGTGCAAAGGTCCTGAGG - Intergenic
1056928533 9:90855066-90855088 CAGGTTGTGCACAGGTCCACAGG - Intronic
1057701375 9:97365521-97365543 CAGAGTGTGCAGAGGTCCTGGGG + Intronic
1057722941 9:97547278-97547300 GAGTATGTGCAAAGGTCCTGAGG - Intronic
1057986768 9:99724817-99724839 CAGTGTGTGCAAAGGACCTGTGG - Intergenic
1058125460 9:101189109-101189131 CACTTTGAGCACATGTTCTGAGG - Intronic
1059449459 9:114361235-114361257 CAGCTTGTGCAAAGGCCCTGTGG - Intronic
1059546681 9:115183036-115183058 CATTTTGGGCACATGTTCTCAGG - Intronic
1059632499 9:116139703-116139725 CAGTATGTGCAAAGGCCCTGTGG - Intergenic
1060035567 9:120252720-120252742 CAGATTGTGCAAAGGTCCTGAGG + Intergenic
1060044123 9:120326482-120326504 CATCTTGTGCAAAGGTCCTGAGG - Intergenic
1060052129 9:120385085-120385107 CAGCATGTGCAAAGGTCCTGTGG + Intergenic
1060057361 9:120426289-120426311 CACTTTGGGCACATGTTCTCAGG - Intronic
1060779516 9:126401109-126401131 CAGGATGTGCCCATGGCCTGGGG - Intronic
1060794896 9:126506809-126506831 CACTCTGAGCACATGTCCGGGGG + Exonic
1061307634 9:129741218-129741240 CAGTGTGTGCAAAGGTCCTGAGG + Intronic
1061972513 9:134052687-134052709 CAGTATGTAGACCTGTCCTGGGG - Intronic
1062492208 9:136811168-136811190 CACCTTGGGCACATGTCCTCAGG - Intronic
1062670375 9:137705349-137705371 GAGTTTGGGCAGATGTACTGAGG + Intronic
1203790295 EBV:147921-147943 CAGATTCTGAACTTGTCCTGTGG + Intergenic
1185852220 X:3499816-3499838 CACTTTGTGCACATGTTGTCAGG - Intergenic
1185983384 X:4804262-4804284 CATTTTGGGCACATGTTCTCAGG - Intergenic
1186524747 X:10238254-10238276 CAGCAAGTGCAAATGTCCTGAGG + Intergenic
1187243213 X:17531742-17531764 CAGCTTGTGCAAAGGCCCTGTGG - Intronic
1187616149 X:20995527-20995549 CACTTTGGGCACATGTCGTCAGG + Intergenic
1188839052 X:34992462-34992484 CACCTTGGGCACATGTCCTTAGG - Intergenic
1189926177 X:45957980-45958002 CAGTTAGTGCAAAGGCCCTGAGG + Intergenic
1191176525 X:57507840-57507862 CATTTTGTGCACATGTACCCTGG + Intergenic
1193001323 X:76565659-76565681 CACTTTGTGCACATGTACCCTGG + Intergenic
1193384654 X:80856088-80856110 CACCTTGTGCACATGTCGTCAGG - Intergenic
1194003723 X:88464511-88464533 CACTTTGCGCACATGTCATCAGG + Intergenic
1194010789 X:88558611-88558633 CACTTTGAGCACATGTTCTCAGG + Intergenic
1194317831 X:92403382-92403404 CATTTTATGCATATCTCCTGGGG + Intronic
1194534063 X:95084505-95084527 CACCTTGGGCACATGTCCTCAGG - Intergenic
1195795716 X:108644665-108644687 CAGTTTGGGCAGATCACCTGAGG + Intronic
1196184431 X:112730889-112730911 CAGTGTATACACATGTTCTGTGG - Intergenic
1196884968 X:120235680-120235702 CACCTTGGGCACATGTCGTGAGG + Intergenic
1197028928 X:121789987-121790009 CACCTTGTGCACATGTCATCAGG + Intergenic
1197758571 X:130012885-130012907 CAGATGGTGCAAGTGTCCTGAGG - Intronic
1198374725 X:136027384-136027406 CAAGTTGTACAAATGTCCTGAGG + Intronic
1198880092 X:141271786-141271808 CACTTTGGGCACATGTCCTCAGG - Intergenic
1200056082 X:153461999-153462021 CACCTTGTGCACATGTTCTCAGG + Intronic
1200626007 Y:5516678-5516700 CATTTTATGCATATCTCCTGGGG + Intronic
1200979196 Y:9246338-9246360 CATCTTGGGCACATGTTCTGAGG + Intergenic
1202132169 Y:21622804-21622826 CATCTTGGGCACATGTTCTGAGG - Intergenic