ID: 1157369302

View in Genome Browser
Species Human (GRCh38)
Location 18:47095653-47095675
Sequence CCCAAGGATGTTCCAACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157369302_1157369306 2 Left 1157369302 18:47095653-47095675 CCTTCTGTTGGAACATCCTTGGG 0: 1
1: 0
2: 1
3: 14
4: 150
Right 1157369306 18:47095678-47095700 TGAAGGATAACATATTTTTGTGG 0: 1
1: 0
2: 3
3: 24
4: 325
1157369302_1157369307 14 Left 1157369302 18:47095653-47095675 CCTTCTGTTGGAACATCCTTGGG 0: 1
1: 0
2: 1
3: 14
4: 150
Right 1157369307 18:47095690-47095712 TATTTTTGTGGCTTATATGCAGG 0: 1
1: 0
2: 0
3: 19
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157369302 Original CRISPR CCCAAGGATGTTCCAACAGA AGG (reversed) Intronic
900476788 1:2879805-2879827 CCCAGGGATCTTCCCACAGGTGG - Intergenic
908531395 1:65037928-65037950 CCCAAAGTTGTTCAAGCAGAGGG - Intergenic
911256379 1:95638091-95638113 TCCAAAGATTATCCAACAGAAGG - Intergenic
914948552 1:152088991-152089013 CCCAAGTATGCTCAAGCAGATGG + Intronic
916869677 1:168899833-168899855 CCCAAGTAGGTGCTAACAGATGG + Intergenic
917847222 1:179030395-179030417 CCCAAGGATGATACAAGACAGGG - Intronic
922764120 1:228148827-228148849 CCCCAGGATGTTCCAACCACAGG - Exonic
1063426772 10:5956522-5956544 ACCATGGATGTTCTTACAGAGGG + Intronic
1064421394 10:15193834-15193856 CCTAAGGCTGTTACAGCAGATGG + Intergenic
1065121489 10:22534645-22534667 CCCAAGGAAGTTTCAAAAAATGG + Intergenic
1065900082 10:30198534-30198556 TCCAAGGATGTGCAAACAGTAGG + Intergenic
1065922910 10:30409075-30409097 CCCAAGGAAATTCCACCCGATGG + Intergenic
1068008227 10:51415659-51415681 CCCGAGGAAGTTACATCAGAAGG + Intronic
1068578372 10:58710042-58710064 CCCCAGGAGGTTTCAACAAATGG - Intronic
1070369454 10:75768143-75768165 CCCATGGCTGTTACAACAAATGG - Intronic
1076059534 10:127402716-127402738 TCCAAGGCTGCTCCGACAGACGG + Intronic
1077537407 11:3131052-3131074 CCCCAGGAGGTTCCAAGTGAGGG - Intronic
1079310903 11:19364949-19364971 CCCAGAGATCTTCCTACAGAAGG - Intronic
1085738727 11:79061702-79061724 CCCAAGTATTTTGCTACAGAGGG + Intronic
1087213183 11:95464143-95464165 CCCAAAGTTTTACCAACAGAAGG - Intergenic
1089201411 11:116726760-116726782 CCCAAGAATGCTCCAACACATGG - Intergenic
1089399393 11:118155801-118155823 CCCAAGGGACTTCCAGCAGAAGG - Intergenic
1089667762 11:120031230-120031252 CCCAAGGAAATTCTAACAGTGGG + Intergenic
1092563536 12:9641531-9641553 CCCAAGGATGTTAAACAAGATGG + Intergenic
1093369168 12:18345360-18345382 CCCCAGACTGTTTCAACAGAGGG + Intronic
1096799465 12:54100473-54100495 CCCAAGGCTGTGCCTACCGAGGG - Intergenic
1097385265 12:58943549-58943571 GCCAAGGTTGATCCGACAGAAGG - Intergenic
1103359550 12:120345802-120345824 CTCAAAGATTCTCCAACAGAGGG + Intronic
1110157717 13:72338795-72338817 TGCAAGGATGGTCCAACAAATGG + Intergenic
1110458136 13:75712641-75712663 CCCCAGGATGTTTCAATAAATGG + Intronic
1111480733 13:88822472-88822494 CCCCAGGATGCTTCATCAGAGGG - Intergenic
1113351730 13:109536059-109536081 CAAAAGGATTTTCCAATAGATGG + Intergenic
1113557907 13:111253425-111253447 AACAAGGATGTTCCATAAGAGGG - Intronic
1117384616 14:55198670-55198692 CCCAATGATGATCTAACAAAGGG - Intergenic
