ID: 1157367463

View in Genome Browser
Species Human (GRCh38)
Location 18:47078714-47078736
Sequence AGGTATTCACTGGGGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157367463 Original CRISPR AGGTATTCACTGGGGGTAGA AGG (reversed) Intronic
901473559 1:9473886-9473908 AGGCATTCACAGAGGGGAGACGG - Intergenic
902242621 1:15099095-15099117 AGGAGTTCACTGGGGGAAGAGGG + Intronic
904855001 1:33491224-33491246 AGGTGTTCACTGGGGCTATGAGG + Exonic
909952157 1:81733705-81733727 AGCTATTAGCAGGGGGTAGAAGG - Intronic
911520185 1:98920208-98920230 AGGTGTTCACTGGAAGTATAGGG + Intronic
915081297 1:153354531-153354553 AGGTTTTCACTGGGAGAAAAGGG - Intergenic
915132894 1:153708234-153708256 AGAAATTCTGTGGGGGTAGAGGG - Intergenic
916492670 1:165315691-165315713 AGGTTTTTCCTGGGGGTAGAGGG - Intronic
917590850 1:176475451-176475473 AGGTCTACACTGGGGAGAGAGGG + Intronic
918309939 1:183278695-183278717 ATGTATTCACCAGGGGAAGAAGG - Intronic
918373544 1:183885315-183885337 AGGTAATCACTCTGGGTTGAAGG - Intronic
920252178 1:204629101-204629123 AGGGATCCACTGGGGCTAAAGGG - Intronic
920429324 1:205906390-205906412 AGGCATCTATTGGGGGTAGATGG - Intergenic
922248247 1:223821511-223821533 AGGTGTGGACTGGGGGTTGAGGG + Intronic
922469436 1:225866836-225866858 AAGTATTCACTGTGGGCTGAGGG - Intronic
1067157862 10:43797548-43797570 AGGAATCCACTGGGGGAAAAAGG - Intergenic
1068550195 10:58399344-58399366 AGGTATACAATGGGGGAAGAGGG + Intergenic
1069413682 10:68178873-68178895 AGACATTAGCTGGGGGTAGAGGG - Intronic
1073505548 10:103985259-103985281 ATGTATTCCCTGGGGATAGAGGG + Intronic
1076135065 10:128040063-128040085 AGGTATTTATTGGGGGTAGGGGG - Intronic
1078667185 11:13335492-13335514 AGGCTTTTACTGGGGGAAGAGGG + Intronic
1080252911 11:30255897-30255919 TGGTATTCACTTGGAGTAGTGGG - Intergenic
1080859408 11:36140280-36140302 AGGTATTCTCTGGTGTGAGAAGG - Intronic
1081367315 11:42251421-42251443 AGGTTTTCACTGGGGGGTGGAGG - Intergenic
1081505974 11:43717563-43717585 TGGTATTGGCTGGGGGTAGAGGG + Intronic
1082675168 11:56090056-56090078 AGGTATCCACTGGGGGTCGTAGG - Intergenic
1084802017 11:71550255-71550277 CCGTGTTCACTGTGGGTAGATGG - Intronic
1087263435 11:96036298-96036320 AGGTTTTAAGTAGGGGTAGAAGG + Intronic
1087661509 11:100994141-100994163 AGGTATCCACCGAGGGGAGAGGG + Intergenic
1091487165 12:900586-900608 AGGTTGTCACTGGAGGGAGATGG - Exonic
1092786035 12:12027951-12027973 AGGTATTCACAGTGAGTAGTTGG - Intergenic
1095241550 12:39865865-39865887 AGGGATTACTTGGGGGTAGAGGG + Intronic
1099065468 12:77972706-77972728 AGGTATTCATTGGGAGATGAAGG + Intronic
1100316999 12:93453755-93453777 AGGAATTCACTGGGAGGACATGG + Intergenic
1102198672 12:111042450-111042472 AGGTAGTCTTTGGGGGTGGAGGG - Intronic
1102668835 12:114600101-114600123 AGCTACACACTGGGGGAAGAGGG + Intergenic
1107196484 13:37658809-37658831 ATGTATTCACTGGTGGGAAACGG + Intronic
1107988682 13:45798011-45798033 AGGACTTCACTGGGGGCAGAGGG + Intronic
1108662578 13:52600219-52600241 AGGTAGGCACTGGGGGAAGGAGG + Intergenic
1109654243 13:65368570-65368592 AGTTATTTACTTGGTGTAGAAGG - Intergenic
1110696169 13:78493258-78493280 AGGATTTCACTGGGGTGAGAAGG - Intergenic
