ID: 1157372031

View in Genome Browser
Species Human (GRCh38)
Location 18:47122693-47122715
Sequence CTGTGCCAGTGTGACATTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157372031 Original CRISPR CTGTGCCAGTGTGACATTGG AGG (reversed) Intronic
900991716 1:6101227-6101249 CTGGGCCAGGGTGACACGGGAGG + Intergenic
902406046 1:16184248-16184270 ATGAGCCAGTTTGACATTTGTGG + Intergenic
906108363 1:43307834-43307856 CAGTGCCAGTGTCAGAATGGTGG + Exonic
907424569 1:54371482-54371504 CTGTGCCCGTGTCACAGTAGAGG - Intronic
909782973 1:79570841-79570863 GTGTGCCAGTGTAGTATTGGTGG - Intergenic
910936564 1:92487493-92487515 TTGTGCATGTCTGACATTGGAGG - Intergenic
912459958 1:109823962-109823984 CTGAGCCAGGGTGACCCTGGGGG - Intergenic
915590371 1:156867063-156867085 CTGTGTCTGTGTGACACTGCTGG + Intronic
916247689 1:162705231-162705253 TTGTCCCAGTGTGACCTTGTGGG + Intronic
916921797 1:169476916-169476938 CTGTATCAGTCTGACTTTGGAGG + Intronic
918199723 1:182255763-182255785 GGGTGCCAGTGTAACAGTGGTGG + Intergenic
920183205 1:204145280-204145302 CTGTCACTGTGTGACCTTGGGGG - Intronic
920557195 1:206912865-206912887 CTGTGGCAATGTGAAAATGGAGG - Intronic
920804528 1:209220022-209220044 CTGAGCCAGTGTTCCCTTGGCGG - Intergenic
920951047 1:210572064-210572086 CCGTGCCAGTGTAACATTTACGG - Intronic
922294690 1:224239521-224239543 ATGTGACAGTGTGACAGTCGAGG - Intronic
1063971494 10:11384324-11384346 ATGAGCAAGAGTGACATTGGAGG + Intergenic
1065074860 10:22067037-22067059 TGTTGCCAGTGTGACAGTGGGGG - Intergenic
1066599935 10:37093641-37093663 CTCTGCCACTGTGACTTTGCAGG - Intergenic
1071170871 10:82862348-82862370 CTATGCCTGTGGGACACTGGAGG - Intronic
1071461196 10:85897879-85897901 GTGGGCCAGAGTGACAGTGGGGG - Intronic
1073442980 10:103563893-103563915 CTGTGCCAGAGTGGCATTGGGGG + Intronic
1074183652 10:111083518-111083540 CAGTGACAGTGTGGCAGTGGGGG + Intergenic
1075157572 10:119990593-119990615 CTCTCCCAGTGAGACTTTGGGGG + Intergenic
1076642465 10:131928102-131928124 GTGTGTGAGTGTGACATTGCAGG + Intronic
1076679004 10:132161873-132161895 CTCTTCCTGTGTGATATTGGGGG + Intronic
1077538411 11:3135231-3135253 CTGGGCCAGTGTCCCCTTGGCGG - Intronic
1080773863 11:35367354-35367376 CTCAGCCAGGGTGACCTTGGGGG + Intronic
1080991419 11:37541112-37541134 TTGTGCCCGTATTACATTGGAGG - Intergenic
1081392144 11:42541730-42541752 CTGTGCCAGTCTGATATGTGTGG - Intergenic
1081516001 11:43830708-43830730 CTGTGCCAGTATTACATTTCAGG + Intronic
1083226408 11:61287647-61287669 CTGGGCCAGTCTGTCACTGGTGG - Intronic
1083476597 11:62919501-62919523 CTCTGCCAGTGTGGCATCAGAGG + Intronic
1084106649 11:66984970-66984992 CTGAACCAGTGTGACATTCTGGG + Intergenic
1089628767 11:119770420-119770442 CTCAGCCAATGTGACACTGGAGG - Intergenic
1093110359 12:15144608-15144630 ATTTGGCAGTGTGAAATTGGTGG + Intronic
1093277677 12:17149442-17149464 CTGAGCTAGTGTGATTTTGGTGG - Intergenic
1093810237 12:23483894-23483916 CTATGCCAGTTGGACATTCGAGG - Intergenic
1101421067 12:104551566-104551588 CTGTGCCAGTGTAACTTAGAAGG + Intronic
1103892429 12:124249942-124249964 CTGTGCCAGTGAGGCCTTAGAGG - Intronic
