ID: 1157371209

View in Genome Browser
Species Human (GRCh38)
Location 18:47113927-47113949
Sequence GTGGACAATGAGACGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157371194_1157371209 30 Left 1157371194 18:47113874-47113896 CCTGTTGAAGAGTGGAGATGGGG 0: 1
1: 0
2: 1
3: 31
4: 213
Right 1157371209 18:47113927-47113949 GTGGACAATGAGACGGTGGGGGG 0: 1
1: 0
2: 2
3: 10
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157371209 Original CRISPR GTGGACAATGAGACGGTGGG GGG Intronic
901760515 1:11468318-11468340 TTGGACAATGAGATGGTAGCAGG + Intergenic
902931951 1:19737732-19737754 GGGGAAGATGAGACGGTGGCTGG - Intronic
903694892 1:25199390-25199412 GTGCAGAAGGAGAAGGTGGGAGG + Intergenic
905022130 1:34825366-34825388 GTGGAAAACAAGACAGTGGGTGG + Intronic
905321110 1:37117967-37117989 GTGGAGCATGAAACAGTGGGAGG - Intergenic
905386430 1:37607363-37607385 GTGAACAGTGATAAGGTGGGAGG - Intergenic
907338414 1:53715877-53715899 GTGGAGAATGGGGCGGTGGCAGG + Intronic
915156512 1:153881029-153881051 ATGGACAAGGAGAGGGAGGGGGG - Intronic
918035093 1:180862395-180862417 GCAGATAATGAGAAGGTGGGGGG - Intronic
919545398 1:198911512-198911534 GTGAACAAGGAGACAGTGGCAGG - Intergenic
920548496 1:206838569-206838591 GAGGACAGTGAGACCTTGGGAGG + Intronic
1067429065 10:46230970-46230992 GTGGGAAATAAGAGGGTGGGAGG + Intergenic
1070112529 10:73498881-73498903 ATGAACAATGGGAGGGTGGGAGG + Exonic
1077174236 11:1181426-1181448 GTGGAGAAGGAGAAGGTGGTTGG - Intronic
1077830670 11:5866631-5866653 GTGGACTATTAGAGGGTGGAGGG + Intronic
1078693546 11:13606200-13606222 GTGGAAAATGAGTAGGTGTGTGG + Intergenic
1080709026 11:34728139-34728161 GTGGACCATGAGAGGGTGGAGGG - Intergenic
1083730908 11:64652034-64652056 GTGGACAACGTGACTGTGGAGGG - Exonic
1087553217 11:99678908-99678930 GTGGTCAAAGAGACAGTGGTTGG - Intronic
1089356181 11:117855522-117855544 GTGGTCACTGGGAGGGTGGGAGG - Intronic
1091921393 12:4307796-4307818 GGGGACAATGAGACAGAGGCAGG - Intergenic
1095138157 12:38631859-38631881 GTGGAAAATGAGAAAGTTGGTGG + Intergenic
1097059689 12:56273442-56273464 GTTGACTATGAGAGGGTTGGGGG - Intronic
1100814772 12:98375633-98375655 GGGGACAAAGAGACAGTGGCAGG + Intergenic
1101755342 12:107617053-107617075 GCGGCCATTGAGACGGTGAGAGG - Intronic
1102173740 12:110861164-110861186 GGAGACAATGGGATGGTGGGGGG - Intronic
1103992104 12:124806189-124806211 CTGGACAATGAGGCGGGGGTTGG + Intronic
1104744915 12:131204504-131204526 GGGGACAATGAGGCTCTGGGAGG + Intergenic
1105388725 13:19957673-19957695 GAGGACCAGGAGACGGTGGCAGG + Intergenic
1107645288 13:42488300-42488322 GTGGAGAATGGGGCGGGGGGTGG + Intergenic
1108062954 13:46551916-46551938 GGGGAAAATGAGTCGGGGGGTGG - Intergenic
1110910506 13:80956052-80956074 GGGGACTATGGGAAGGTGGGAGG + Intergenic
1112249823 13:97769484-97769506 GTGGTCAATGACAGGGTGGCTGG + Intergenic
1113489286 13:110678819-110678841 GCGGACCTGGAGACGGTGGGAGG + Intronic
