ID: 1157370706

View in Genome Browser
Species Human (GRCh38)
Location 18:47108989-47109011
Sequence GGCCCTCTGGTCATTCACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157370706 Original CRISPR GGCCCTCTGGTCATTCACAA TGG Intronic
902720838 1:18303004-18303026 TGCCCTCTGGTGATGCACTAGGG + Intronic
903541990 1:24101776-24101798 TGTCCTCTGGTGATTCCCAAGGG + Intronic
909951217 1:81722439-81722461 GGCCCTCTTGGCATACAAAACGG - Intronic
913103991 1:115595181-115595203 GGGCCTCTGGACAAGCACAAAGG - Intergenic
919944653 1:202310353-202310375 GGGCCCCTGGTCACTCACAGTGG - Exonic
920917127 1:210266782-210266804 GGCCCTCTTGGCATACAAAATGG + Intergenic
922713893 1:227855971-227855993 GGCCCTGTGGCCATTTTCAAGGG - Intergenic
1067150533 10:43728944-43728966 GACCCTCTGGCCATTCCCATTGG + Intergenic
1067472687 10:46548094-46548116 AGCCCTCTGGTCCCTCACACGGG + Intergenic
1069735708 10:70652774-70652796 GGCTTTCTGGACATTGACAATGG + Intergenic
1076539500 10:131205135-131205157 GGACCACTTGTCAGTCACAACGG - Intronic
1077114442 11:876998-877020 GGCCCAGAGGTCATTAACAAGGG + Intronic
1079660937 11:23035711-23035733 GACCCTCTGCTTTTTCACAAGGG - Intergenic
1080502684 11:32885624-32885646 GGCCCTCTGCTCTTGCAGAAAGG + Intergenic
1080576981 11:33609095-33609117 GGCAGTCTGGTCTTTCAGAAGGG - Intronic
1081225015 11:40510843-40510865 TTCCCTCTTGTTATTCACAAGGG - Intronic
1084784871 11:71436375-71436397 GGCCTTCTGGCCATGCACAGTGG + Intronic
1086246643 11:84761057-84761079 GACCCTCTGCTTTTTCACAAGGG - Intronic
1087156872 11:94913474-94913496 GGCCCTCTTGGCATACAAAATGG - Intergenic
1088683764 11:112267907-112267929 GGCCCTCTTGGCATACAAAATGG + Intronic
1091081180 11:132669809-132669831 GCCCCTCTGGTCATCAGCAATGG + Intronic
1091968833 12:4768988-4769010 GGCTCTCTTGTGAGTCACAAGGG - Intronic
1097500045 12:60390627-60390649 GGCCCTCTGAGTATTCAAAAAGG + Intergenic
1098314851 12:69182363-69182385 GACCCTCTGCCCTTTCACAAAGG + Intergenic
1098784733 12:74737711-74737733 GGCCCTTTCCTCATTCTCAAGGG + Intergenic
1099735889 12:86565837-86565859 GGCCCACTGGGCAATGACAAGGG - Intronic
1100566253 12:95796999-95797021 GGCACTCTGTTTATTCACACTGG - Intergenic
1100841012 12:98611799-98611821 GGGCCTTTGGTCTTTCACGAGGG + Intergenic
1101578095 12:106016339-106016361 GGCCCTCTTGGCATACAAAATGG - Intergenic
1102903861 12:116659983-116660005 AGCCCTCTGGTCCTTCTCAGAGG + Intergenic
1103254151 12:119526119-119526141 GGCCATCTGATCTTTGACAAAGG + Intronic
1104392352 12:128401736-128401758 GCCCCACTGGACATTCACAGAGG - Intronic
1107070730 13:36265983-36266005 GGACCTCTGGCCATTTACACAGG - Intronic
1108413347 13:50172519-50172541 GGCCCTCTTGGCATACAAAATGG - Intronic
1112633252 13:101184734-101184756 GGCAGCCTTGTCATTCACAATGG + Intronic
1113441719 13:110334224-110334246 GGCCTTCTTGACATTCAGAAAGG + Intronic
1118055542 14:62075961-62075983 GCCCCTCTGGCCATTGACATTGG + Intronic
1119427254 14:74543800-74543822 GCCCCACTGGTCCTTCACCAAGG - Intronic
1120280438 14:82431600-82431622 GGCCCTCTGTTCTTGCAGAAAGG - Intergenic
1120509254 14:85393845-85393867 TGCCCTCATGTCATGCACAACGG - Intergenic
1131259643 15:90881850-90881872 GGCGCTCTGGTCTTTGATAAAGG - Exonic
