ID: 1157371410

View in Genome Browser
Species Human (GRCh38)
Location 18:47115928-47115950
Sequence ATCTTTTTCTTCAGGAAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 662
Summary {0: 1, 1: 0, 2: 5, 3: 63, 4: 593}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157371410_1157371413 2 Left 1157371410 18:47115928-47115950 CCATCTTTCCTGAAGAAAAAGAT 0: 1
1: 0
2: 5
3: 63
4: 593
Right 1157371413 18:47115953-47115975 ACAGGAGACCCTTCCCCATCAGG 0: 1
1: 0
2: 0
3: 11
4: 204
1157371410_1157371420 26 Left 1157371410 18:47115928-47115950 CCATCTTTCCTGAAGAAAAAGAT 0: 1
1: 0
2: 5
3: 63
4: 593
Right 1157371420 18:47115977-47115999 CCCTTCCTTTGTCCTGATACAGG 0: 1
1: 0
2: 2
3: 12
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157371410 Original CRISPR ATCTTTTTCTTCAGGAAAGA TGG (reversed) Intronic
900849081 1:5127874-5127896 ATCTGTAACTTCAGCAAAGATGG - Intergenic
901099288 1:6706898-6706920 ATCCTTTGCTTAAGGAAAGAAGG + Intergenic
901353817 1:8625018-8625040 TGCATTTTCTTCAGGGAAGAAGG + Intronic
901411749 1:9089040-9089062 CTCTTTTTCGTCAGGAGTGAGGG - Intergenic
901841120 1:11954815-11954837 ATCTGCTCCTGCAGGAAAGAAGG - Exonic
902068577 1:13711993-13712015 ATCTTTTTCTTAATAAAAAAAGG - Intronic
902429329 1:16351221-16351243 GTCTCTTTCTTGAGGAATGATGG - Intronic
904436697 1:30503565-30503587 GTTTTTTTCTTCTGGAAAGTCGG - Intergenic
904902597 1:33869291-33869313 ATTTTTTCCCTTAGGAAAGAAGG + Intronic
905415032 1:37797977-37797999 ATTTTTTTTTTCAGTAGAGATGG - Intronic
907454091 1:54564231-54564253 TTCTTTTTCTTCTGGAGACAGGG - Intronic
907707190 1:56842734-56842756 CTCTTTTCCTCCAGGATAGAGGG + Intergenic
907717278 1:56938880-56938902 ATTTTTTTTTTCTGGCAAGAGGG - Intronic
907762990 1:57379816-57379838 ATCTTCTTCTTCATGAAGGTTGG - Intronic
909147983 1:71962167-71962189 ACTCTTGTCTTCAGGAAAGAGGG - Intronic
909578841 1:77208540-77208562 AACTTTTTCTACAGGAAACTAGG - Intronic
909611158 1:77553120-77553142 ATGGTTTTCTTTTGGAAAGAAGG + Intronic
909844468 1:80374525-80374547 ATTTTTTTTTTCAGTAGAGATGG - Intergenic
910535749 1:88295652-88295674 ATGATCTGCTTCAGGAAAGAAGG - Intergenic
912668264 1:111602566-111602588 ATCTCTTGCTTCAGAAAAGTGGG - Intronic
914452092 1:147801562-147801584 ATCCTTTTCTTCAAGGCAGATGG + Intergenic
914694617 1:150065761-150065783 GTGGTTTTCTTCAGGAAGGAAGG + Intergenic
914709270 1:150197902-150197924 ATTTTTTTTTTCAGTAGAGATGG - Intergenic
915075178 1:153302359-153302381 CTCTTTTTCTTCAGGATTGTAGG - Intronic
915148823 1:153812489-153812511 CTCTCTTTCTCCAGGAAAGCTGG + Intronic
915577762 1:156791968-156791990 GTTTTTTTCTTCATGGAAGAAGG + Intronic
915580182 1:156808780-156808802 CTCTTTTTCTCCAGGACAGCAGG + Intronic
916165564 1:161964318-161964340 ATCTATGTCTTCAGGAAAGTGGG + Intergenic
916337191 1:163686202-163686224 AATTGTTTCTTAAGGAAAGAGGG - Intergenic
916412845 1:164563458-164563480 TTCTTTTTTTTAAGGAAAGCAGG - Intronic
916841431 1:168605376-168605398 ATCTTTTCCTTGACAAAAGAAGG + Intergenic
916873558 1:168943362-168943384 ATCTTTTTTTTAAAGAAATAAGG - Intergenic
918135237 1:181667516-181667538 ATCTGTGTCTTAAGAAAAGAGGG + Intronic
918256192 1:182750248-182750270 TTATTTTTGTTCAGAAAAGAGGG - Intergenic
918620420 1:186597650-186597672 TTTTTTTTTTTCAGTAAAGATGG + Intergenic
918868631 1:189936900-189936922 ATATTTTTCTTCTTGAGAGAGGG - Intergenic
919001786 1:191841813-191841835 ATCTTTTTCTCCATAAAAAAAGG + Intergenic
919155963 1:193765952-193765974 TTTTTTTTTTTAAGGAAAGATGG - Intergenic
919264315 1:195241258-195241280 TTCTTTTTCTTCCGAAATGACGG - Intergenic
919541256 1:198847990-198848012 ATTTTTTTTTTCAGTAGAGATGG + Intergenic
919895389 1:202006692-202006714 ATCTTTTTTTTCAGTAGAGATGG - Intergenic
920012768 1:202881577-202881599 ATTTTTTTTTTAAGTAAAGATGG + Intronic
920025354 1:202990057-202990079 TTGTTTTTCTTAAGAAAAGATGG - Intergenic
920986473 1:210895164-210895186 TTTTTTTTTTTCAGGCAAGAGGG + Intronic
921426868 1:215012845-215012867 ATCTTTTTCTCCATAAAAGATGG - Intronic
921936443 1:220801091-220801113 ATCTTTTACTTGAAGAAAGGTGG - Intronic
922121980 1:222680252-222680274 ATTTTTTTTTTCAGGAGACAGGG + Intronic
923609619 1:235478355-235478377 ACCTTTTACTTCAGGAATGGTGG - Intronic
923621787 1:235585498-235585520 ATCTTTTTGTGTAAGAAAGAAGG - Intronic
923836655 1:237618324-237618346 AACTTCTGCTTCTGGAAAGATGG + Intronic
923997591 1:239512803-239512825 TTTTTTTTTTTCAAGAAAGAGGG - Intronic
924403663 1:243718643-243718665 ATTTTTTTTTTCAGTAGAGACGG + Intronic
1063440643 10:6070155-6070177 ATTTTTTTTTTCAGTAGAGATGG + Intergenic
1063657445 10:8006157-8006179 ATTTTTTTTTTCAGTAGAGACGG - Intronic
1064396653 10:14987773-14987795 ATCTTTTTCTGAAAGAGAGAAGG - Intronic
1064399443 10:15009168-15009190 ATCTTTTTCTTCAAGAGAGAAGG - Intergenic
1066007773 10:31163334-31163356 ATTTTTTTTTTCAGTAGAGATGG + Intergenic
1066570976 10:36771529-36771551 ATCTTCCTCTTTAGAAAAGATGG + Intergenic
1066978651 10:42391570-42391592 CTCTTTTTCATCAGGAGTGAGGG + Intergenic
1067175774 10:43944348-43944370 TCCTTTGTCTTCAGTAAAGACGG + Intergenic
1067734733 10:48840916-48840938 ATCTTTATCTTCATAATAGAAGG + Intronic
1067790056 10:49281211-49281233 ATACATTTTTTCAGGAAAGAAGG + Intergenic
1067796320 10:49324647-49324669 ATCTTCCTCCTCAGGAGAGAGGG - Exonic
1067817629 10:49494526-49494548 ATCTGATTCTTCAGGAAAAAGGG - Intronic
1068584855 10:58785980-58786002 AGAATTTTCTTCAGGAAAGGGGG + Intronic
1069560268 10:69424277-69424299 TTCTGTTTCTAAAGGAAAGAAGG - Intergenic
1069940410 10:71951588-71951610 CTCTTTTTAATCTGGAAAGATGG + Intergenic
1069964564 10:72103604-72103626 ATCGTCTGCTTCAGGGAAGAGGG - Intronic
1071290284 10:84184148-84184170 TTTTTTTTTTTCAAGAAAGATGG - Intronic
1071312258 10:84353852-84353874 CTCTTTTCCTGCAGAAAAGAGGG + Intronic
1071595345 10:86918338-86918360 ACCTTTTTCTGGAGGGAAGAGGG + Intronic
1071695973 10:87871668-87871690 ATTTTTTTTTTCAGTAGAGATGG + Intronic
1072262678 10:93696033-93696055 AACTTTTGCTTCCGGGAAGATGG + Intronic