1118002242 14:61534136-61534158 GTGGATAATGGTATGGTGGGAGG + Intronic
1123133673 14:106008121-106008143 GTGTGCAATGAGAGGGTGTGGGG + Intergenic
1127046821 15:55034718-55034740 GTGGGGAATGGGACGGTGTGGGG - Intergenic
1129854268 15:78812338-78812360 TTGGACAATGAGGAGGTGTGCGG - Intronic
1131131489 15:89903502-89903524 GTGGTCAATGAGCCCCTGGGTGG + Intronic
1131511547 15:93051915-93051937 GTGGACACTGAGAGGCTGAGAGG - Intronic
1132338297 15:101062812-101062834 GTAGACTTAGAGACGGTGGGAGG + Intronic
1134032362 16:11002660-11002682 ATGGACAATGAGACTGGGAGGGG - Intronic
1134093413 16:11403570-11403592 GTGGCAAATGTGACGCTGGGAGG + Intronic
1134224717 16:12381360-12381382 GTGGATGATGGGTCGGTGGGTGG - Intronic
1134235064 16:12459092-12459114 GGGGAGAGTGAAACGGTGGGAGG - Intronic
1138735824 16:59249067-59249089 GTGGAGAATGTGACGGGGGTAGG + Intergenic
1142557671 17:790709-790731 GTGGCCAATCAGCGGGTGGGGGG - Intronic
1142557729 17:790921-790943 GTGGCCAATCAGCGGGTGGGGGG - Intronic
1142589135 17:993706-993728 GTGGATTATGTGAGGGTGGGTGG - Intergenic
1142589196 17:994046-994068 GTGGATTATGTGAGGGTGGGTGG - Intergenic
1143174251 17:4947549-4947571 GTGGACAGGGAGATGGTGGTGGG + Intronic
1145426331 17:22903194-22903216 GTGGACATTGGGAGGGTGTGAGG + Intergenic
1147599758 17:41738577-41738599 GTGCACAATTAGGTGGTGGGTGG - Intergenic
1148440687 17:47710330-47710352 GTGGACACTGAGCTGGTGTGGGG + Intronic
1151232210 17:72693216-72693238 GAGGACAGTGGGAGGGTGGGTGG - Intronic
1153058000 18:966957-966979 CTTGACCATGAAACGGTGGGAGG - Intergenic
1154383614 18:13873788-13873810 GTGGAGAGAGAGACGGTGAGAGG + Intergenic
1155161825 18:23202251-23202273 GTAGAAAATGAGAGGGTGGGTGG + Intronic
1155788550 18:29933560-29933582 GTGAACACTGAGGCAGTGGGTGG - Intergenic
1157215278 18:45777558-45777580 GTGGACAGAGAAACTGTGGGTGG + Intergenic
1157233535 18:45941875-45941897 TAGGAGAATGAGACAGTGGGAGG - Intronic
1157371209 18:47113927-47113949 GTGGACAATGAGACGGTGGGGGG + Intronic
1160008151 18:75083592-75083614 GTGGACCTTGAGATGGTGAGTGG - Intergenic
1160387565 18:78505729-78505751 GGGGAGAATGAGGGGGTGGGGGG - Intergenic
1160656753 19:276415-276437 GTGGACATTGAAACGCAGGGAGG - Intergenic
1162127640 19:8507933-8507955 GGGGGCAAGGAGAAGGTGGGAGG + Intergenic
1163026485 19:14515845-14515867 GTGGACCATGAGAGGGTGGGAGG - Exonic
1163123761 19:15233172-15233194 ATGGGCAATGAGACGGAGGGCGG + Intronic
1163458961 19:17424976-17424998 AGGGACTATGAGACGCTGGGGGG - Exonic
1163637449 19:18443842-18443864 GTGGACAGAGGGACGGAGGGAGG + Exonic
1165624108 19:37270620-37270642 GTGGACAATGAGCGCCTGGGAGG + Intergenic
1165624654 19:37273162-37273184 GTGGACAATGAGCGCCTGGGAGG + Intergenic
1165625197 19:37275688-37275710 GTGGACAATGAGCGCCTGGGAGG + Intergenic
1165626271 19:37280754-37280776 GTGGACAATGAGCGCCTGGGAGG + Intergenic