1118056861 14:62087828-62087850 CCCAAGGATTTTACCTCAGAAGG - Intronic
1118434120 14:65754000-65754022 CCAAAGGATCTTCCAAAATAAGG - Intergenic
1119897144 14:78229897-78229919 CCTAAGGATGTTGCAACAGATGG + Intergenic
1119995850 14:79252970-79252992 CCCAAGGAACTTACATCAGAAGG + Intronic
1122890963 14:104732059-104732081 CCCAAGGCAGCTCCAAAAGAAGG + Intronic
1123398107 15:19956848-19956870 TTCAAGGATGGTCCAACATATGG - Intergenic
1125051569 15:35304381-35304403 TTGAAGGATGTTCCATCAGAGGG - Intronic
1128373442 15:67058113-67058135 CCCAAGCATCTGTCAACAGATGG - Intergenic
1128408640 15:67370060-67370082 CCCAAGGCTGTTCTTTCAGAAGG + Intronic
1129785714 15:78308852-78308874 CCCAAGGGAGTTACAGCAGAAGG + Intergenic
1131102248 15:89701941-89701963 CCCAAGACTGGTCAAACAGAAGG - Exonic
1134500921 16:14768613-14768635 CCCAAGGCTGTTCTTAAAGACGG - Intronic
1134579661 16:15360436-15360458 CCCAAGGCTGTTCTTAAAGACGG + Intergenic
1134715043 16:16353762-16353784 CCCAAGGCTGTTCTTAAAGACGG - Intergenic
1134722921 16:16397123-16397145 CCCAAGGCTGTTCTTAAAGACGG - Intergenic
1134734758 16:16490919-16490941 CCCAAGGATGTTCAAGGAGGTGG + Intergenic
1134932715 16:18220987-18221009 CCCAAGGATGTTCAAGGAGGTGG - Intergenic
1134944507 16:18314748-18314770 CCCAAGGCTGTTCTTAAAGACGG + Intergenic
1134951772 16:18354897-18354919 CCCAAGGCTGTTCTTAAAGACGG + Intergenic
1135043564 16:19136256-19136278 CCCAGGCATGTTCCTACGGAGGG - Intronic
1135194809 16:20385929-20385951 CTCCAGGACGTTCCACCAGATGG - Intronic
1136149697 16:28339295-28339317 CCCAAGGCTGTTCTTAAAGACGG + Intergenic
1136165933 16:28453106-28453128 CCCAAGGCTGTTCTTAAAGACGG + Intergenic
1136197039 16:28661914-28661936 CCCAAGGCTGTTCTTAAAGACGG - Intergenic
1136213378 16:28776037-28776059 CCCAAGGCTGTTCTTAAAGACGG - Intergenic
1136258111 16:29055954-29055976 CCCAAGGCTGTTCTTAAAGACGG - Intergenic
1136320384 16:29480355-29480377 CCCAAGGCTGTTCTTAAAGACGG + Intergenic
1136434957 16:30219695-30219717 CCCAAGGCTGTTCTTAAAGACGG + Intergenic
1138584568 16:57961492-57961514 CCCAAGTATGGCCCAAAAGAAGG + Intronic
1139233913 16:65314722-65314744 CCCAAGTATGTTCCAGCACCAGG + Intergenic
1139854987 16:69973079-69973101 CCCAAGGCTGTTCTTAAAGACGG + Intergenic
1139884708 16:70200212-70200234 CCCAAGGCTGTTCTTAAAGACGG + Intergenic
1140367815 16:74395316-74395338 CCCAAGGCTGTTCTTAAAGACGG - Intergenic
1141400587 16:83743784-83743806 CCCATGATTGTTCCAACAGAAGG + Intronic
1141900835 16:86989178-86989200 CGCAAAGATGTCCCAAGAGAGGG + Intergenic
1146223358 17:31045705-31045727 GCCTAGGATGTTTCAACAGAGGG - Intergenic
1146341632 17:32024265-32024287 GCCTAGGATGTTTCAAGAGAGGG + Intronic
1146351168 17:32095357-32095379 GCCTAGGATGTTTCAACAGAGGG - Intergenic
1146888582 17:36489190-36489212 CCTAAGGATCCACCAACAGATGG - Intronic
1147233092 17:39033721-39033743 GCCTAGGATGTTTCAACTGAGGG + Intergenic
1148173683 17:45546108-45546130 GCCTAGGATGTTTCAACAGAGGG - Intergenic
1148275586 17:46299340-46299362 GCCTAGGATGTTTCAACAGAGGG + Intronic
1148297695 17:46516908-46516930 GCCTAGGATGTTTCAACAGAGGG + Intronic