1072427306 10:95340730-95340752 TTTTTTTTCTTCAGTAGAGATGG + Intronic
1072640108 10:97205366-97205388 CACTGTTTCTTCAGGGAAGAAGG + Intronic
1075165396 10:120063558-120063580 ATCTCTTCCTTCTGGAATGATGG - Intergenic
1076079997 10:127570647-127570669 ATGCTTTTTTTAAGGAAAGATGG - Intergenic
1076145219 10:128113431-128113453 ATGATTTTCTTCAGGACAGGTGG + Exonic
1076886568 10:133265617-133265639 ATTTTTTTTTTCAGTAGAGACGG - Intronic
1077604658 11:3600942-3600964 ATCTTTTTCTTAAAGAGAGAAGG - Intergenic
1077761357 11:5103129-5103151 ATCTTTTCTTTCTGGAAGGAAGG + Intergenic
1077941091 11:6844321-6844343 ACCTGTTTCTGGAGGAAAGAAGG - Intergenic
1078022695 11:7668784-7668806 CTCTTTTTCCTCAGAACAGAAGG - Intronic
1078418133 11:11182688-11182710 CTCTTATTCCTCAGGTAAGATGG + Intergenic
1078637199 11:13063153-13063175 ATTTTCTTCTTCAGAAAAGGTGG + Intergenic
1078748345 11:14136730-14136752 ATCTTTTTTTCCAAGAAAGGAGG - Intronic
1078748515 11:14138170-14138192 ATGTCTTTCTTGAGAAAAGAGGG - Intronic
1079060555 11:17245247-17245269 TTCTTTTTTTTCAGTAGAGACGG + Intronic
1079277875 11:19058596-19058618 ATTTTTTTTTTCAGTAGAGACGG + Intronic
1080046665 11:27815988-27816010 ATCTGTTTCATGAGCAAAGAGGG - Intergenic
1080083353 11:28248498-28248520 ATCTTTCACTTCAGGCAAAATGG - Intronic
1080197804 11:29632307-29632329 ATCTTTCTATTCTGGAAACAGGG + Intergenic
1080910308 11:36590393-36590415 ACCTCTTTCTTCATTAAAGATGG - Intronic
1081820243 11:45986646-45986668 ATATTTTTCTGAAGGAAGGAGGG - Intronic
1083076629 11:60046433-60046455 ATTTTTTTTTTAAGGAAAGTAGG - Intronic
1083395943 11:62392065-62392087 TTCCTTGTTTTCAGGAAAGACGG + Exonic
1084808077 11:71593098-71593120 ATCTTTTTCTTAAAGAGAGAAGG + Intronic
1084845189 11:71893113-71893135 ATCTTTTTCTTCAAGAGAGAAGG + Intronic
1084989765 11:72911427-72911449 TTCTTTTTGTTCAGGATAGCTGG + Intronic
1085429194 11:76432343-76432365 ATCCTTTTCTCCAAGATAGAGGG - Intergenic
1085500816 11:77021698-77021720 ATTTTTTTCTTATGCAAAGATGG + Exonic
1085976785 11:81665253-81665275 ATCTCATTCTTCATGTAAGAGGG - Intergenic
1085995356 11:81906009-81906031 ATCTGACTCTTCAGGAAAGATGG + Intergenic
1086825601 11:91491219-91491241 ATCTTTTTCTTTTGCAAATAGGG + Intergenic
1087267237 11:96074040-96074062 ATATTTTTTTTCATGAAAGATGG + Intronic
1087888661 11:103511116-103511138 ATAATTTTCTTCATTAAAGACGG + Intergenic
1088878743 11:113957397-113957419 GTCTTGTTCTCCAGAAAAGAGGG - Intergenic
1088990811 11:114951774-114951796 TTGTTTCTCTTTAGGAAAGAAGG - Intergenic
1089516022 11:119032120-119032142 ATCTTTTACTCCAGAGAAGATGG + Intergenic
1089961936 11:122624229-122624251 ATCTTATTATACAGCAAAGACGG + Intergenic
1090198345 11:124836596-124836618 TTTTTTTCCTTCTGGAAAGAGGG - Intergenic
1090482185 11:127078479-127078501 ATCTTCATCGTCAGGAAAAAGGG + Intergenic
1090551111 11:127821067-127821089 AGCTTGTTCATCAGCAAAGAAGG - Intergenic
1090819639 11:130329909-130329931 ATCATCTATTTCAGGAAAGAAGG - Intergenic
1091526918 12:1312000-1312022 ATCATGTTCTTGAGGAAAAATGG - Intronic
1091875608 12:3930778-3930800 AGCTTCTTCTTCAGGAAAAAGGG + Intergenic
1092110017 12:5953414-5953436 AAATTTTTCTTCAAGGAAGAGGG - Intronic
1092136514 12:6152088-6152110 TTTTTTTTCTTTAGTAAAGATGG + Intergenic
1092431815 12:8416077-8416099 ATCTTTTTCTGAAAGAGAGAAGG - Intergenic
1092434765 12:8438696-8438718 ATCTTTTTCTGAAAGAGAGAAGG - Intergenic
1093242886 12:16699395-16699417 ATATTTTGTTTCATGAAAGAAGG + Intergenic
1093272359 12:17080695-17080717 CTCTTTTCCTGCAGGAAAGTAGG + Intergenic
1093295605 12:17386810-17386832 ATGTTTTTATTAAGAAAAGATGG - Intergenic
1093475284 12:19547852-19547874 TTCTGTTGCTTCAGGAAAAAAGG - Intronic
1093648426 12:21616056-21616078 TTCTTTTTTTTCAAGAAACAGGG + Intergenic
1093915042 12:24792303-24792325 ATAATTTTGTGCAGGAAAGAAGG - Intergenic
1094070378 12:26406380-26406402 ATATTTTTGTTCAGGAACCAGGG + Intronic
1094694004 12:32798262-32798284 ATTTTTTTTTTCAGTAGAGATGG + Intronic
1095903450 12:47352958-47352980 ATTTTTTTCCTCACCAAAGATGG + Intergenic
1096417111 12:51424100-51424122 TTCTTTTTCTTGAGGAGAGAGGG + Intronic
1097396763 12:59084695-59084717 AAATTGTTCTTCAGGAAAGATGG - Intergenic
1097420703 12:59375352-59375374 ATTTTGTTCTTCAAGAAATAGGG - Intergenic
1097563652 12:61239891-61239913 ATCTTTTCCTTCAAGTAAGCGGG + Intergenic
1097831114 12:64224704-64224726 TTTTTTTTCTTCAGGAAACAAGG - Intergenic
1097981790 12:65742713-65742735 CTCATTTTCTTTAGGAGAGAGGG - Intergenic
1097992646 12:65852324-65852346 ATTTTTTTCTTTAGTAGAGATGG - Intronic
1098916945 12:76267346-76267368 ATCGTTTACTGCAGGACAGATGG - Intergenic
1099264179 12:80423683-80423705 CTTTTTTTCCTCAGGAAAGAAGG + Intronic
1099323596 12:81182291-81182313 ATGCTGTCCTTCAGGAAAGAAGG + Intronic
1099594690 12:84645461-84645483 GTCATTTTCTTTAGGCAAGAGGG - Intergenic
1099595882 12:84665591-84665613 ATCTTTACCCTCAGAAAAGAAGG - Intergenic
1099610115 12:84857460-84857482 GTCTTTTCCTTCAGGGCAGAAGG + Intergenic
1099625867 12:85072913-85072935 AAGTTTTTCTTCCAGAAAGAAGG - Exonic
1100039311 12:90293789-90293811 ATCTGTTTCCTCAGGATCGAGGG - Intergenic
1100569427 12:95833076-95833098 ATCTTTTTCCCCAGGAAAAGAGG - Intergenic
1102514997 12:113440414-113440436 ATCTTGCTCTTCAGAAAAGGAGG - Intergenic
1102777620 12:115534321-115534343 ATCTATTTCTTTAAGAAATAAGG - Intergenic
1103297491 12:119900441-119900463 ATTTTTTTTTTCAGTAGAGACGG + Intergenic
1103789605 12:123460165-123460187 TTCTTTTCCTTCAGGAGAGGAGG + Intronic
1103865289 12:124046632-124046654 AGATTTTCCTTCAGGACAGAAGG + Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1103921373 12:124401032-124401054 ATCTTTTTCTTTTGTAGAGATGG - Intronic
1104757123 12:131276309-131276331 ATTGTTTCCTTCTGGAAAGACGG + Intergenic
1105361043 13:19716818-19716840 ACCTTTTCCTTCACTAAAGAAGG + Intronic
1106227469 13:27795840-27795862 GTCTTTTCCAGCAGGAAAGACGG + Intergenic
1106717636 13:32407704-32407726 GATTTTTTCTTCAGGGAAGATGG - Exonic