1107438735 13:40404779-40404801 TTGGGCCAGGGTGATATTGGTGG - Intergenic
1108825670 13:54408906-54408928 GTGAGCCAGTGTGATTTTGGCGG - Intergenic
1108944112 13:56000101-56000123 TTGTGCCAGTGTGTTAATGGAGG + Intergenic
1110289112 13:73783947-73783969 CTGTGGACTTGTGACATTGGAGG - Intronic
1111836489 13:93394989-93395011 CTGTGCCCCTGTGACAGTGGAGG - Intronic
1113277758 13:108751744-108751766 CTGTGCCTGTGTGATTTTGGAGG - Intronic
1113968777 13:114172241-114172263 CCTTGCCAGTTTGATATTGGGGG - Intergenic
1115382588 14:32756915-32756937 ATGTGCCAGCCTGACAGTGGGGG + Intronic
1116430835 14:44843666-44843688 CTGTGGCAGTGTGGAACTGGAGG + Intergenic
1118293167 14:64544557-64544579 CAGTGCTGGTGTCACATTGGTGG + Exonic
1118622649 14:67628041-67628063 CTGTGCCACAGTGCCCTTGGGGG + Intronic
1121611603 14:95284642-95284664 CTGTGCAAGTCTGAAATTTGGGG - Intronic
1121897851 14:97665003-97665025 CGGTGGCAGTGTGAGTTTGGGGG + Intergenic
1126783657 15:52159416-52159438 CTGTTCCAGTCTGACCTTGGAGG - Intronic
1127221208 15:56883634-56883656 ATGTGCTAGGGAGACATTGGTGG - Intronic
1129549275 15:76430439-76430461 CTCTGCCTGTGTGACTTTGTAGG - Intronic
1130694831 15:86120616-86120638 TTGTGCCAGTGGCACAATGGTGG - Intergenic
1132063999 15:98715558-98715580 GTATGCCAGTGTGACATTCTCGG + Intronic
1132294801 15:100727130-100727152 CTATCACAGTGTGACCTTGGGGG - Intergenic
1132378460 15:101348354-101348376 TGGGGCCAGTGTGACATTTGCGG + Intronic
1132870315 16:2112832-2112854 CAGTGCTAGCGTGGCATTGGGGG + Exonic
1134522221 16:14924086-14924108 CAGTGCCAGCGTGGCATTGGGGG - Intronic
1134709891 16:16322737-16322759 CAGTGCCAGCGTGGCATTGGGGG - Intergenic
1134717108 16:16362756-16362778 CAGTGCCAGCGTGGCATTGGGGG - Intergenic
1134949712 16:18345908-18345930 CAGTGCCAGCGTGGCATTGGGGG + Intergenic
1134957643 16:18389403-18389425 CAGTGCCAGCGTGGCATTGGGGG + Intergenic
1141422497 16:83926030-83926052 CTCTGCAAGTGTCACATTGGAGG - Exonic
1141426585 16:83948127-83948149 CTTTGCTACTGGGACATTGGAGG - Intronic
1141516243 16:84547236-84547258 CGAAGCCAGTGAGACATTGGGGG + Intronic
1141524469 16:84603065-84603087 CTGGGCCATTGTTACATGGGAGG - Intronic
1143459747 17:7094652-7094674 CTGTGCTAGTGTGGCAGTCGAGG + Intergenic
1144747228 17:17623918-17623940 CTGAGCAAGTGGGACAATGGGGG + Intergenic
1150601178 17:66652414-66652436 TTGTACCAGTGTGACATTTCTGG + Intronic
1154274268 18:12946385-12946407 CTGTGCATGTGTGACAGTAGGGG + Intergenic
1155235638 18:23816387-23816409 GGGTGTCAGTGTGACATTGGTGG + Exonic
1155504978 18:26524499-26524521 CTGAGCCTGAGTGACTTTGGGGG - Intronic
1156121334 18:33846360-33846382 CTGTACCAACATGACATTGGAGG - Intergenic
1157372031 18:47122693-47122715 CTGTGCCAGTGTGACATTGGAGG - Intronic
1159554677 18:69932918-69932940 CTGGGCCTGTGTGAGGTTGGAGG - Intronic
1161528177 19:4770361-4770383 CTGTGCCCATGTGACATTTGGGG + Intergenic
1166305881 19:41936756-41936778 CTGTATCAGTGTGACTTTTGGGG + Intergenic
925425593 2:3746770-3746792 CTGAGCCAGTGAGACAGAGGAGG + Intronic
928738267 2:34318754-34318776 CTGTGCCACTGAGGAATTGGAGG - Intergenic