1165626810 19:37283281-37283303 GTGGACAATGAGCGCCTGGGAGG + Intergenic
1165627352 19:37285799-37285821 GTGGACAATGAGCGCCTGGGAGG + Intergenic
1165628430 19:37290851-37290873 GTGGACAATGAGCGCCTGGGAGG + Intergenic
1165628967 19:37293379-37293401 GTGGACAATGAGCGCCTGGGAGG + Intergenic
1165629513 19:37295902-37295924 GTGGACAATGAGCGCCTGGGAGG + Intergenic
1165630054 19:37298427-37298449 GTGGACAATGAGCGCCTGGGAGG + Intergenic
1165630597 19:37300955-37300977 GTGGACAATGAGCGCCTGGGAGG + Intergenic
1165631131 19:37303496-37303518 GTGGACAATGAGCGCCTGGGAGG + Intergenic
1166369834 19:42294531-42294553 GTGGGCACTCAGACGGTGGCAGG + Intronic
1167116852 19:47493408-47493430 GTGGACATCGAGAAGGTGAGTGG - Exonic
1168599741 19:57708202-57708224 GAGGACATTGAGATAGTGGGAGG - Intronic
925091156 2:1156920-1156942 GTGGACAGTGAGACCCTTGGAGG + Intronic
925608490 2:5683520-5683542 GGGGACAATGAAAGGGTTGGAGG - Intergenic
925878206 2:8329564-8329586 GTGGACAATGAGGCCCTGTGAGG + Intergenic
926197983 2:10775152-10775174 GGGGACAATGAGAGGGAGGAGGG - Intronic
926633029 2:15154764-15154786 CTGGACAATGTGAGAGTGGGGGG + Intergenic
926915049 2:17883372-17883394 GTGGTAAAGGAAACGGTGGGGGG + Intronic
927293109 2:21423613-21423635 GTGGTCAATGGGAAGCTGGGGGG + Intergenic
927517874 2:23682596-23682618 GAACACAATGAGGCGGTGGGCGG - Intronic
927600865 2:24439685-24439707 GTTGACCATGAGACTGTGGAGGG - Intergenic
928866573 2:35924090-35924112 GTGGACCATTAGAGGGTGGTGGG + Intergenic
929431160 2:41887842-41887864 CTGGACAATGAGATGAGGGGAGG + Intergenic
929461134 2:42102641-42102663 GTGGAGAATGAGGCGGGGTGGGG - Intergenic
929894040 2:45942930-45942952 GTGGAGAATAAGAGGTTGGGGGG - Intronic
933153680 2:78946870-78946892 GTGGACACTGTGGGGGTGGGGGG + Intergenic
934662918 2:96152762-96152784 GTGGACAATGAGAAAGAGAGGGG + Intergenic
935135342 2:100295625-100295647 GTGAACAAGGAGGTGGTGGGTGG + Intronic
936946045 2:117932029-117932051 GAGGAAAATGACACGGGGGGAGG + Intronic
938043016 2:128091444-128091466 GTGGACAAAGAGAGGGTTTGGGG + Intronic
939309952 2:140463169-140463191 GTGGCCAGTGGGAGGGTGGGTGG + Intronic
940348379 2:152652059-152652081 GTGGACAATGAAACAGTGAGTGG - Exonic
943786170 2:191881071-191881093 GTGGACCATGAGAGGGTGGGAGG - Intergenic
948675744 2:239595574-239595596 GTGGACATGGAGACCCTGGGAGG + Intergenic
1168758511 20:332509-332531 GTGGACAATAAGACTATGAGTGG - Intergenic
1169819351 20:9691305-9691327 GAGGACACTCAGACGGTGGTGGG + Intronic
1175157463 20:56981172-56981194 GTGGACACTGAGCCGGAGGCTGG - Intergenic
1179189124 21:39108354-39108376 GTGGGCTATGAGACAGTGCGCGG - Intergenic
1180057170 21:45364985-45365007 GTGGAGAATGAGGCTGTGGGCGG + Intergenic
1180186131 21:46140262-46140284 GTGAACAATGTGAAGGTGGACGG - Intronic
1180996046 22:19965811-19965833 GTGGGCATTGGGAGGGTGGGAGG + Intronic
1181168479 22:20995511-20995533 GTGGAAGATGAGACGCTGGGTGG + Intronic