1107143399 13:37030138-37030160 AGCTTTTCCTTCAGGAAAATTGG + Intronic
1107270851 13:38614347-38614369 AGCTAATTCTTCAGGAAATATGG + Intergenic
1107790543 13:43998016-43998038 CTCTATCACTTCAGGAAAGAAGG - Intergenic
1108682134 13:52789658-52789680 ATTTTTTTCTTCAGGAGGAATGG - Intergenic
1108704600 13:52973835-52973857 ATTTTTTTCTAGAGCAAAGAGGG - Intergenic
1109528259 13:63605163-63605185 ATCTACCTCTTCAGGAATGATGG - Intergenic
1109661063 13:65461444-65461466 TTTTTTTTTTTCAGGAAAAATGG - Intergenic
1110065029 13:71093498-71093520 ATCTTTTTTTTCATCTAAGAAGG - Intergenic
1110411655 13:75210422-75210444 ATCTTGTTTCTCAGGAAATAAGG + Intergenic
1110457530 13:75706632-75706654 ATCTTTTTATCCAGGAAAATTGG + Intronic
1111153606 13:84292892-84292914 ATCTCTTTCTAAAAGAAAGATGG + Intergenic
1111178370 13:84628760-84628782 CTCATTTTTTTCAGGGAAGATGG + Intergenic
1111788213 13:92818179-92818201 ATTTTTGTCTTCAGTAAAGATGG + Intronic
1112403875 13:99100641-99100663 TTTTTTTTTTTCAGTAAAGACGG - Intergenic
1112454347 13:99544788-99544810 ATCTTTTTATGGAGGAAGGAAGG - Intronic
1112544674 13:100354439-100354461 ATCTTCCACTTCAGGAAACATGG + Intronic
1112589869 13:100753030-100753052 ATTGTTTTCTTCTGGAAATATGG - Intergenic
1113083643 13:106544820-106544842 ATATTTTTCTTCAGGTAATTGGG - Intronic
1113226034 13:108160492-108160514 ATCTTTTGAGGCAGGAAAGATGG - Intergenic
1113231406 13:108217343-108217365 GTATTTTTCTTCAGTAGAGACGG - Intronic
1113483771 13:110640184-110640206 TTCTATTTCCTAAGGAAAGAAGG - Intergenic
1113751734 13:112781208-112781230 ATTTTTTTTTTCAGTAGAGATGG + Intronic
1114912609 14:27219713-27219735 AGCTGTTTCTGCAGGAAAGATGG - Intergenic
1115681064 14:35738642-35738664 ATATTTTGCTTCAGGAAAATGGG - Exonic
1115745866 14:36437008-36437030 ATCCTTTCCTGCAGTAAAGAAGG + Intergenic
1115857842 14:37650184-37650206 ATCTTTTTCTTGAGGACGAAGGG + Intronic
1115887686 14:37992024-37992046 ATCTCTGTCTTCAGGAAGGAAGG + Intronic
1116063182 14:39950017-39950039 ATTTTTTTTTTCAGTAGAGACGG + Intergenic
1116079398 14:40154344-40154366 TTCTTTTTCTTGAGAAAAGCAGG + Intergenic
1116346116 14:43796703-43796725 ATTTTTGTCTTCAGGTAACAGGG - Intergenic
1116861648 14:50000430-50000452 ATCTGTTGTTTCAGGAATGAGGG + Intronic
1117039505 14:51756652-51756674 ATCTTTTTCTTAAAGAGAGAAGG + Intergenic
1117084907 14:52189837-52189859 ATCTTGTTATCCAGGAAAAAGGG + Intergenic
1117955690 14:61121986-61122008 TTGTTTTTCTTCTGGAAAGAGGG + Intergenic
1117961913 14:61171642-61171664 CACCTTTTCTCCAGGAAAGAAGG - Intergenic
1118550421 14:66944043-66944065 ATCTTGTTTTTCTGGAAAAAGGG - Intronic
1119417413 14:74482326-74482348 CTCTTTTTCTTCATGGAAAAAGG + Intronic
1119573622 14:75698596-75698618 ATCTTTTCATTCAAGAAAGAGGG + Intronic
1119605021 14:76008202-76008224 ATCTCTCTCTTCAGGGAAGCTGG + Intronic
1120343163 14:83247205-83247227 ATTATTTTATTCAGGAAAAATGG + Intergenic
1120430212 14:84403752-84403774 ATATTTTTCTCCATGAAAGCTGG - Intergenic
1121079748 14:91097938-91097960 CTCTTTTTCTTCCAGAAAGCTGG - Intronic
1121775937 14:96590922-96590944 ATATTCTTCTTCAAGAAAGGTGG - Intergenic
1121964653 14:98292811-98292833 ATTTTTTTCTTAAACAAAGAGGG + Intergenic
1121992883 14:98577050-98577072 TTCTTTTTCTTCAGGTAAATTGG + Intergenic
1122185948 14:99996125-99996147 ATCTTTTCATCCAAGAAAGAAGG + Intronic
1122506265 14:102233759-102233781 TTCATTTACTCCAGGAAAGAGGG + Exonic
1122506560 14:102235397-102235419 TTCCTTTTCTTCCGGAAGGAGGG - Intronic
1123633825 15:22282160-22282182 TGCATTTTCTTCAGGGAAGAAGG - Intergenic
1123973333 15:25529076-25529098 AGCTTGATCTTCAGGAAAAATGG + Intergenic
1125064138 15:35461588-35461610 TTTTTTTTTTTAAGGAAAGAAGG + Intronic
1126269693 15:46800092-46800114 AAAATATTCTTCAGGAAAGAAGG + Intergenic
1126509162 15:49447656-49447678 ATCATCTTCTTCAGTAATGAAGG - Intronic
1127145389 15:56018185-56018207 CTCTTGCTCTTCAGGAGAGAAGG - Intergenic
1127428558 15:58880251-58880273 ATCTGTTTCTTCAGTAAAGTGGG - Intronic
1127722399 15:61715942-61715964 ATTTTTTTTTTCAGTAGAGATGG - Intergenic
1127888475 15:63225845-63225867 ATTTTTTTCTTTCTGAAAGAGGG + Intronic
1128036012 15:64527315-64527337 TTTTTTTTCTTCTGTAAAGATGG + Intronic
1128958382 15:71973581-71973603 ATCTTTTTACTCTGGAAAGGGGG + Intronic
1129267314 15:74400821-74400843 ATCTTTGTCCTCAAGAAACAGGG - Intergenic
1129421245 15:75428666-75428688 ATCTTTATTTTTAGGAGAGACGG + Intronic
1129755252 15:78094188-78094210 ATCTTGTCCTACAGGTAAGAGGG + Exonic
1130041291 15:80406904-80406926 ATCTTTTTCTTTGGGAGAAAGGG + Intronic
1130342157 15:83008713-83008735 TTCTTTTTCTTCATGAAGCAAGG + Intronic
1133144823 16:3776838-3776860 ATCTTTTTTTTTAGTAGAGATGG - Intronic
1133278271 16:4650934-4650956 TTCTTTTTTTTCAGTAGAGACGG - Intronic
1133668205 16:7991789-7991811 ATCTTCCTGTTAAGGAAAGATGG + Intergenic
1135060604 16:19268343-19268365 ATCTTTTTCTTCATGAACACAGG + Intergenic
1135649358 16:24192485-24192507 AGCTCTTTGTTCAGGAAACAGGG + Intronic
1135777091 16:25266330-25266352 AAATTTTTCTTTAGGAAAAATGG - Intergenic
1136865001 16:33741317-33741339 ATTATTTTCCTCAGGGAAGAAGG - Intergenic
1136865130 16:33743192-33743214 ATTATTTTCCTCAGGGAAGAGGG - Intergenic
1137608005 16:49799699-49799721 ATGTTTTTATTAGGGAAAGATGG - Intronic
1137840631 16:51637509-51637531 ATCTTATCCTTCAGGCAAAATGG - Intergenic
1137968796 16:52962894-52962916 ATCATGTGCTTCAGGAAAAAGGG - Intergenic
1138786500 16:59852655-59852677 AACTGTTTCTTCTTGAAAGAAGG - Intergenic
1139100635 16:63762110-63762132 TTCCTTTTCTTCAGAAAAGGGGG + Intergenic
1139756478 16:69148131-69148153 ATTTTTTTTTTCAGTAGAGATGG + Intronic
1140269921 16:73456372-73456394 ATCTTCTTCTGCAGCACAGAAGG + Intergenic
1140637887 16:76938075-76938097 TTCTTTTTCTTTAGTAGAGATGG + Intergenic
1140699191 16:77565649-77565671 ATCATTTTCTTCAGGAATCTAGG - Intergenic
1141243317 16:82283456-82283478 AGCCATTTCTTCAGGAAAAAGGG - Intergenic
1203126499 16_KI270728v1_random:1589460-1589482 ATTATTTTCCTCAGGGAAGAGGG - Intergenic
1142491400 17:281960-281982 GTCTCTTGCTTCAGGATAGAAGG + Intronic