1111913603 13:94338424-94338446 AGGATGTCACTTGGGGTAGAGGG - Intronic
1114160771 14:20164373-20164395 ATGTATTCACTGGGGTTTGTTGG + Intergenic
1115716486 14:36110732-36110754 AGGTTTTCACTGGGAGGTGAGGG - Intergenic
1117778194 14:59204010-59204032 AGGTACTCACTTGGTGTTGATGG + Intronic
1117888334 14:60389304-60389326 AGATATCCCCTGGGGGTAAACGG + Intergenic
1118380170 14:65211647-65211669 AGGTATCCACTGGGGGGGGGGGG + Intergenic
1120186815 14:81402064-81402086 AGGTATCTACTGGGGGAATATGG + Intronic
1121281489 14:92702357-92702379 GGGCATTCACTGGGGGTCTAAGG + Intergenic
1126304360 15:47238398-47238420 AGGTATACTCTGGGGGGTGAGGG - Intronic
1127841716 15:62837615-62837637 AGGAGTTCCCTGGGGCTAGATGG + Intronic
1131417991 15:92277584-92277606 AGGTCATCAGTGTGGGTAGAGGG - Intergenic
1132157261 15:99504389-99504411 AGATCTTCACTGTGGGGAGATGG + Intergenic
1133587232 16:7207821-7207843 AGATATTCTCTGGTGATAGATGG - Intronic
1137757497 16:50914306-50914328 ATGTTTTCACTGGGTGCAGAAGG - Intergenic
1139297982 16:65919427-65919449 AGATATTCACGGGAGGGAGACGG - Intergenic
1139969641 16:70765765-70765787 AGGTATCCCCTGGGTGCAGAGGG - Intronic
1141788208 16:86215832-86215854 GGGTGCTCACTGGGGGCAGAGGG - Intergenic
1152372985 17:79902055-79902077 AGGTACTCACTGAAGGTAAAGGG - Intergenic
1152908169 17:82981552-82981574 AGCTATTGACTGGCTGTAGATGG - Intronic
1154027635 18:10723676-10723698 AGGCAGTCTCTGGGGGGAGACGG + Intronic
1155824994 18:30430090-30430112 AGGTATTCAGTAGTGGTAGTTGG + Intergenic
1157367463 18:47078714-47078736 AGGTATTCACTGGGGGTAGAAGG - Intronic
1158338674 18:56441413-56441435 AGATATTAACTAGGGGTAGAGGG - Intergenic
1162028530 19:7907605-7907627 AGGTAGGCACTGGGGGAAGGAGG - Intronic
1165083798 19:33328669-33328691 AGGGCTTGACTGGGGGCAGAAGG - Intergenic
1167135691 19:47613912-47613934 ATGTATTCATTGGGGGGAGGGGG + Intronic
928347548 2:30515041-30515063 AGGTATACAATGGGGGCAGTGGG - Intronic
928833621 2:35518134-35518156 AGGTATTCACTAGGAAGAGAAGG - Intergenic
929016742 2:37504989-37505011 AGGGATTTACTGGGAGTAGATGG - Intergenic
930045519 2:47168318-47168340 AGGTTTCCAATGGGAGTAGAGGG - Intronic
932662909 2:73672593-73672615 AGGTGGTGACTGGGGGTAGGTGG - Intergenic
933786025 2:85842294-85842316 AGATGGTCACTGGGGGTACATGG - Intronic
934530401 2:95083584-95083606 AGGTGTTCACTGTGGGGACATGG - Intergenic
935617378 2:105100733-105100755 ATGTAATCACTGGGGGTAGGGGG - Intergenic
935694528 2:105760197-105760219 AGATTTTCAGTGGGGATAGAAGG + Intronic
935842003 2:107123577-107123599 AGGTATTCGCCGGGAGGAGAGGG + Intergenic
936417809 2:112334802-112334824 AGGTATTCATTGGGGGAAAATGG - Exonic
940713073 2:157185966-157185988 AGGAATTCACTAGGGAAAGAAGG - Intergenic
940993853 2:160126039-160126061 AGGAATGCCCTGGAGGTAGACGG - Intronic
945658920 2:212659913-212659935 AGAAATGCACTGGGGGTGGATGG - Intergenic
946115735 2:217460471-217460493 AGGAATTCACTGGGGGAAGCTGG + Intronic
947025638 2:225734888-225734910 AGGTACTCCCTGAGGGTGGAAGG + Intergenic
1169184156 20:3598630-3598652 AGGTATTACCTAGTGGTAGAAGG + Intronic
1170032388 20:11956734-11956756 AGGAATCCACTGGAGGTAGGAGG + Intergenic