928762217 2:34598011-34598033 CTCTGCCAATGTGTCCTTGGAGG - Intergenic
930645872 2:53906254-53906276 CAGTGCTAGTGTGATATTGCTGG - Intronic
931833350 2:66074708-66074730 CTGTGCCAGGCTAACTTTGGGGG - Intergenic
935087772 2:99865187-99865209 CTGTGCCATTGTGCCCTTAGAGG - Intronic
935094052 2:99926993-99927015 CTGAGCCTGTGTGAGATTGCTGG - Intronic
935895845 2:107736629-107736651 CTGTGCAAGTTTGACAGTGTAGG - Intergenic
936066052 2:109332937-109332959 CTGTGACAGTGAGACCTTGGTGG + Intronic
941035660 2:160566454-160566476 GTTTACCAGTGTGACAATGGAGG + Intergenic
941468865 2:165860513-165860535 CTCTGCCAGTGTGGCTTTGCAGG + Intronic
943401360 2:187415548-187415570 CTCTGCCAATGTGTCAGTGGTGG + Intronic
943725485 2:191247132-191247154 TTGTGCCTGTGGGACACTGGTGG + Intronic
944060347 2:195565248-195565270 CTAAGCCAGTGTGAGAGTGGAGG - Intergenic
944757131 2:202774772-202774794 CTGGCCCAGTGTGATATGGGTGG - Exonic
945048318 2:205801015-205801037 CTTTGCCCCTGTGACGTTGGTGG + Intergenic
946951815 2:224884435-224884457 CAGTGCCATTGTGAAATTTGAGG + Intronic
947994743 2:234517561-234517583 TTATGCCAGTGTTACAGTGGAGG - Intergenic
948860589 2:240750907-240750929 CAGTGCCAGTGTGAAAAGGGGGG - Intronic
1169008703 20:2231636-2231658 TTGTGACAGAGAGACATTGGTGG + Intergenic
1170058826 20:12237981-12238003 CTGAGTCAGTGTCAAATTGGTGG + Intergenic
1172773811 20:37396068-37396090 CTGTGCCTGCCTGACATTGGAGG - Intronic
1175379407 20:58552525-58552547 ATGAGACAGTGTGACAATGGGGG + Intergenic
1175895665 20:62334600-62334622 GGCTGCCGGTGTGACATTGGCGG - Exonic
1175930569 20:62491950-62491972 CTTTCCCAGTGTGACATGGCGGG + Intergenic
1180846827 22:18987663-18987685 CAGTGTCAGTGTGACAGTTGTGG + Intergenic
1180846983 22:18988757-18988779 CAGTGTCAGTGTGACAGTTGTGG - Intergenic
1180948071 22:19707741-19707763 CTGTGCCGCTGTGAGATTTGCGG + Intergenic
1181636862 22:24178538-24178560 CTCTGCCTGTGTCACAGTGGAGG + Exonic
1181747180 22:24963561-24963583 ATGGGCCACTGTGTCATTGGTGG + Intronic
1182305604 22:29365766-29365788 CTGTGCCTGTGACACATTTGGGG - Intronic
1182312878 22:29421704-29421726 CTGTGCCTGTGACACATTTGGGG - Intronic
1184234325 22:43174963-43174985 GTGTGCCTGTCTGAGATTGGTGG - Intronic
950339999 3:12234672-12234694 CTGTGACAGTGTCACCTTAGAGG + Intergenic
950464531 3:13145512-13145534 TTCTGCCAGTGAGACATTAGAGG - Intergenic
954326245 3:49865841-49865863 CTTTGCCAGTGTGGCGTGGGTGG + Intronic
954787247 3:53102868-53102890 CTGTGATTGTGTGACATTAGAGG + Intronic
956167336 3:66406527-66406549 CTGTTCCAGTGTGACAGGGAGGG - Intronic
956263322 3:67369527-67369549 CTGAGGCTGTGTGCCATTGGTGG + Intronic
956371200 3:68563839-68563861 CTGTGTCAGTGTTACATGGCGGG - Intergenic
958505713 3:94974238-94974260 GTGAGCTAGTGTGATATTGGGGG - Intergenic
959894076 3:111587409-111587431 CTCTGCCAGTGTGGCTTTGCAGG + Intronic
966861730 3:184234329-184234351 CTCTGCCAGTGTGACACAGATGG - Exonic
969944920 4:10773493-10773515 CTGAGTCAGTGTGTCATTGCTGG - Intergenic
970617857 4:17784360-17784382 CAGTGCCAATATGACATTAGTGG - Intergenic
974922314 4:68257018-68257040 CTTAGAAAGTGTGACATTGGAGG - Intergenic