1142663067 17:1444656-1444678 ATTTTTTTTTTTAGTAAAGACGG - Intronic
1144641178 17:16937778-16937800 ATCTTTGTCTACAGGCAAGTTGG - Intronic
1144873841 17:18386451-18386473 ATCTTTGTCTACAGGCAAGTTGG + Intronic
1145158629 17:20559339-20559361 ATCTTTGTCTACAGGCAAGTTGG - Intergenic
1146200965 17:30858201-30858223 ATCTTTTGCTTGAGGAAATTAGG + Exonic
1146237817 17:31184774-31184796 CTCTTTTTCTACAGGAGATAAGG - Intronic
1146494447 17:33308817-33308839 ATCTTTTTTTTCACAAAAAAAGG - Intronic
1147531042 17:41277964-41277986 ATCTCTATCTTCAGGAATAAGGG + Intergenic
1147797106 17:43052083-43052105 ATCTGTGTCTTCAGGAAACCAGG - Intronic
1150506588 17:65704657-65704679 ATCTCTTTCATCAGCTAAGAAGG - Intronic
1151058312 17:71060042-71060064 TTCTATTTCTTCAGCAAAGTAGG - Intergenic
1151299486 17:73212416-73212438 ATTTTTTTATTCTAGAAAGAGGG - Intronic
1151590276 17:75039053-75039075 ATCTTCTCCATCTGGAAAGAGGG + Exonic
1152835565 17:82528300-82528322 ATCTTTCTCTTCAACAAAGCAGG - Intronic
1153032412 18:727049-727071 CTCTTTTTCTTCTTTAAAGATGG + Intronic
1153699627 18:7679492-7679514 TTCTTTATCTTTAGTAAAGACGG - Intronic
1153750273 18:8222481-8222503 ATCTCTTTCATAAGGAAAGCCGG + Intronic
1154095539 18:11411409-11411431 ATCTCTTTGTTCAGAAAACATGG - Intergenic
1154197337 18:12276297-12276319 TTCTTTTTTTTTAAGAAAGAGGG + Intronic
1154340064 18:13495529-13495551 ATCTTATACTTCAGGAATGGGGG - Intronic
1155370915 18:25099494-25099516 ATATTTTTCTTCTGGAAATAAGG - Intronic
1155511950 18:26586993-26587015 ATCTATTTCTTCAGTAAAGGTGG + Intronic
1155869573 18:31009225-31009247 ATTTTTTTCTTTAGTAAAGATGG + Intronic
1156007699 18:32463355-32463377 GTCTTTTTTTTCAAGTAAGATGG - Intronic
1156071264 18:33213332-33213354 CTCTTCTTCTACAGGAAATAAGG + Intronic
1157134959 18:45045109-45045131 ATTTTTTTTTTTAGTAAAGACGG - Intronic
1157161546 18:45318362-45318384 AGCTTGTTCCTCAGGAAAGCAGG - Intronic
1157371410 18:47115928-47115950 ATCTTTTTCTTCAGGAAAGATGG - Intronic
1159114627 18:64100147-64100169 TTTTTTTTCTTCAGGGGAGATGG + Intergenic
1159447492 18:68558518-68558540 GTCATTTTCTTCAAGAAATAGGG - Intergenic
1159554067 18:69926635-69926657 ATCTAATTCTTCAGGGAACATGG + Intronic
1160185968 18:76676347-76676369 TTTTTTTTTTTCAGTAAAGATGG - Intergenic
1160233587 18:77067819-77067841 TTCTTTTCCTTCTGGAGAGAGGG + Intronic
1160457549 18:79013813-79013835 ATATTTATCTTCAGCAAAAAGGG + Intergenic
1160977261 19:1799285-1799307 ATTTTTTTTTTCAGTAGAGATGG - Intronic
1161803459 19:6428880-6428902 ATTTTTGTTTTCAGTAAAGATGG + Intronic
1164283243 19:23787760-23787782 ACTTTTTCCTGCAGGAAAGATGG + Intronic
1164865399 19:31600442-31600464 ATATTTTTCCTCTGAAAAGATGG - Intergenic
1165984736 19:39758140-39758162 ATCTCCTTCTCCAGGAAACATGG - Intergenic
1165988939 19:39794884-39794906 TTTTTTTTCTTCAGGAAATGAGG + Intergenic
1166079424 19:40434284-40434306 AGTTTTTTCATCTGGAAAGAGGG + Intergenic
1166526927 19:43516992-43517014 TTTTTTTTCTTCAGTAAAGATGG + Intronic
1166668164 19:44694068-44694090 ATTTTTCCCTTCAGGAAAGTGGG - Intergenic
1167553383 19:50176771-50176793 TTCTTTTTTTTCAGTAGAGATGG + Intergenic
1168184124 19:54686483-54686505 TTTTTTTTTTTTAGGAAAGATGG + Intronic
925341963 2:3144043-3144065 TTCTCTCTCATCAGGAAAGAGGG - Intergenic
925590395 2:5503426-5503448 ATGTTCTGCTTCAGGGAAGAAGG - Intergenic
925956919 2:8975587-8975609 ATGTTTCCCTTTAGGAAAGATGG - Intronic
926239449 2:11073938-11073960 ATTTTTTCCTTCAGGACACAAGG - Intergenic
926307019 2:11644982-11645004 TTTTTTTTCTTTAAGAAAGAGGG + Intergenic
926317662 2:11723261-11723283 ATCTCTACATTCAGGAAAGAAGG - Intronic
926920818 2:17938203-17938225 ATTTTTTTTTCCAGGAAAGTAGG + Intronic
928228212 2:29473696-29473718 ATTTTTTTTTTCAGTAGAGATGG - Intronic
928724414 2:34155004-34155026 ATCTTTTTTTTTAGTAGAGACGG + Intergenic
929321733 2:40551897-40551919 ATTTTTTTCTTTTGTAAAGATGG + Intronic
929750094 2:44702382-44702404 ATGTTATTCTCCAGCAAAGAGGG - Intronic
933012660 2:77087924-77087946 ATCTTTTGCCTCTGGAAAAAGGG - Intronic
933697250 2:85228841-85228863 ATTTTTTTTTTTAGGAGAGATGG - Intronic
933736337 2:85498143-85498165 TTTTTTTTCTCCAGAAAAGAGGG + Intergenic
933914610 2:86976590-86976612 TTCTTGTTCTTCAGGAAAAACGG - Exonic
934008383 2:87793309-87793331 TTCTTGTTCTTCAGGAAAAACGG + Exonic
934115460 2:88787105-88787127 ATTATTTTCATCAAGAAAGAGGG + Intergenic
934628123 2:95881830-95881852 ATTATTTTCATCAAGAAAGAGGG - Intronic
934631189 2:95924889-95924911 ATTATTTTCATCAAGAAAGAGGG - Intronic
934633519 2:95958127-95958149 ATTATTTTCCTCAGGGAAGAGGG - Intronic
934633645 2:95960009-95960031 ATTATTTTCCTCAGGGAAGAGGG - Intronic
934799981 2:97145151-97145173 ATTATTTTCCTCAGGGAAGAGGG + Intronic
934802856 2:97184095-97184117 ATTATTTTCATCAAGAAAGAGGG + Intronic
934805283 2:97217822-97217844 ATTATTTTCATCAAGAAAGAGGG + Intronic
934928947 2:98404610-98404632 ATCTTTCTCTTCAAGACAGCAGG - Intergenic
935408108 2:102730719-102730741 ATCTTTTTTTTTAGTAGAGACGG + Intronic
935458805 2:103302970-103302992 TTCTGTTTCTTGAGGTAAGAAGG + Intergenic
935757796 2:106290350-106290372 ATTTTTTTTTTCAGTAGAGATGG + Intergenic
935772030 2:106434315-106434337 TTCTTGTTCTTCAGGAGAAAGGG + Exonic
935908039 2:107861631-107861653 TTCTTGTTCTTCAGGAGAAAGGG - Exonic
935994447 2:108753862-108753884 TTCTTGTTCTTCAGGAGAAAGGG - Exonic
936074421 2:109392685-109392707 ATTTTTTTTTTCAGTAGAGATGG + Intronic
936129830 2:109826738-109826760 TTCTTGTTCTTCAGGAGAAAGGG - Exonic
936214867 2:110544747-110544769 TTCTTGTTCTTCAGGAGAAAGGG + Exonic
936424004 2:112399310-112399332 TTCTTGTTCTTCAGGAGAAAGGG + Exonic
936619256 2:114078075-114078097 ATTTTTTTTTTCTGGTAAGAAGG + Intergenic
936637979 2:114281071-114281093 ATTTTTTTCTTCAGGTCAGATGG + Intergenic
937390016 2:121477451-121477473 ATATGTTTTATCAGGAAAGAAGG - Intronic
938570905 2:132561088-132561110 ATTTTTTTTTTCAGTAGAGAAGG + Intronic
940107921 2:150118775-150118797 ATTTTTTTCTTTAGTACAGACGG - Intergenic