1131361018 15:91790660-91790682 GGCTCTCTGGTCCTTTACAGGGG - Intergenic
1134095831 16:11417817-11417839 GTCTCTGTGGACATTCACAATGG - Exonic
1135044059 16:19140256-19140278 GGCCCTCTGGTCATTTCGAAGGG - Intronic
1139919695 16:70451595-70451617 GGCACTGAGGTCAGTCACAATGG - Intergenic
1139965599 16:70743727-70743749 GCCCCTCTGGACATCCACACAGG - Intronic
1141691254 16:85597944-85597966 GGCCCTCAGGGTATTCAGAAGGG + Intergenic
1142878276 17:2865693-2865715 GACCTTCTGGCCATCCACAAGGG - Intronic
1149182023 17:53950911-53950933 GGCCTTCTGGTGATACACATAGG - Intergenic
1152654142 17:81512317-81512339 GCCGCGCTGGTCATTGACAATGG - Exonic
1153654459 18:7270691-7270713 AGCCAGATGGTCATTCACAATGG + Intergenic
1156912645 18:42428907-42428929 GACCCTCTGGCCTTTCACAATGG - Intergenic
1157370706 18:47108989-47109011 GGCCCTCTGGTCATTCACAATGG + Intronic
1157924642 18:51749899-51749921 GGCACTATTCTCATTCACAAGGG + Intergenic
1161215995 19:3095295-3095317 TGCCCTCTGTTCCTTCTCAAGGG + Intronic
1162065996 19:8125925-8125947 GGCCCTCTGGACACTCACAGCGG + Exonic
1163263098 19:16203245-16203267 GCCCCTGTGGGCATTCACACTGG + Intronic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
1164369175 19:27627121-27627143 GGACATTTGGTTATTCACAAAGG - Intergenic
1166214125 19:41324765-41324787 GGCCCTCTGCTCTTTAAAAATGG - Exonic
1166503655 19:43358551-43358573 GGCCCCTTGGTTCTTCACAAGGG - Intronic
1166506799 19:43376207-43376229 GGCCCCTTGGTTCTTCACAAGGG + Intergenic
1167171624 19:47836199-47836221 GACCCTCAGGTCATCCACATGGG - Intronic
1167560296 19:50223010-50223032 GGCCCTCTGGTCCCTTACACTGG - Intronic
925780688 2:7378989-7379011 GGCCCTCTGGCCCTTCAGATGGG - Intergenic
927264956 2:21136063-21136085 GGCCCTGTGATCATTCACATGGG - Intronic
932934341 2:76084466-76084488 GGCCCTCGGGTGATTAACACAGG + Intergenic
933352888 2:81178216-81178238 GGCCCTCTGCTCTTGCAGAAAGG - Intergenic
934072363 2:88396176-88396198 GTTCCTCTGGACATTCACATAGG + Intergenic
935847626 2:107183911-107183933 GGCACTCCGGGCACTCACAAGGG + Intergenic
939046990 2:137261279-137261301 GACCCTCTGCTCAGTCTCAAAGG + Intronic
943432827 2:187825782-187825804 GGCCCTCTTGGCATACAAAATGG - Intergenic
944134365 2:196382447-196382469 AGGCCTCTGGTTATTCACATAGG + Intronic
948303881 2:236932345-236932367 GGCCATCTGGTCAAGGACAAGGG + Intergenic
1171374341 20:24682046-24682068 CGCACTGTGGTAATTCACAAAGG - Intergenic
1172184321 20:33021807-33021829 GCCCCTCTGGTCACACCCAAAGG - Intronic
1172205505 20:33160251-33160273 GGCCCTCAGGTTGTTCACAAAGG - Intergenic
1173581011 20:44146516-44146538 GTCCATCTGGTAATTCACAAAGG + Intronic
1179432261 21:41330451-41330473 GGTCCTCCTGTTATTCACAAGGG - Intronic
1179482017 21:41684536-41684558 GGTCCTCTGGTTACTCACAGTGG - Intergenic
1179970709 21:44835733-44835755 GGCCCCCTGGCCATTTTCAAGGG + Intergenic
1183192218 22:36329014-36329036 TGCCCACTGGTCATTCAGGAGGG + Intronic
1183881524 22:40835805-40835827 GGCCCTCTTGGCATACAAAATGG + Exonic
952651902 3:35737345-35737367 GGCCCTCTGGTCACTCAGGTAGG + Exonic
955986059 3:64575196-64575218 GGCCCCCTGGCAATTCACCAAGG + Intronic
959376405 3:105593622-105593644 GGCCCTCTGCTCTTGCAAAAAGG - Intergenic
