ID: 1157374474

View in Genome Browser
Species Human (GRCh38)
Location 18:47150473-47150495
Sequence CGCTGCTGCCCGACGGACGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 54}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157374462_1157374474 20 Left 1157374462 18:47150430-47150452 CCACCCGCACTGGCCGCGGGTCC 0: 1
1: 0
2: 1
3: 25
4: 164
Right 1157374474 18:47150473-47150495 CGCTGCTGCCCGACGGACGCCGG 0: 1
1: 0
2: 2
3: 9
4: 54
1157374467_1157374474 7 Left 1157374467 18:47150443-47150465 CCGCGGGTCCTCAGCCGGGATAG 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1157374474 18:47150473-47150495 CGCTGCTGCCCGACGGACGCCGG 0: 1
1: 0
2: 2
3: 9
4: 54
1157374468_1157374474 -1 Left 1157374468 18:47150451-47150473 CCTCAGCCGGGATAGACAGCCCC 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1157374474 18:47150473-47150495 CGCTGCTGCCCGACGGACGCCGG 0: 1
1: 0
2: 2
3: 9
4: 54
1157374463_1157374474 17 Left 1157374463 18:47150433-47150455 CCCGCACTGGCCGCGGGTCCTCA 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1157374474 18:47150473-47150495 CGCTGCTGCCCGACGGACGCCGG 0: 1
1: 0
2: 2
3: 9
4: 54
1157374459_1157374474 24 Left 1157374459 18:47150426-47150448 CCAGCCACCCGCACTGGCCGCGG 0: 1
1: 0
2: 1
3: 11
4: 196
Right 1157374474 18:47150473-47150495 CGCTGCTGCCCGACGGACGCCGG 0: 1
1: 0
2: 2
3: 9
4: 54
1157374469_1157374474 -7 Left 1157374469 18:47150457-47150479 CCGGGATAGACAGCCCCGCTGCT 0: 1
1: 0
2: 0
3: 12
4: 74
Right 1157374474 18:47150473-47150495 CGCTGCTGCCCGACGGACGCCGG 0: 1
1: 0
2: 2
3: 9
4: 54
1157374464_1157374474 16 Left 1157374464 18:47150434-47150456 CCGCACTGGCCGCGGGTCCTCAG 0: 1
1: 0
2: 1
3: 4
4: 139
Right 1157374474 18:47150473-47150495 CGCTGCTGCCCGACGGACGCCGG 0: 1
1: 0
2: 2
3: 9
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157374474 Original CRISPR CGCTGCTGCCCGACGGACGC CGG Exonic
901057343 1:6454840-6454862 CGCCGCTGCCCGACGCGCCCTGG + Intronic
901110001 1:6786040-6786062 CGCTGCCGCCCGACGGGGACCGG - Intronic
902213492 1:14920504-14920526 TCCTGCTGCCCCACGGAGGCTGG + Intronic
902583323 1:17423039-17423061 CGCTGCTGCCCCAGGGAAGGAGG - Intronic
908401244 1:63774473-63774495 CGCTGCTGCTGGCCGCACGCGGG + Exonic
912401469 1:109397456-109397478 GGCTGCGGCCCGGGGGACGCGGG + Intronic
1070593432 10:77816560-77816582 CTCCGCTCCCCGAGGGACGCGGG + Exonic
1071532479 10:86400651-86400673 GGCTGCAGCCCCACGGCCGCCGG + Intergenic
1078561681 11:12377925-12377947 CGCTCCTGCCCGACGTACCCGGG - Intronic
1082880402 11:58031383-58031405 GGCAGCTGCCAGACGGATGCAGG - Exonic
1083729070 11:64643315-64643337 CGCTGCCGCCCGACGGAGGCCGG + Intronic
1095875928 12:47079927-47079949 AGCTGCTGCCCGCAGGAGGCAGG - Intronic
1123173757 14:106398966-106398988 AGCTGCTGCCCGACGCCCGCGGG - Intergenic
1129016654 15:72474608-72474630 CGCGGGGGCCCGGCGGACGCTGG - Exonic
1130908471 15:88255785-88255807 CGCCGCTGCCCGCCGCCCGCTGG - Intronic
1132405465 15:101539637-101539659 CCCTGCTGCCCTCCGGGCGCTGG + Intergenic
1136484337 16:30561606-30561628 CGCGGCTCCCGGAGGGACGCTGG + Intergenic
1138514556 16:57528971-57528993 CGCTGCTGGCCGACGGCGACTGG - Exonic
1140512345 16:75517275-75517297 CGCTGCTGCCCTTCGGTAGCTGG - Intergenic