940154263 2:150637287-150637309 ATCTTTTTCTGCAGTAATTAAGG + Intergenic
940232107 2:151466636-151466658 ATCTTTTACTTTAGAAAAGATGG + Intronic
940310982 2:152278905-152278927 GTCTTTTTCTTCAAAAAATAAGG + Intergenic
940684506 2:156829031-156829053 ATATTATCCTTCATGAAAGAAGG + Intergenic
940870179 2:158853272-158853294 ATCTTTTTCTTAAAGAGAGAAGG + Intronic
940872888 2:158874331-158874353 ATCTTTTTCTTAAAGAGAGAAGG + Intergenic
940989369 2:160082542-160082564 ATCTTTTCTTTCAGGAAAAGTGG + Intergenic
941175909 2:162197298-162197320 ATCTTTTTCTCCTGGAAGGCAGG - Intronic
941434646 2:165454186-165454208 ATCTTGGTCTCTAGGAAAGATGG - Intergenic
941488760 2:166116867-166116889 ATCTTTTTCTTTTAGAAATATGG - Intronic
941771560 2:169350841-169350863 ATCTTGTTCCTGAAGAAAGAAGG - Intronic
942304911 2:174597850-174597872 TTCTTTTTCTGCAGCAAAGGAGG - Intronic
942316800 2:174704422-174704444 ATCATATTTTGCAGGAAAGAAGG + Intergenic
943356314 2:186860331-186860353 TTTTTTTTTTCCAGGAAAGAAGG + Intergenic
943465215 2:188220272-188220294 ATCTTTTTCTTTTAGAAAAAGGG - Intergenic
943551227 2:189341944-189341966 ATCTTTTTCTTTAGATAATACGG - Intergenic
943752777 2:191527015-191527037 ACATTTATGTTCAGGAAAGAGGG - Intergenic
943770887 2:191715362-191715384 ATCTTTATGTTCAGAAAAAAAGG + Intergenic
944060373 2:195565478-195565500 ATTTTTTTTTTAAAGAAAGAAGG - Intergenic
944379129 2:199086768-199086790 ATCTTTTGCTTCTGGAAACCTGG + Intergenic
944554074 2:200870528-200870550 ATTTTTTTTTTCAGTAGAGACGG - Intergenic
945662320 2:212701731-212701753 CTCTTTTTCTCCAGCAAAGAAGG + Intergenic
947281745 2:228462985-228463007 ATTTTTTTTTTCAGTAGAGATGG - Intergenic
947437831 2:230088110-230088132 TTCTATTTCTTCAGGAACCATGG + Intergenic
947996621 2:234533474-234533496 ATCTTTTTCTTCAGAAAGAAAGG + Intergenic
948069778 2:235111337-235111359 ATCTTGTGATTCATGAAAGAGGG - Intergenic
948650046 2:239436931-239436953 ATCTTTTTATTCAGGACAGCAGG + Intergenic
1169171005 20:3465312-3465334 ATCTTTATATTCTGGAGAGATGG + Intergenic
1169508379 20:6238228-6238250 ATTTTTTTCTTGATTAAAGATGG + Intergenic
1169604063 20:7295559-7295581 ATCTCTTTGTTCAGGTAAGAAGG + Intergenic
1170004912 20:11656601-11656623 ATCTTTTTCCTCTGCAAAAAGGG - Intergenic
1170330668 20:15207302-15207324 AACTTATCCTTCAGGAATGAAGG - Intronic
1170594449 20:17794556-17794578 ATTGTTTTCTTCATGAAAAAAGG + Intergenic
1170913583 20:20600122-20600144 TTTTTTTTCTTCAGTAGAGACGG - Intronic
1171038891 20:21741692-21741714 ATGTCTATCTACAGGAAAGAAGG - Intergenic
1172079305 20:32326830-32326852 ATCTTCCTCTTCATCAAAGAAGG - Exonic
1172488448 20:35314737-35314759 ATGTTCTTCTTCAGGATATAGGG + Exonic
1172571746 20:35975934-35975956 ATCTTTTTCTGAAAGAAAGAGGG - Exonic
1173036551 20:39417028-39417050 ATTTTTTTCTTTAAGAAAAATGG + Intergenic
1173330532 20:42072598-42072620 AACTTTTTCGTCTGCAAAGAGGG + Intergenic
1173721373 20:45260990-45261012 GGCTTTTTATTCAGGAAAGTTGG - Intergenic
1174367901 20:50067528-50067550 ATCTTTTTCTCCAAGGGAGATGG - Intergenic
1174504508 20:51008501-51008523 ATTTTTTTTTTCCGTAAAGACGG + Intronic
1174542145 20:51297922-51297944 ATTTTTTTTTTCAGTAGAGATGG - Intergenic
1174585827 20:51607446-51607468 TTCTTGTTCTACAGGCAAGAAGG + Intronic
1174994752 20:55553535-55553557 ATATTTATCCTCAGGAAATATGG + Intergenic
1176993577 21:15527096-15527118 ACCTTCTTCCTCTGGAAAGAAGG - Intergenic
1177200987 21:17955956-17955978 ATCTTTTTCTTCCGGGATCAAGG - Intronic
1177874179 21:26610930-26610952 ATCTCTTCCTCCAGGAAAGTGGG - Intergenic
1178117518 21:29432614-29432636 TCCTTCTTCTGCAGGAAAGAAGG - Intronic
1179170155 21:38966663-38966685 GTCCTTTTCTCCAGCAAAGATGG + Intergenic
1179473300 21:41626453-41626475 TTCTTTTTCTTAAGGCAACATGG + Intergenic
1182742171 22:32575856-32575878 TTTTTTGTCTTGAGGAAAGAAGG - Intronic
1184304848 22:43590809-43590831 CTCTTTTTCTTGAGCAAAGATGG + Intronic
949402083 3:3675833-3675855 ATTGTTTCCTTCAGGAATGAGGG - Intergenic
949475454 3:4440981-4441003 ATCCTTTTTTTCAAGAAAGGAGG + Intronic
949540777 3:5030640-5030662 TTCTTTTTTTTCTGGAAAGATGG - Intergenic
950323773 3:12084428-12084450 ATCTTGTTCTTCAAAAATGAAGG + Intronic
950352939 3:12374990-12375012 ATCTATGTGTTAAGGAAAGAAGG - Intronic
951464494 3:22987582-22987604 ATCTTGTTCTTTAAGACAGAGGG + Intergenic
951518130 3:23584559-23584581 TTTTTTTTTTTCTGGAAAGACGG + Intronic
952452435 3:33444914-33444936 ATATTTTTTTTCAGTAGAGATGG + Intergenic
952555433 3:34524749-34524771 ATTTTCTTCTTCAGGAAAATAGG - Intergenic
952710271 3:36424603-36424625 ATCTATTTCTTCAAGGAAGCTGG - Intronic
953058407 3:39406593-39406615 GGCTTTTTCTTCAGGAAGGCGGG - Intergenic
953169484 3:40494366-40494388 TCCACTTTCTTCAGGAAAGACGG + Intergenic
953172211 3:40517368-40517390 TTTTTTTTTTTCAGGAGAGACGG - Exonic
953717448 3:45328086-45328108 ATGTTTATCTTCATGAAAAAGGG - Intergenic
954099967 3:48363629-48363651 ATATTTTACTTTAGAAAAGAGGG + Intergenic
954845436 3:53551696-53551718 CTCTTTTTAGTTAGGAAAGAAGG + Intronic
955200668 3:56849456-56849478 ATATTTTTCATCAGTAAAAATGG + Intronic
955589213 3:60515958-60515980 ACCTTTGCCTTCAGGAAATAAGG + Intronic
955908939 3:63839766-63839788 AACTTCGTCTGCAGGAAAGAAGG + Exonic
956052140 3:65259725-65259747 ATCTTTTGCTTCAGGAACCTTGG + Intergenic
956148016 3:66211771-66211793 TACTTTTTCTTCAGAAGAGATGG - Intronic
957075505 3:75599950-75599972 ATCTTTTTCTTAAAGAGAGAAGG - Intergenic
957769387 3:84670267-84670289 TTATTTTTCTTCATGAAAGAAGG + Intergenic
957896051 3:86422017-86422039 ATGTCTTTCTTTAGGAAAGGTGG + Intergenic
957964002 3:87298508-87298530 ATCTGTTTCTTCAGAAAATTTGG + Intergenic
957970584 3:87376656-87376678 TTCTGGTTCTTCAGTAAAGAAGG + Intergenic
958161788 3:89826108-89826130 ATTTGCTTCTTCAAGAAAGAGGG + Intergenic
960081640 3:113547668-113547690 AGCTTTCTTATCAGGAAAGAAGG - Intronic
961275679 3:125724185-125724207 ATCTTTTTCTTAAAGAGAGAAGG + Intergenic
961278593 3:125746780-125746802 ATCTTTTTCTTAAAGAGAGAAGG + Intergenic