1173307241 20:41862331-41862353 AAGTATCCATTGGGAGTAGAGGG + Intergenic
1174537845 20:51266433-51266455 AGGTATTTACTGAGGGAATAGGG + Intergenic
1177357190 21:20023574-20023596 AGGTATATTGTGGGGGTAGAGGG + Intergenic
1177414540 21:20776990-20777012 AGGTATTCACTAGGAAGAGAAGG - Intergenic
1177669036 21:24201426-24201448 AGCTATCCACTTGGGGTAGTGGG - Intergenic
1178287548 21:31337996-31338018 AGGGATGCCCTGGGGGTACAGGG - Intronic
1178356519 21:31913878-31913900 AGGTAGTCACAGGGAGTAGTGGG + Intronic
1179559842 21:42208560-42208582 AGGTATTTATTGGGTGAAGACGG - Intronic
1181009968 22:20034543-20034565 AGGTCCACACTGGGGGTACAAGG - Intronic
1182819984 22:33207461-33207483 AAGTATTACCTGGGGGCAGAAGG - Intronic
1183674634 22:39292485-39292507 AGTAATTCACTGGGGGTCCAGGG - Intergenic
949269806 3:2201522-2201544 AAGTAGTCACTGGAGGAAGAAGG - Intronic
952536593 3:34317391-34317413 AGGTTTTTACTGGGTTTAGAGGG - Intergenic
955519509 3:59761377-59761399 AGGCATCCACTGGGTGAAGAAGG - Intronic
960312614 3:116134817-116134839 AGGGAGACACTGGGGATAGAGGG - Intronic
961706282 3:128788545-128788567 AGGCATTCACTGGGGGTCTTGGG + Intronic
967615185 3:191556497-191556519 AGGTATTTGCTGAGGGTAAAGGG + Intergenic
969161779 4:5266382-5266404 AGGGAGTGACTGGGGGTAAAAGG + Intronic
969987504 4:11226738-11226760 GGGTATCCACTGGAGGTAGGAGG + Intergenic
971849026 4:31959663-31959685 GGGTGTTCACTTGGGGAAGATGG + Intergenic
971974832 4:33671315-33671337 AGGGATTCAATGGGTGGAGAAGG - Intergenic
974856563 4:67468009-67468031 AGGCATTCACTGGGGGTCTTGGG - Intergenic
977898233 4:102388103-102388125 ATGCATTCACTGGGGGATGAAGG - Intronic
978212196 4:106150642-106150664 AGATAAGCACTGGGGGTACAGGG + Intronic
978282826 4:107037205-107037227 TGTAATTCACTGGGGCTAGAAGG - Intronic
979014898 4:115420079-115420101 GGGTATTCACTGGGAAGAGAAGG + Intergenic
980257796 4:130403841-130403863 AGGTATTCAGAGTGGATAGAGGG - Intergenic
980587595 4:134837276-134837298 AGGTTTTCCCTGGGGATGGAGGG + Intergenic
980613311 4:135185430-135185452 AGGTGTGCACTGGGGGAACAGGG - Intergenic
982152582 4:152477384-152477406 ACGTATTCAATGAGGGTGGAAGG - Intronic
982343378 4:154329544-154329566 AGGGAGACACTGGGGGAAGAAGG + Exonic
983945003 4:173576092-173576114 AAGTATTGAATGGGGGTATATGG - Intergenic
984648767 4:182246907-182246929 AGGTAGTGACTGGGAGTGGAGGG + Intronic
990876679 5:60494248-60494270 AAGAATGCACTGGGGGTAGGGGG + Intronic
991641688 5:68760665-68760687 AAATATCCACTGGTGGTAGATGG - Intergenic
993329707 5:86582935-86582957 AGGTTTTCACTGGGGTCACATGG - Intergenic
994360564 5:98844883-98844905 AGGTATTCACTAGGAAGAGAAGG - Intergenic
994715134 5:103311782-103311804 AGATACTATCTGGGGGTAGAGGG + Intergenic
996389390 5:122943471-122943493 GGGCAATCACTGGGGGAAGAGGG - Intronic
1000650346 5:163810558-163810580 GGTTATTCATTGGGGGTGGAGGG - Intergenic
1001753760 5:174150717-174150739 AGGCATTGAGTTGGGGTAGATGG - Intronic
1002586086 5:180249331-180249353 AGGTTTCCACTGGGGGTAAGGGG - Intronic
1003668309 6:8132031-8132053 TGGAATTCACTGCAGGTAGAAGG + Intergenic
1003860666 6:10319382-10319404 AGGTTTTCCGTGGGGATAGAGGG + Intergenic