1141538433 16:84699828-84699850 CGCTTCCGCCCGAGGGTCGCGGG + Intergenic
1141904277 16:87013293-87013315 CGCTGCTGCCCCACACACGCAGG + Intergenic
1143411932 17:6714137-6714159 CGCAGCTGCCCGCCCGACCCAGG + Intergenic
1144071029 17:11671385-11671407 CTCTGCTTCCTGATGGACGCTGG - Intronic
1148356396 17:46978596-46978618 CGCTGCTGCAAGAAGGACCCCGG - Exonic
1148581552 17:48747444-48747466 CGCTGCTTCCCGCTGGACGGCGG - Intergenic
1151235943 17:72719884-72719906 CGCTGCTGCCCGGCGGATGGGGG + Intronic
1151703135 17:75753847-75753869 CGCTGCTGGCCGACAGGCGCGGG - Exonic
1152691636 17:81720800-81720822 CCCAGGTGCCCGAGGGACGCAGG - Exonic
1152716393 17:81902663-81902685 AGCGGCTCCCCGACGGCCGCGGG + Exonic
1155216519 18:23648060-23648082 CGCTGCTGCCAGACAGAAACAGG + Intronic
1157374474 18:47150473-47150495 CGCTGCTGCCCGACGGACGCCGG + Exonic
1160498042 18:79386601-79386623 TGCTGCTGCCCCACAGCCGCAGG - Intergenic
1166558886 19:43719095-43719117 CTCTGAAGCCCGACGGCCGCTGG - Exonic
930405950 2:50955919-50955941 AGCTGCTGCCCGGCAGACTCTGG - Intronic
932345927 2:70995019-70995041 CGCTGCAGCCAGAGGGAGGCGGG + Exonic
938301038 2:130213490-130213512 CGCTGCTGCCCGCCGGCCTCCGG + Intergenic
938455682 2:131460977-131460999 TGCTGCTGCCCGCCGGCCTCCGG - Intergenic
940640770 2:156342426-156342448 CGGGGCTGCGCGCCGGACGCCGG - Intergenic
946418679 2:219552927-219552949 CGCTGCGGCCCCTCGGACGCCGG - Exonic
948896696 2:240931009-240931031 TGCTGCTGGCCGACAGCCGCAGG - Exonic
1176112344 20:63416351-63416373 CACTGTCGCCCGGCGGACGCTGG - Intronic
1178920638 21:36736055-36736077 CGTGGCTGCCCGAGGGATGCGGG + Intronic
1179797732 21:43795023-43795045 AGCTGCTGACAGACAGACGCTGG - Intronic
1182869528 22:33633846-33633868 CGCTGCTGCCTGTCTGACCCCGG - Intronic
1184328760 22:43812271-43812293 CGCTGTTGCCCGAGAGACGACGG + Exonic
954384748 3:50238172-50238194 TGCTGCTGCCCGACGGGCCTGGG + Intronic
966911435 3:184562321-184562343 TGCTGCTGCCCGCCGGCTGCCGG + Exonic
968739811 4:2321828-2321850 CGCTGCTGCCCGGCACAGGCAGG - Intronic
968965608 4:3767683-3767705 CGCTGCTGCGCGCCCGGCGCCGG - Exonic
971757135 4:30719834-30719856 CGCTGCAGCCCGAGGGGCGGCGG + Intergenic
992627629 5:78649060-78649082 CGCCGCTGCCCGGCGGGCTCAGG - Intronic
1002697481 5:181100644-181100666 CGCTGCTGCCCGGCGGAGGCGGG + Intergenic
1005020153 6:21410189-21410211 CGCTGCTCCCCGACGGGCCCTGG - Intergenic
1010414886 6:75601855-75601877 CGCTCCTCCCCCACGGGCGCTGG - Intronic
1026013399 7:66654264-66654286 CGCTGCTGCGCGCCGGAAGCCGG + Intronic
1029281556 7:99438941-99438963 CGCCGCCGCCCGAGGGATGCCGG - Intronic
1030884771 7:114923061-114923083 CGCTGCGGCCCCACGGGCCCGGG - Exonic
1036018055 8:4808198-4808220 CGCTGCTGACCGACTGGTGCTGG - Intronic
1049896280 9:114049-114071 TGCTACTGCCCGAGGGTCGCCGG + Intergenic
1059145539 9:111896633-111896655 TCCTGCTGCCCGCAGGACGCAGG - Intergenic
1059168788 9:112104651-112104673 AGCTGCTGCCCAAAGGACACTGG + Intronic
1061015967 9:127980904-127980926 CGCTGCTGCTCGAAGGGTGCCGG - Intergenic
1061272314 9:129550340-129550362 CGCGGCTTCCCGGCGGAGGCGGG - Intergenic
1062529983 9:136995560-136995582 CGCTGCTGCCCGCAGGTCCCCGG - Exonic
1187844127 X:23519010-23519032 CGCTGCTGCCACAAGGAAGCGGG + Intergenic
1197734807 X:129843092-129843114 GCCTGCAGCCCGACGGACGGAGG + Intronic