961826245 3:129600633-129600655 ATCTGTTTCTCCAGGCCAGAGGG + Intronic
961875807 3:130022853-130022875 ATCTTTTTCTTAAAGAGAGAAGG - Intergenic
962371678 3:134825800-134825822 ATCCTTTTCTTCCTGAAAGAAGG + Intronic
962827937 3:139113753-139113775 AGCTTTTTCTTCTGGAAAATGGG - Intronic
965007125 3:163041342-163041364 ATCTATTTGTACATGAAAGAAGG - Intergenic
965013057 3:163121867-163121889 CTCTCTTTCTTCAAGGAAGAGGG + Intergenic
965448742 3:168809897-168809919 ATCTTGTTCTTCAGGAGCAATGG + Intergenic
965617422 3:170609277-170609299 TTCTTTTTTTGGAGGAAAGAGGG + Intronic
966087781 3:176090824-176090846 ATCTCTTTCTTAAAGGAAGAAGG - Intergenic
966661002 3:182414833-182414855 ATGTTTTTCTGCAGTACAGAGGG + Intergenic
967364136 3:188666605-188666627 TTATTTTTCAACAGGAAAGAAGG + Intronic
967470101 3:189851388-189851410 TTCTTTTTCTTCAGCAGAGACGG - Intronic
967962152 3:194934125-194934147 ATCTTTCTGATCAGCAAAGATGG + Intergenic
968202768 3:196769637-196769659 ATTTTTTTTTTTAGGAGAGACGG - Intronic
969019159 4:4127900-4127922 GTGTTTTTCTTCAAGAGAGAAGG - Intergenic
969023799 4:4157776-4157798 ATCTTTTTCTTAAAGAGAGAAGG - Intergenic
969730023 4:8949294-8949316 ATCTTTTTCTTCAAGAGAGAAGG + Intergenic
969786188 4:9458924-9458946 ATCTTTTTCTTAAAGAGAGAAGG + Intergenic
969789627 4:9483408-9483430 ATCTTTTTCTTCAAGAGAGAAGG + Intergenic
970018717 4:11541849-11541871 ATAATTGTCTTCTGGAAAGAAGG - Intergenic
970246443 4:14069436-14069458 ATCCTCTTATTCAGGAAAGCAGG + Intergenic
970427762 4:15961722-15961744 AACTTTTTCTTGTGGAAATAAGG - Intronic
970587550 4:17529031-17529053 TTTTTTTTCTTCAGGTCAGATGG - Intergenic
971790322 4:31162326-31162348 CTCTTTTTCTTCCTGAAAGCAGG - Intergenic
971881103 4:32373959-32373981 ATTTTTTTTTTGAGGAAAGAAGG + Intergenic
972155914 4:36161679-36161701 ATCTTGTTATTGAGGAAAGCAGG - Intronic
972274410 4:37543654-37543676 ATTTTTTTTTTCAGTAGAGATGG - Intronic
973086382 4:46067040-46067062 ATATTTTCCTTCAGGAAAATTGG - Intronic
973683805 4:53348889-53348911 ATTTTTTTTTTAAGTAAAGATGG + Intronic
973697226 4:53501917-53501939 ATCTCTGTCTTCTGGAAACACGG + Intronic
973822230 4:54671960-54671982 ATCATTATGTTCAGAAAAGAAGG - Intronic
974033297 4:56795450-56795472 ATTTTTTTTTTCAGTAGAGATGG - Intergenic
974063306 4:57054719-57054741 ATCTTCTACTTCAGGAGAGCTGG + Intronic
974727820 4:65818384-65818406 ATCTTTTTCCTGAAGATAGAAGG + Intergenic
974938593 4:68437162-68437184 ATTTATTTCTTCAGGTAGGAAGG - Intergenic
974981452 4:68962358-68962380 TTTTTTTTCTTCAGTAAAAATGG + Intergenic
975672217 4:76792026-76792048 ATTTTTTTTTTCAGTAGAGATGG - Intergenic
975788221 4:77917675-77917697 GTATTTTTCTTGAGGAAAAAAGG - Intronic
976128815 4:81861987-81862009 ATATTTTTCATCTGCAAAGAAGG - Intronic
976151355 4:82095461-82095483 ATCTTTTTTTTAAGTAGAGATGG - Intergenic
977232233 4:94465579-94465601 TTCTTTTTTTTCAGTAGAGACGG + Intronic
977543820 4:98351002-98351024 ATCTTTTTCTTCTTGAGACAAGG - Intronic
978165196 4:105598603-105598625 ATCTTATTCTTCATGAAAATCGG - Intronic
978229567 4:106382652-106382674 ATTTTTTTTTTCAGTAGAGATGG + Intergenic
978623632 4:110659803-110659825 ATCTATTTGCCCAGGAAAGATGG - Intergenic
979323260 4:119349323-119349345 ATATTTTTATTGAGGATAGAAGG - Intergenic
979393660 4:120159389-120159411 TACTTTTTCTCCAGGAAAAAGGG - Intergenic
981049323 4:140295170-140295192 AGCATTTTCTTCAAGAAGGAAGG - Intronic
981233576 4:142388362-142388384 ATCTTATTTTTCTGGAAAAAGGG + Intronic
981798514 4:148628363-148628385 GTCTTATTCATCAGGAAAAATGG + Intergenic
982007201 4:151075147-151075169 ATCTTTTTTTTTTGGAAACAGGG + Intergenic
982084840 4:151823946-151823968 ATGTTTTTCTGCAAGAGAGAAGG - Intergenic
983241091 4:165233961-165233983 ATATTTTTATTGAGGATAGAAGG - Intronic
983724213 4:170899953-170899975 ATCTTTTTCTCCAAGAATTATGG - Intergenic
983876399 4:172881384-172881406 AGGTTTTTCTCCAGGAAAGTGGG - Intronic
984129461 4:175856054-175856076 ATCTTTTAGTTCAAGAAAAAAGG + Intronic
984209913 4:176834006-176834028 CTCTTTTTCTTCTGGTAATAAGG + Intergenic
984273281 4:177574390-177574412 AACTTTTTCTAGAGGAAAGTGGG + Intergenic
984333056 4:178351589-178351611 ATCAATTTCTCCAGGAAAGCAGG - Intergenic
984361320 4:178737172-178737194 ATCCTTATCTTCAAGAAAAAAGG + Intergenic
985102001 4:186467545-186467567 ATCGCCTGCTTCAGGAAAGAAGG + Intronic
986270490 5:6226230-6226252 ATCAGTATCCTCAGGAAAGAGGG + Intergenic
986324393 5:6661170-6661192 TTCTTTTTCTTAAGGAAGGTGGG - Intronic
986403361 5:7400863-7400885 GTAATTTTCTGCAGGAAAGATGG + Intronic
986465591 5:8019304-8019326 ACGTTTTTCTTCAGAAATGAGGG + Intergenic
986545655 5:8893842-8893864 ATATTTTTGTTGGGGAAAGAAGG - Intergenic
988112018 5:26834361-26834383 ATTTTTTTCTTCAAGAAATATGG - Intergenic
988191154 5:27936817-27936839 ATCTCTTACTTCTGGAAAGGTGG + Intergenic
988287168 5:29235187-29235209 ATGACTTTCTTCAGGAGAGAAGG - Intergenic
988298135 5:29391632-29391654 TTCCTTTTCTTCTGGAAGGAGGG - Intergenic
988358917 5:30210840-30210862 ATTTTTTTTTTTAGTAAAGATGG + Intergenic
989148162 5:38269410-38269432 ATCTTCATCTTCATCAAAGAAGG - Intronic
989219537 5:38941323-38941345 ATGTTTTTTTTAAGGAAATATGG + Exonic
989811791 5:45685877-45685899 ATTTTTTTCTTCAGAAATTATGG + Intronic
990770220 5:59235442-59235464 AGATTTTTCTTCAGCAAATAAGG - Intronic
990806053 5:59663339-59663361 ATTTTTTTTTTCAGTAGAGATGG + Intronic
990940874 5:61201530-61201552 ATCTTTTTGTTCAGGCATGATGG + Intergenic
991058755 5:62348556-62348578 ATTTGTTTCTTAAAGAAAGATGG + Intronic
992154206 5:73939028-73939050 ATCTCTTAATTCAGAAAAGATGG + Intronic
992644575 5:78799921-78799943 ACCTCTTTCTTGGGGAAAGAAGG + Intronic
992657598 5:78925914-78925936 ATCTTTTTTTCCAAAAAAGAGGG - Intronic
994054343 5:95399001-95399023 TCCTTTTTGTTCAGGAAAGTTGG - Intronic
994955294 5:106523231-106523253 TTTTTTTTCTTCAGGCCAGAAGG - Intergenic
995213812 5:109571909-109571931 ATCTTTTTCTCCAGGTAGGTAGG + Intergenic
995409753 5:111842813-111842835 AACTTGTTCTTCAGCAATGAAGG - Intronic