1004416870 6:15432668-15432690 AGTTATTTACTTGGGCTAGAAGG + Intronic
1005697531 6:28365202-28365224 AGGTACACACTGGGAGTGGAGGG - Intronic
1009041406 6:58183440-58183462 AGGCATTCACTGGGGGTCTTAGG + Intergenic
1009217258 6:60937755-60937777 AGGCATTCACTGGGGGTCCTAGG + Intergenic
1015225361 6:130851438-130851460 AGGTATTCACTGCAGGTTAACGG + Intronic
1023059184 7:36312583-36312605 AGGTATTCCTTAGGGGAAGAAGG + Intergenic
1023121069 7:36909373-36909395 GGGAATTTGCTGGGGGTAGAAGG + Intronic
1023533944 7:41188133-41188155 AGGCATTCACTGGAGTCAGAAGG + Intergenic
1024277862 7:47693581-47693603 AGCTATTAACTGGGGAGAGAAGG - Intergenic
1028876388 7:95827900-95827922 TGATAGTCACTGGGGGTGGAGGG + Intronic
1029390004 7:100268743-100268765 AGGAATTTACTAGGGGTGGATGG + Intronic
1029401724 7:100351409-100351431 AGGTATGCACTTGAGGTAGGAGG + Intronic
1030894269 7:115038057-115038079 AGGTTGTCACTGTGGGTAGTGGG + Intergenic
1032282284 7:130513901-130513923 AGGTATTGACTGGAGGGATACGG + Intronic
1032282679 7:130517169-130517191 AGGTATTGACTGGGGGGTAAAGG + Intronic
1035015614 7:155763293-155763315 ACGTATCCACAGGGGGTGGAAGG + Intronic
1037503875 8:19511567-19511589 AGGAATTCAACTGGGGTAGAGGG - Intronic
1038748570 8:30275438-30275460 GGGCATTGACTGGGGGTGGAGGG - Intergenic
1040620219 8:49083960-49083982 AGGTAGTCACTGGGAGGATATGG + Intergenic
1042967044 8:74364765-74364787 AGGGAATCACTGGGGATAGTGGG + Exonic
1045523742 8:102925964-102925986 ATGTATTCAATGGTGGTAGAGGG + Intronic
1048206740 8:132421560-132421582 GGGGATTCACTTGGGGCAGATGG + Intronic
1049623083 8:143607353-143607375 AGACATTCACTGGGGATGGAGGG - Intronic
1053242578 9:36508130-36508152 AGGTATTGACTGGAGGCAGAAGG + Intergenic
1054131763 9:61374641-61374663 AGGTATTCCCTGGGGTGAGCAGG - Intergenic
1057247259 9:93467256-93467278 AGTTATTCAATGGGGGAAAAGGG - Intronic
1057350407 9:94292568-94292590 AGGCATTCTCTGGGGGAATAGGG - Intronic
1058504531 9:105654758-105654780 ACCTGTTCACTGGGAGTAGATGG + Intergenic
1060015368 9:120081980-120082002 ATGTATTCACAGGGTGTTGAGGG + Intergenic
1060245149 9:121939513-121939535 AGTGATTCTCTGGGGGTAGGGGG + Intronic
1061637335 9:131920834-131920856 AGGCTTTCACTGGAGGGAGATGG + Intronic
1185835988 X:3346415-3346437 AGGGAAACACTGGGGGTAAAGGG - Intronic
1187085573 X:16039790-16039812 AGGTTTTAATTGGGGGTAGTAGG - Intergenic
1187738439 X:22328533-22328555 AGGAATTCACTGGAGCTAGTGGG + Intergenic
1189666758 X:43363953-43363975 AGGTATTCACTGGGTTGACAGGG - Intergenic
1189944285 X:46162190-46162212 AGATTTTCACTAGGTGTAGAAGG - Intergenic
1192042884 X:67641821-67641843 AGCTGTTCACTTGGGGTTGAGGG + Intronic
1192166398 X:68829892-68829914 AGTTACTCACTTGGGGTTGAGGG - Exonic
1194966203 X:100291409-100291431 CGGTATTCACTGGGGTAGGAAGG + Intergenic
1198039018 X:132830881-132830903 ATGTATTCACTGGCGGTAAAAGG - Intronic
1198799500 X:140434292-140434314 AGGCACTCACTGGAGGAAGAAGG + Intergenic
1198848672 X:140941479-140941501 ATGAATTCACTGGGGGAAAAAGG - Intergenic
1200032469 X:153307406-153307428 AGATATTCACTGGGAGTGCAGGG - Intergenic
1200958370 Y:8973106-8973128 AGGTAACCACTGTGGGTAGAAGG + Intergenic