959781705 3:110241665-110241687 GGACATCTGGTCAGTCAGAAGGG - Intergenic
961583625 3:127903733-127903755 GGCCTCCTGCTCATTCAGAAGGG - Intergenic
963293405 3:143517765-143517787 GGCCCTCTTGGCATACAAAATGG + Intronic
966869571 3:184281444-184281466 AGCCCACTGGCCATTCTCAATGG + Intronic
973369962 4:49236818-49236840 GGCCCTCTGGGCCGTCTCAAAGG + Intergenic
977312555 4:95405124-95405146 GGCCCTCTGCTCTTGCAAAAAGG + Intronic
978566498 4:110088132-110088154 GGCCCTTCAGTCATTCCCAAAGG + Intronic
981125598 4:141102679-141102701 GGCCTGCTGATAATTCACAAGGG + Intronic
983779508 4:171650870-171650892 GGCCTGCAGGTCATGCACAAGGG - Intergenic
984600264 4:181718754-181718776 GGCCCTCTGGACATTCCTGAAGG + Intergenic
986868320 5:12015903-12015925 AGCCCTCTGGTCACCCACACTGG + Intergenic
987076129 5:14383339-14383361 GGCTGTCTGGCCATACACAATGG - Intronic
987900454 5:24004012-24004034 GGTCATATGGTCATTCACAAGGG + Intronic
990942916 5:61221515-61221537 GGGCCTCTGGGCATAAACAAGGG - Intergenic
991146997 5:63318713-63318735 GACCCTCAGGTCAATAACAAAGG + Intergenic
997668598 5:135651963-135651985 TGCCCTTTGGGCATTCACACGGG - Intergenic
1000465364 5:161569152-161569174 ATCCCTCTGCTCTTTCACAAAGG + Intronic
1003055191 6:2811988-2812010 AGGCCGCTGGACATTCACAATGG - Intergenic
1006797884 6:36742611-36742633 GTCCCTCAGGTAATTCAGAAAGG - Intronic
1010022970 6:71182550-71182572 TTCCCTCTATTCATTCACAAAGG - Intergenic
1015080172 6:129214565-129214587 GGCCATCTGATCTTTCACAAAGG - Intronic
1017533180 6:155317869-155317891 TGCACACTGTTCATTCACAAAGG + Intergenic
1021041933 7:15872947-15872969 GGCCCTCTGTTCTTACAAAAAGG + Intergenic
1026837135 7:73646912-73646934 GTCCCTCTGGGCCTTCACAAGGG - Intergenic
1027521678 7:79216430-79216452 GGCCCTCTGCCTTTTCACAAGGG - Intronic
1029985918 7:104923208-104923230 GGCTCTCTCATCACTCACAAGGG + Intergenic
1030282773 7:107794028-107794050 TGCCCTCTGGTCACCAACAAAGG + Intronic
1032588429 7:133170052-133170074 GGCCCTCTTGGCATACAAAATGG + Intergenic
1033353977 7:140584666-140584688 TGCCCTCTGGGCATTCAGACAGG + Intronic
1037624076 8:20592622-20592644 GGCCCTCTGCCTTTTCACAAGGG + Intergenic
1040539590 8:48340296-48340318 AGCCCTGTGGTCAATCATAATGG - Intergenic
1048322168 8:133408448-133408470 GGCCCTCTTGGCATACAAAATGG - Intergenic
1056202289 9:84288508-84288530 GGCTCTCTGAACATTCAAAAGGG - Intronic
1057727353 9:97577333-97577355 TGCCTTCTGGTCATTCTCAGAGG + Intronic
1057839700 9:98476111-98476133 GGCCTTCTGATCAGACACAAAGG + Intronic
1058084131 9:100731255-100731277 GCCCCACTTGTCATTGACAACGG + Intergenic
1061759787 9:132842694-132842716 GGTCCTCTGCTCAGTCTCAAAGG + Intronic
1062617201 9:137403252-137403274 GCCCCTCAGGTCACTCACAGTGG - Intronic
1187969778 X:24647758-24647780 GCCCCTCCGGGCATTCACTATGG + Intronic
1190198135 X:48337046-48337068 GGCCCTCTGGTTCTTCATGAAGG + Intergenic
1191110721 X:56801547-56801569 GTCCCTCTGGTGTTCCACAAAGG + Intergenic
1194388597 X:93288378-93288400 GGCCCTCTTGGCATACAAAAGGG + Intergenic
1195848302 X:109253643-109253665 GGACCTCTGGACTTACACAAAGG + Intergenic
1198680004 X:139171083-139171105 GGCCCTGTGGGAATTCAGAAGGG - Intronic