995472057 5:112512836-112512858 ATGTGTTTATTCAAGAAAGATGG - Intergenic
995917535 5:117266730-117266752 ATATTTTGCTTCATGAAACAGGG - Intergenic
996246790 5:121273531-121273553 ATTTTTTACTTCAGCAAATATGG - Intergenic
996947167 5:129084330-129084352 ATCTTTCTATCCACGAAAGATGG + Intergenic
999848694 5:155514003-155514025 ATATTTTTTTTCTGAAAAGAAGG - Intergenic
1000785886 5:165542717-165542739 ATATTTTTTTTCAGTAGAGATGG + Intergenic
1000851852 5:166350028-166350050 TTCTTCTTCTTCAAGAAAAAAGG - Intergenic
1001688763 5:173616472-173616494 AGCTTCTTCTCCAGGACAGAAGG + Exonic
1003063835 6:2884911-2884933 ATATTTTTCTTCAGGAGTGTAGG - Intergenic
1003515748 6:6817217-6817239 TTTTTTTTCTTCAGTAGAGATGG + Intergenic
1004161496 6:13218137-13218159 ATGTTTTTCTTTAGAAATGATGG + Intronic
1004629732 6:17409773-17409795 ATGTTTTGCTTCAGGGAAGGTGG - Intronic
1004770791 6:18778838-18778860 TTCTTTTTCTGCAGATAAGAAGG - Intergenic
1004985876 6:21081746-21081768 ATTTTTTTTTTTAGTAAAGATGG + Intronic
1006324435 6:33342775-33342797 ATATTTTTTTTTAGTAAAGATGG + Intergenic
1006998208 6:38283187-38283209 ACATTTTTCATCAAGAAAGAAGG + Intronic
1007987761 6:46224305-46224327 ATCTTTTGATCCATGAAAGATGG - Intronic
1008125440 6:47663387-47663409 ATCTTTTTTTTTAGTAGAGACGG + Intronic
1009388103 6:63111423-63111445 ATCTCTCCCTTCAGGAAAGTGGG + Intergenic
1009429183 6:63547681-63547703 ATTTTTTTTTTCAGTAGAGACGG + Intronic
1009634339 6:66245531-66245553 ATCTTTTTCTTCAGTAAACAAGG + Intergenic
1009904629 6:69855182-69855204 ATCTCTTTCCTTAGGAAATAAGG + Intergenic
1009924488 6:70103473-70103495 TCTTTTTTCTTCAAGAAAGATGG + Intronic
1010335440 6:74676961-74676983 ATCTTTGTCTTCCAGAAAAATGG + Intergenic
1011087672 6:83560499-83560521 ATTTGTTTCTTTATGAAAGATGG + Intronic
1011716307 6:90108821-90108843 ACCTTTTTATTGAGGACAGAGGG + Intronic
1011767446 6:90638159-90638181 TTATTTTTCTTCAAGAAATAAGG + Intergenic
1012573569 6:100762157-100762179 ATTTTTTGCTTGAGGATAGAGGG - Intronic
1012731436 6:102887573-102887595 TACTTTGTCTTAAGGAAAGAGGG + Intergenic
1013605667 6:111745306-111745328 ATGTGTTTCTTCAGGCAAGCAGG - Intronic
1013691612 6:112651440-112651462 ATCTGTTTTCTCAAGAAAGATGG - Intergenic
1013984546 6:116174409-116174431 GTCTTTTCCTTCAGGAGTGAGGG - Intronic
1014002306 6:116378130-116378152 CTTCTTTTCTTCAGGGAAGATGG - Intronic
1014287841 6:119521766-119521788 AACTGTTTCTTAAGGAAAGAAGG - Intergenic
1014753118 6:125274724-125274746 ATGTATTTCCTCAGGAAGGAAGG + Intronic
1015204043 6:130614953-130614975 ATCTTTCTATTAAGGATAGATGG - Intergenic
1015607131 6:134969595-134969617 AGCTTTTTCCTCTGTAAAGATGG + Intronic
1015787355 6:136931492-136931514 ATCTTTTCCTTGTGGCAAGATGG - Intergenic
1015847945 6:137541025-137541047 CTTTTTTGCTTCTGGAAAGATGG + Intergenic
1016023329 6:139258494-139258516 ATCTTTTTCTTAAGAGAACATGG + Intronic
1016295141 6:142565742-142565764 ATCTCTTTCTTTAAGAAAAAAGG + Intergenic
1016832368 6:148446411-148446433 GTTCTTTTCTTAAGGAAAGAGGG + Intronic
1016877609 6:148879376-148879398 ATGTTTTACTTCTGGAAAGTGGG + Intronic
1017567242 6:155700727-155700749 TTTTTTTTTTTCAGTAAAGATGG + Intergenic
1017672954 6:156784484-156784506 AACTTTTTCTTCAGGAAATTTGG + Intronic
1018538102 6:164845468-164845490 AAGTTTTTCTTCAGGAAAAGGGG - Intergenic
1018801905 6:167229356-167229378 ATCTTGTTTTTCTGGAAAAAAGG + Intergenic
1018827483 6:167420879-167420901 TTCTTTTTCTTCCTGAAAGCAGG + Intergenic
1018849501 6:167576828-167576850 ATCTTGTTCTTCAGGAATTTGGG - Intergenic
1018976445 6:168571190-168571212 ATCTTTTTGTTTAGTAAAAAAGG + Intronic
1020149328 7:5669453-5669475 ATCTTTCACTTGAGGCAAGATGG - Intronic
1020856416 7:13430843-13430865 ATATTTTACTTAATGAAAGATGG + Intergenic
1020952582 7:14699118-14699140 ATTTTTTTTTTCTGGAGAGAGGG - Intronic
1021524877 7:21575987-21576009 AACTTCTGCTTCTGGAAAGAGGG + Intronic
1022458803 7:30584748-30584770 ATCAGTTTCGTCTGGAAAGATGG - Intergenic
1024126197 7:46297976-46297998 AAATTATTCTTCAGGAATGAAGG + Intergenic
1024544421 7:50505460-50505482 ATCTTTATCCTCAGGACACATGG - Intronic
1025754979 7:64330132-64330154 TTCTTTTGCTTCAGGGAAGTGGG + Intronic
1027700876 7:81468890-81468912 CTCTCTTGCTTCAGGAAAAAAGG + Intergenic
1027941810 7:84691697-84691719 TTATTTTTCATGAGGAAAGAGGG + Intergenic
1028037175 7:85999427-85999449 GTCTCTTTCTTCAGGATAGTAGG + Intergenic
1028109209 7:86918776-86918798 ATCTTTTCCTTTAGGATGGATGG - Intronic
1028594912 7:92538214-92538236 AACTTTTTCTTCAGGGAGCACGG - Intergenic
1029077602 7:97948263-97948285 ATCTTTTTCTTAAAGCGAGAAGG - Intergenic
1030010134 7:105157580-105157602 ATATTTTTCTTAAAGAAAGATGG + Intronic
1030023867 7:105302898-105302920 TTTTTTTTCTTCAGAAAAGTAGG - Intronic
1030604977 7:111630973-111630995 ATCTTTTTCTTCATTTATGAAGG + Intergenic
1031117825 7:117687391-117687413 ATATGTTTCTTCAGCAAAAATGG - Intronic
1031674819 7:124596739-124596761 ATCATTTTCTTTGGGAATGAGGG - Intergenic
1031683456 7:124703432-124703454 ATTTTTTTCTTCTGGAGACATGG + Intergenic
1031795946 7:126174989-126175011 ATTTTTTTCATAAGTAAAGAGGG + Intergenic
1032070175 7:128800180-128800202 CTCTTTTTCTTCAGTTAATATGG + Intronic
1033760470 7:144431505-144431527 ATCTTTCTTTTCAGGCATGATGG + Intergenic
1034342489 7:150367104-150367126 ATGTTTTTCTTCTGTAGAGATGG - Intergenic
1035006834 7:155669817-155669839 CTCTATTTCTTCAGGTGAGAGGG + Intronic
1035138141 7:156728416-156728438 ATCTGTTTCTTCATGAAAGCAGG - Intronic
1035437909 7:158872824-158872846 TTCTTTTTTTTCAGTAGAGATGG - Intronic
1035556585 8:571729-571751 AGTTTTTCCTTCAGGAAGGAAGG + Intergenic
1035858522 8:3002926-3002948 TTTTTTTTCTTCAGGCAAGGAGG - Intronic
1036605330 8:10300557-10300579 ATTTTTTTGTTCAGTAGAGATGG + Intronic
1036819594 8:11929866-11929888 ATATTTTTCTTAAAGAGAGAAGG - Intergenic
1036832775 8:12034915-12034937 ATCTTTTTCTGAAAGAGAGAAGG - Intergenic
1036902950 8:12685438-12685460 ATCTTTTTCTAAAAGAGAGAAGG - Intergenic
1036980529 8:13465216-13465238 ATTTTGTTCTCCAGGAAAGGTGG - Intronic