1148362244 17:47021396-47021418 GCCTAGGATGTTTCAACAGAGGG + Intronic
1148508265 17:48145858-48145880 TCCTAGGCTGTTCCAACAAAAGG + Intronic
1150404891 17:64893032-64893054 GCCTAGGATGTTTCAACAGAGGG - Intronic
1150783983 17:68147945-68147967 GCCTAGGATGTTTCAACAGAGGG - Intergenic
1152076838 17:78165025-78165047 CCCAAGGTGGTTCTCACAGAAGG - Intronic
1154348454 18:13563780-13563802 CTCAAGGATCTTTAAACAGATGG + Intronic
1157184523 18:45527135-45527157 CCCAAGAATCTTCCAAGAAAAGG + Intronic
1157369302 18:47095653-47095675 CCCAAGGATGTTCCAACAGAAGG - Intronic
1158588431 18:58760266-58760288 CCCCAGGGTGTCCCAGCAGAAGG - Intergenic
1159235296 18:65663680-65663702 TCCAATGCTGTACCAACAGAGGG + Intergenic
1159759052 18:72402135-72402157 CCCACGGATGTTCCAACTTCTGG + Intergenic
1165009433 19:32833131-32833153 CTCAAGTAAGTACCAACAGAAGG - Exonic
1165009973 19:32838103-32838125 CTCAAGTAAGTACCAACAGAAGG - Intronic
1165223956 19:34340986-34341008 GCCAACGTTGTCCCAACAGATGG - Intronic
926357354 2:12053490-12053512 CACAAGTTTGTTCCAACAAAAGG - Intergenic
926847855 2:17161726-17161748 CCCCAAGGAGTTCCAACAGAAGG + Intergenic
927863540 2:26575128-26575150 ACCAAGGAGGTTCCAGGAGAGGG - Intronic
929665784 2:43832732-43832754 CACTAGGAAGTTCCCACAGAGGG + Intronic
936509106 2:113131269-113131291 CCCCAGCATGTTCCACCACATGG - Intronic
942401798 2:175610585-175610607 CCCTAGGTTGTTCCAAAACATGG - Intergenic
947669688 2:231928405-231928427 CCTAAGGACGTTCAGACAGAAGG - Intergenic
1169701346 20:8450429-8450451 CCTAAGAATGATCCAACTGATGG - Intronic
1170383971 20:15795800-15795822 CCAACGGATGTTCCCACAGTCGG - Intronic
1170388820 20:15850267-15850289 CCCAAGGGTGATCGAACAGGGGG + Intronic
1171851287 20:30310293-30310315 CCCAAGGTTGTGCCTACTGAGGG - Intergenic
1173553098 20:43946973-43946995 ACCCAGGATGTTCCAAATGACGG - Intronic
1173882115 20:46423388-46423410 CCTGAGGATGTTCCAAGACAGGG - Intronic
1174742813 20:53032432-53032454 CCCAAGATTATTCCACCAGACGG - Intronic
1176744792 21:10641580-10641602 TTCAAGGATGGTCCAACATATGG - Intergenic
1179487817 21:41722227-41722249 CCCAAGAGATTTCCAACAGAGGG - Intergenic
1183084577 22:35478629-35478651 CCCCAGGATGTCCCAACTCAAGG - Intergenic
1183455717 22:37922147-37922169 GCCAAGGATGTTCCAGGAGGCGG + Exonic
1185281804 22:49972772-49972794 CTCCAGGAGGTTCCAGCAGATGG + Intergenic
950405783 3:12803671-12803693 CCCCAGGATGCTCCCACACAAGG - Intronic
951897500 3:27624214-27624236 CAGAAGGATGTTCCTTCAGAAGG - Intergenic
953468992 3:43150787-43150809 CTCAAGGCTGTTCCCAGAGAAGG - Intergenic
954652864 3:52175947-52175969 CCCAAGGATGACTCATCAGAGGG - Intergenic
956205882 3:66754302-66754324 CCCAAGGGTGGTGGAACAGAGGG + Intergenic
958086311 3:88812651-88812673 CTCAAGGATGTCCTAACAGCTGG + Intergenic
960737025 3:120792340-120792362 TCCAAGCATGTTCAAACAGAAGG - Intergenic
961066369 3:123880610-123880632 GGCAAGGAAGTACCAACAGAGGG + Intronic
962583249 3:136817581-136817603 TCCAAGAATGTTCCCAAAGAGGG - Intergenic
964599560 3:158482462-158482484 CCCTTGGATTTTTCAACAGATGG + Intronic
965231786 3:166063678-166063700 TACAAGAATGTTCCAACATATGG + Intergenic
968808107 4:2788088-2788110 CCCCAGGATGGTCCAACACGGGG - Intergenic