1181732205 22:24855440-24855462 GTGGACAGTGGGGCAGTGGGAGG + Intronic
1182769962 22:32787745-32787767 GTGAAAAATGAGACCCTGGGAGG + Intronic
1184167024 22:42735712-42735734 GTGGACTGTGAGAGGGTGGGAGG + Intergenic
1184688471 22:46106882-46106904 GGGGACCGTGAGACTGTGGGCGG + Intronic
1185119668 22:48958502-48958524 CTGGACAATGGGACAGTGGGAGG - Intergenic
950385892 3:12659742-12659764 GTGGATAATGTGACAGTGAGGGG - Intronic
951742402 3:25939042-25939064 GTGGACAAGCAGAGGGTGAGAGG + Intergenic
953422631 3:42766206-42766228 GTGGACTTTGAGATGCTGGGTGG + Intronic
958844516 3:99249975-99249997 GTGGAAATGGAGACGGTGAGAGG - Intergenic
960519545 3:118639286-118639308 GGGGACAATCAGAGGGAGGGAGG - Intergenic
961781487 3:129323325-129323347 GTGGAGAACGAGAGGGTGGCAGG - Intergenic
963837736 3:150074073-150074095 GTGGAGAGTGAGGTGGTGGGGGG + Intergenic
964678345 3:159309003-159309025 GTGGACTATGAGAGGGTGGCAGG + Intronic
967279033 3:187804697-187804719 ATCCACAATGAGACTGTGGGTGG - Intergenic
968122540 3:196135827-196135849 ATGGACAGTGAGACCGTGGAGGG + Intergenic
970709796 4:18848556-18848578 GTTGACAATGAGAAGGTAAGTGG - Intergenic
971349372 4:25842898-25842920 GTGGACAATGACAGGCAGGGCGG + Intronic
974277273 4:59739428-59739450 GTGGACTATTAGAAGGTGGAGGG - Intergenic
980271649 4:130591769-130591791 GTGGACTACTAGAGGGTGGGAGG - Intergenic
980354209 4:131723436-131723458 GTGGACAATGAGCGCCTGGGAGG - Intergenic
980354749 4:131725942-131725964 GTGGACAATGAGCGCCTGGGAGG - Intergenic
980355283 4:131728419-131728441 GTGGACAATGAGCGCCTGGGAGG - Intergenic
980356906 4:131735899-131735921 GTGGACAATGAGCGCCTGGGAGG - Intergenic
980357446 4:131738391-131738413 GTGGACAATGAGCGCCTGGGAGG - Intergenic
980357985 4:131740880-131740902 GTGGACAATGAGCGCCTGGGAGG - Intergenic
980359060 4:131745844-131745866 GTGGACAATGAGCGCCTGGGAGG - Intergenic
980359598 4:131748315-131748337 GTGGACAATGAGCGCCTGGGAGG - Intergenic
980360680 4:131753282-131753304 GTGGACAATGAGCGCCTGGGAGG - Intergenic
980361223 4:131755762-131755784 GTGGACAATGAGCGCCTGGGAGG - Intergenic
980361763 4:131758237-131758259 GTGGACAATGAGCGCCTGGGAGG - Intergenic
980362306 4:131760717-131760739 GTGGACAATGAGCGCCTGGGAGG - Intergenic
980362849 4:131763200-131763222 GTGGACAATGAGCGCCTGGGAGG - Intergenic
982207308 4:153006297-153006319 GTGGAGGAGGAGAGGGTGGGTGG + Intergenic
983696778 4:170542023-170542045 GTGGAGAATGAGAAGGAGAGTGG + Intergenic
985300942 4:188488692-188488714 GTGGACTACTAGACGGTGGAGGG - Intergenic
985549520 5:525882-525904 GTGGACAAAGGGCAGGTGGGCGG + Intergenic
985837328 5:2280819-2280841 GTGGTGAATGAGTGGGTGGGTGG + Intergenic
985841326 5:2308099-2308121 GTGGAGTTTGAGATGGTGGGTGG - Intergenic
986502943 5:8419095-8419117 GTGGATAAAGAAACTGTGGGGGG + Intergenic
987043477 5:14085104-14085126 GAGGACAATGAGAAGGAAGGAGG - Intergenic
987463453 5:18243845-18243867 GTGCACAGTGAGAAGGTGGTAGG - Intergenic