1037412104 8:18608685-18608707 ATCTTCCTCTTTATGAAAGAGGG - Intronic
1037544211 8:19902075-19902097 ATTTTTTTCTTTAGAAAACAAGG - Intronic
1038554333 8:28495687-28495709 ATCTTTTTCCTCCAGAAAAAAGG + Intronic
1038621504 8:29147794-29147816 TGCTTTTTCTGCAGGGAAGATGG - Intronic
1038970679 8:32630734-32630756 TTTTTTTTTTTCAGGCAAGATGG + Intronic
1039063108 8:33587924-33587946 ATGTATTTCTTCAGTAGAGATGG + Intergenic
1039088708 8:33805491-33805513 ATTTTATTCTTCTGAAAAGAAGG - Intergenic
1039143017 8:34414431-34414453 TTCTTTTTTTTCAGTAGAGACGG + Intergenic
1040462025 8:47658603-47658625 ATGTTTTTCTACAATAAAGATGG + Intronic
1040570764 8:48607309-48607331 AAAATTTTCTTCAGGAATGAGGG + Intergenic
1041176609 8:55203431-55203453 ATCTTTATCTTCAGGGAACTTGG - Intronic
1041905644 8:63030876-63030898 ATCTTTTTTTTCTGGAGAAAGGG - Intronic
1042470908 8:69186795-69186817 ATCCTTATCTGCAGGAAACATGG + Intergenic
1043960343 8:86410494-86410516 ATTTTTTTACTCAGGAAAGCTGG - Intronic
1043977779 8:86602419-86602441 ATCTTTGTGTTCTGGAAATATGG - Intronic
1044238550 8:89860493-89860515 ATCTTTTTTTCTAGCAAAGATGG + Intergenic
1044638772 8:94356099-94356121 TTCTTTTTCTTTAAGAAACAAGG - Intergenic
1044913238 8:97084389-97084411 ATCTTTTTCTTGAGGGAATCAGG + Intronic
1045544346 8:103114758-103114780 ATCTGATTCTTCAGGCCAGAAGG - Intergenic
1045724357 8:105154524-105154546 ATCTAATTGTTTAGGAAAGATGG + Intronic
1046618431 8:116502130-116502152 CTCCTTTTCTTCAGGAAAGTGGG - Intergenic
1046619171 8:116509595-116509617 ACCTCTTTCTTTAGAAAAGAGGG + Intergenic
1046815350 8:118577232-118577254 ACCTTTTTCTTCTGGAATAAGGG + Intronic
1047198633 8:122744596-122744618 ATCTTTAGCTCCAGGACAGAAGG - Intergenic
1047295126 8:123563979-123564001 ATATTTTCCTTTAGGACAGAGGG - Intergenic
1047420685 8:124705603-124705625 ATTTTCTTGTTCAGGAAAGGAGG + Intronic
1047463994 8:125094858-125094880 CTCTTTTTTTTGAGAAAAGAGGG + Intronic
1047591039 8:126328000-126328022 ATGTGTTTCATGAGGAAAGAAGG + Intergenic
1047670907 8:127145803-127145825 ATCTTTTTCTTTAGGTAATGAGG - Intergenic
1047706555 8:127505266-127505288 CTCTTTTTCTTTATGACAGAGGG - Intergenic
1050879237 9:10678412-10678434 GTCTCATTCTTCAGGAAATAGGG + Intergenic
1051377929 9:16423204-16423226 ATATTTATCTCTAGGAAAGAGGG + Intronic
1051500912 9:17776794-17776816 AGGTTTTTCTTCCAGAAAGATGG - Intronic
1053703355 9:40724593-40724615 ATCTTTTGGTGAAGGAAAGAAGG + Intergenic
1054413412 9:64848057-64848079 ATCTTTTGGTGAAGGAAAGAAGG + Intergenic
1055645026 9:78355259-78355281 ATCTATTGCTTCAGCAATGAGGG + Intergenic
1055670133 9:78596319-78596341 ACATTTTTCATCAGGAAAGAAGG - Intergenic
1055746032 9:79445460-79445482 AAATTTTGCTTTAGGAAAGATGG - Intergenic
1057156695 9:92848264-92848286 GTCTTTTTCTTGAGGAAACCAGG + Exonic
1058006511 9:99921929-99921951 ATCATTTTCCTCAGTAAAGAAGG + Intronic
1058011630 9:99984002-99984024 ATTATTTTCCTCAGAAAAGAAGG - Intronic
1058494209 9:105537399-105537421 ATCATTTTCCTCAGGATAAATGG + Intronic
1058550392 9:106108596-106108618 ATCTTTTTCTCAAGGAAAAGTGG - Intergenic
1059122307 9:111652337-111652359 ATTTTTTTTTTTAGGACAGATGG - Intronic
1059621360 9:116009110-116009132 ATTTTTTTCTTCAGGAAAATAGG + Intergenic
1060458580 9:123825785-123825807 ATAATTTTCTCCAGGAAAGAGGG - Intronic
1061340721 9:129978427-129978449 TTCTTTTTCTTCCTAAAAGATGG - Intronic
1061378002 9:130237407-130237429 TTCTTTCTCTTCAGGAAACTGGG - Intergenic
1061659273 9:132117690-132117712 TTTTTTTTCTTCATGGAAGATGG - Intergenic
1186712138 X:12210076-12210098 ATCTTTTTCTTGAGTGAAGTAGG - Intronic
1186844779 X:13519736-13519758 ATTTTTTTCTGAAGGACAGAGGG + Intergenic
1189378736 X:40486290-40486312 CTCTTTTTCTTCAGAGATGAAGG + Intergenic
1190072707 X:47292193-47292215 CTCTTTTTCATCAGGAGTGAGGG + Intergenic
1190532867 X:51396863-51396885 ATCTTTTTCTTGTTGGAAGAAGG + Intergenic
1190565589 X:51727279-51727301 ATCTTTTTCTTTAGGAATGTTGG + Intergenic
1190768906 X:53498894-53498916 ATCTTTTTCTTTTTGAGAGAGGG - Intergenic
1190999252 X:55642765-55642787 TTCTTTTTATTAAGGAAGGAAGG + Intergenic
1191016881 X:55818831-55818853 TTCTTTGTCTTCAGGTATGAGGG + Intergenic
1191778547 X:64844167-64844189 CTCCTTTTCTTCTGGAAGGAAGG - Intergenic
1191951816 X:66601162-66601184 ATTATTATCTTCAGGATAGAAGG + Intronic
1192021682 X:67399464-67399486 ATCTTTTTCATCAGGGATGTTGG + Intergenic
1193152037 X:78135404-78135426 TTTTTTTTTTTCAGTAAAGACGG - Intronic
1193905893 X:87243681-87243703 ATCTTTTCCTTCAAGGAAGTGGG + Intergenic
1194115229 X:89888558-89888580 ATCTTTTTCTTCATGTCAGAGGG + Intergenic
1194128019 X:90044080-90044102 AAATTTTGCTTCAGGAAATATGG + Intergenic
1194326137 X:92519478-92519500 ATTTTTATCTTGAGCAAAGAAGG - Intronic
1194470833 X:94294250-94294272 ACCTTTTTCTTAATGAAACAAGG + Intergenic
1194795673 X:98209002-98209024 ACCTTTTTCTAGATGAAAGAAGG + Intergenic
1195247422 X:103007037-103007059 ATCTTTCTCTTCAGAAAACTGGG + Intergenic
1195523428 X:105857576-105857598 ATTTTTTTCTTTAAGAAATAAGG - Intronic
1199299187 X:146193201-146193223 ACCTTATTCTTCTGGAAATATGG + Intergenic
1199676749 X:150195882-150195904 ATCTGTTGCTTCAGGAAGAAGGG + Intergenic
1200038490 X:153348352-153348374 AACGTTCTCTTCAGGAAAGCTGG - Exonic
1200427245 Y:3035003-3035025 AACTTACTCTTCAGGGAAGAGGG + Intergenic
1200468020 Y:3545697-3545719 ATCTTTTTCTTCATGTCAGAGGG + Intergenic
1200634856 Y:5638678-5638700 ATTTTTATCTTGAGCAAAGAAGG - Intronic
1201401687 Y:13610438-13610460 TTCTTTGACTTCAAGAAAGATGG + Intergenic
1201742968 Y:17343399-17343421 CTCTTTTTAATCTGGAAAGATGG + Intergenic
1202189448 Y:22225784-22225806 ATTTTTTTCTCCAGGCAAGATGG - Intergenic
1202304158 Y:23450342-23450364 ATCTTTTTCCTTAAGATAGAAGG + Intergenic
1202305201 Y:23461820-23461842 TGCATTTTCTTCAGGGAAGAGGG - Intergenic
1202565608 Y:26208769-26208791 TGCATTTTCTTCAGGGAAGAGGG + Intergenic
1202566652 Y:26220249-26220271 ATCTTTTTCCTTAAGATAGAAGG - Intergenic
1202586858 Y:26439445-26439467 ATTATTTTCCTCAGGGAAGAGGG + Intergenic