971387013 4:26150153-26150175 CCCAAGGCTGTTCCAAAAATTGG + Intergenic
972791054 4:42371624-42371646 CCCAAGAATTCACCAACAGATGG + Intergenic
973616719 4:52686180-52686202 GACAAGGATGTTCCAACAAAAGG - Intergenic
976595032 4:86887388-86887410 CCCAAGGAGGGACCAAAAGAAGG - Exonic
977520628 4:98078660-98078682 ACCCAGGATGTTACAACAAATGG + Intronic
977845676 4:101763867-101763889 CCCAAGGAACTTGCAACAGTTGG - Intronic
978728529 4:111998502-111998524 AAAAAGGATGCTCCAACAGAAGG + Intergenic
981753639 4:148118099-148118121 CACAGGCATTTTCCAACAGAGGG - Intronic
985994774 5:3591810-3591832 CCAAAGGCTGGTCCCACAGACGG + Intergenic
987388274 5:17351109-17351131 GCCAAGGATCTGCCAACAGGAGG - Intergenic
988366965 5:30312296-30312318 CACAAAGATGTTACAACAAAAGG - Intergenic
990701434 5:58478993-58479015 CCACAGGATGTTCCAACAGTTGG + Intergenic
993095502 5:83474120-83474142 CCCCAGGATATTGCAAAAGAAGG + Intronic
994611197 5:102042615-102042637 CACAATAATGTTCCTACAGAAGG + Intergenic
996500637 5:124212254-124212276 GCCAAGGATATTCTTACAGAGGG - Intergenic
1001768321 5:174272752-174272774 CCCCAGGATGTTGCAAGACAAGG - Intergenic
1007464994 6:42045616-42045638 CCCAGGGGAATTCCAACAGATGG + Intronic
1007782361 6:44261893-44261915 CCCAAGCATGTTCCCAGAGGTGG - Intronic
1013424037 6:109994504-109994526 CCCAAGGGAGTTGCAAAAGATGG - Intergenic
1014258281 6:119186203-119186225 CCCAAGGACTTTCCAGCAAAGGG - Intronic
1015137876 6:129894414-129894436 CCCAAGAAGGTTGCATCAGATGG - Intergenic
1016015272 6:139177480-139177502 CCCAAGGAAGATCTAAAAGAAGG - Exonic
1031233584 7:119142856-119142878 CACAAGGATGTCAGAACAGAAGG - Intergenic
1033165840 7:139038023-139038045 CCTAAGCTTTTTCCAACAGAAGG + Intergenic
1033446302 7:141425312-141425334 GGCAAGAATGTTCCACCAGAGGG - Intronic
1033900997 7:146140002-146140024 TGCAAAGATATTCCAACAGAGGG - Intronic
1034561322 7:151881191-151881213 CCCAAGGCCCTTCCTACAGATGG + Intergenic
1038619769 8:29130552-29130574 GCAAAGGATGTCCCAACAGGAGG - Exonic
1039466763 8:37790128-37790150 CCACAGGATTTTCCAACACATGG - Intronic
1040508359 8:48071848-48071870 CCAGAGGAAGTTCCAGCAGAGGG - Intergenic
1046785500 8:118261527-118261549 ACCAATGATGTTCCAAAAGATGG - Intronic
1049112723 8:140658225-140658247 GTCAAGGATGTTACCACAGAAGG - Intronic
1049376098 8:142289919-142289941 CCCAAGGATGGGCCCAGAGAGGG + Intronic
1050119228 9:2291218-2291240 CCCAAGAATGATCCAGCAGTGGG - Intergenic
1055480958 9:76708810-76708832 CCCAGTGATGGTCAAACAGAAGG - Exonic
1056094836 9:83242385-83242407 ACCAAGGAAATTCCAAGAGACGG + Intergenic
1057470277 9:95350427-95350449 CCAAACGTTTTTCCAACAGACGG - Intergenic
1058126386 9:101200082-101200104 CCCTAGCATGTTCCTACAGCTGG - Intronic
1062081963 9:134629011-134629033 CCCATAGATGTTCAAACGGAAGG - Intergenic
1189605155 X:42669649-42669671 TCCAAGAATATTCCAGCAGATGG - Intergenic
1190384930 X:49875868-49875890 CCCAAGGATTTTACATCACAGGG - Intergenic
1194942749 X:100031998-100032020 CCCTGGAATGTTACAACAGAGGG - Intergenic
1197253171 X:124235640-124235662 ACCAAGAATATTCTAACAGAAGG - Intronic
1199887829 X:152039745-152039767 CCCAAGGAAGTTCCAAATTATGG - Intergenic