991316189 5:65309446-65309468 GTGGGCAATGTGGCAGTGGGGGG + Intronic
991945095 5:71891968-71891990 GTTGGCAATGAGACGTAGGGTGG + Intergenic
992023585 5:72649478-72649500 GTGGAGAATGGGACAGTGAGGGG - Intergenic
999458620 5:151738889-151738911 GGGGGCAAGGAGAGGGTGGGAGG + Intergenic
1001231609 5:169993693-169993715 GTGGTCCAAGAGTCGGTGGGTGG - Intronic
1001929240 5:175661030-175661052 GTGGACCAGCAGAGGGTGGGTGG - Intronic
1002629203 5:180558369-180558391 GTGGAGAGTGAGACCTTGGGCGG + Intronic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1007075628 6:39064534-39064556 GGGCACAATGAGAGGGTGGGGGG - Intronic
1007111215 6:39314354-39314376 GTGGACTAGGACCCGGTGGGAGG + Exonic
1007472325 6:42098985-42099007 GTGGACAGGGAGACAGTTGGGGG + Intergenic
1013330248 6:109094255-109094277 GTGTACAAGGAGAGGGTGAGAGG - Exonic
1014370705 6:120603920-120603942 GAGGACAATGAGAGGGTTTGAGG + Intergenic
1020039026 7:4987359-4987381 GGTGGCAATGAGAAGGTGGGTGG - Intronic
1023789158 7:43737915-43737937 GAGGACAGAGAGAGGGTGGGAGG + Intergenic
1029447432 7:100621687-100621709 GTGGAGAATGACTCGGTGTGGGG - Intronic
1034837282 7:154364282-154364304 ATGGACAATGAGTCTGAGGGCGG - Intronic
1037608072 8:20454152-20454174 GTGAACAAGGAGACAGAGGGTGG - Intergenic
1040634704 8:49259099-49259121 GTGGAAAATGAGGAGGTTGGAGG - Intergenic
1040635205 8:49265187-49265209 GTGGATAAAGAAACTGTGGGGGG - Intergenic
1040906953 8:52479279-52479301 GTGGCCACGGAGACTGTGGGTGG - Intergenic
1042146990 8:65740339-65740361 GTGGAGAATGAGGGGGTGGATGG - Intronic
1043659333 8:82716467-82716489 GTAGTCAAAGAGATGGTGGGTGG - Intergenic
1051339655 9:16099897-16099919 ATGGCCAGTGAGAGGGTGGGTGG - Intergenic
1053642913 9:40105728-40105750 GTGGACAATGAGCGCCTGGGAGG + Intergenic
1053763240 9:41359762-41359784 GTGGACAATGAGCGCCTGGGAGG - Intergenic
1054541849 9:66270929-66270951 GTGGACAATGAGCGCCTGGGAGG - Intergenic
1054921114 9:70543043-70543065 TTGGAAAAAGATACGGTGGGAGG + Intronic
1056195941 9:84228617-84228639 GAGGGCAATGGGACGGTGAGGGG + Intergenic
1059332054 9:113541826-113541848 GTGGAAAATGAGTGGATGGGCGG - Intronic
1062233785 9:135498480-135498502 GTCAACAATGAGACGGGGAGGGG - Intronic
1186963100 X:14758334-14758356 AGGGAGGATGAGACGGTGGGTGG - Intergenic
1187029051 X:15466776-15466798 GTGAACTATGAGACTGTTGGAGG - Intronic
1187246596 X:17558283-17558305 GTGGAGAATGAGATGGGGGCAGG - Intronic
1189718196 X:43886202-43886224 GAGGTCAATGAGAAGGTGGTAGG + Intergenic
1189902808 X:45724899-45724921 GTGGACTATTAGAGGGTGGAGGG - Intergenic
1190914877 X:54803936-54803958 GTTCACAAGGAGAAGGTGGGAGG + Intergenic
1193473240 X:81932644-81932666 GTGGATAATGAGAAATTGGGAGG + Intergenic
1194938155 X:99976739-99976761 GTGGACTACTAGAAGGTGGGGGG + Intergenic
1195674083 X:107493976-107493998 GTGGCCACTGAGAAGGTGTGTGG - Intergenic
1200107393 X:153722846-153722868 GTGGACCAAGAGTGGGTGGGAGG + Intronic