978885856 4:113765603-113765625 CTGTGCTAGTGATACAGTGGGGG - Intergenic
979537051 4:121834245-121834267 CTGTTCCTGTCTGACTTTGGGGG - Intronic
980654009 4:135759086-135759108 CTCTGCCCCTGTGACATTGCAGG + Intergenic
980880888 4:138709040-138709062 CTTTGGGACTGTGACATTGGGGG - Intergenic
985578364 5:684128-684150 CTGTGGCCGTGGGACATTGGAGG - Intronic
985593294 5:776268-776290 CTGTGGCCGTGGGACATTGGAGG - Intergenic
989249989 5:39301914-39301936 TTGTGCCAATGTGACAATGTTGG - Intronic
990003164 5:50918869-50918891 CTATGCAAGTGTGACATTCTAGG - Intergenic
992594456 5:78331589-78331611 CAGTGCCAGTGTGTTATAGGGGG + Intergenic
992910968 5:81395459-81395481 GTGTGCCACTGTGATTTTGGGGG + Intergenic
993015332 5:82528948-82528970 CTTTTCCAGTGTTACATTGCTGG + Intergenic
997431932 5:133846898-133846920 CTCTGACAGTGTGAGATGGGTGG - Intergenic
1009557781 6:65196775-65196797 CTCTGTCAATGTTACATTGGAGG + Intronic
1011262539 6:85484273-85484295 CTGTGCCATTGTCTCCTTGGAGG + Intronic
1015006419 6:128287105-128287127 CTGAGGCAGTGAGACATTGTAGG - Intronic
1016879974 6:148901463-148901485 CTGTGCCACAGTAACATTGGAGG - Intronic
1020359379 7:7311249-7311271 CTGAGCCAATGTGACCTTGCAGG + Intergenic
1023100282 7:36710989-36711011 CTGTACAAATGTGACTTTGGGGG - Intronic
1024104646 7:46070410-46070432 CTGTGCCTGTGTGCCAGTAGGGG + Intergenic
1029609026 7:101616795-101616817 CTTGGGCAGTGTGGCATTGGAGG + Intronic
1029821355 7:103150357-103150379 ATGTGCCTGTGTGACATTGGAGG + Intergenic
1032259825 7:130326488-130326510 CTGAGCCAGTCTGTCATGGGTGG - Intergenic
1032806829 7:135363400-135363422 CTCTGCCTCTGTGACAGTGGGGG - Intronic
1034308507 7:150066686-150066708 CTCTGCCCTGGTGACATTGGTGG - Intergenic
1036402702 8:8424501-8424523 CTGTACCAGTGTCACTCTGGGGG + Intergenic
1038182568 8:25242836-25242858 CTGTGTCAGTTTGTCACTGGAGG + Intronic
1039987586 8:42460806-42460828 GTGTGCCAGTGTTACATTGATGG - Intronic
1040440045 8:47431557-47431579 CTGTGACACTGTGACCCTGGAGG + Intronic
1042176125 8:66038287-66038309 TTGATCCAGTGTGACATAGGTGG + Intronic
1042496731 8:69463380-69463402 CTGTGCCACTGTGCCACTGGGGG - Intergenic
1043064569 8:75551451-75551473 TTGTGCCAGTGTGTTAATGGAGG - Exonic
1043359276 8:79451997-79452019 CTTTGCCAGTTTGATGTTGGTGG - Intergenic
1044728917 8:95214748-95214770 CAGAGCAAGTGTGACATGGGAGG + Intergenic
1047726075 8:127685074-127685096 CTTTGTCAGTAAGACATTGGAGG - Intergenic
1050103318 9:2140946-2140968 CTGCGCCAGTGTGAGAATGCAGG - Intronic
1050827816 9:9970836-9970858 ATGTTCCAGTGTGACATTCCAGG - Intronic
1052017536 9:23486637-23486659 CTGTGCCTGTGTGCCATCGTGGG - Intergenic
1056259242 9:84831470-84831492 CTATGCCCGTGGTACATTGGTGG + Intronic
1185643723 X:1601988-1602010 CAGTGCCAGTGTGACTATGGTGG - Exonic
1186099380 X:6139350-6139372 TTGTTACATTGTGACATTGGAGG - Intronic
1186411573 X:9348685-9348707 CTCTGCCAGTGGGACCTGGGTGG - Intergenic
1186590420 X:10924769-10924791 CTGTGCCAGGGTGACTTCAGTGG + Intergenic
1189630596 X:42948571-42948593 CTGAGCCAGGGTGATATTGGGGG - Intergenic
1194687340 X:96938171-96938193 CTGTGCCCCTGTGAGATTGAGGG + Intronic