ID: 1157374883

View in Genome Browser
Species Human (GRCh38)
Location 18:47153369-47153391
Sequence CCTGCTTTAGGGAGGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 466
Summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 412}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157374883_1157374892 17 Left 1157374883 18:47153369-47153391 CCTCCCACCCTCCCTAAAGCAGG 0: 1
1: 0
2: 3
3: 50
4: 412
Right 1157374892 18:47153409-47153431 TTTTTACTTTTTTAACTTTTAGG 0: 1
1: 5
2: 94
3: 755
4: 5041
1157374883_1157374894 19 Left 1157374883 18:47153369-47153391 CCTCCCACCCTCCCTAAAGCAGG 0: 1
1: 0
2: 3
3: 50
4: 412
Right 1157374894 18:47153411-47153433 TTTACTTTTTTAACTTTTAGGGG 0: 1
1: 2
2: 18
3: 210
4: 1838
1157374883_1157374893 18 Left 1157374883 18:47153369-47153391 CCTCCCACCCTCCCTAAAGCAGG 0: 1
1: 0
2: 3
3: 50
4: 412
Right 1157374893 18:47153410-47153432 TTTTACTTTTTTAACTTTTAGGG 0: 1
1: 1
2: 41
3: 424
4: 3181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157374883 Original CRISPR CCTGCTTTAGGGAGGGTGGG AGG (reversed) Intronic
900482547 1:2906181-2906203 GCTGCTTCAGGGAGCGAGGGTGG + Intergenic
900749160 1:4383361-4383383 CCTGCATCAGGGACAGTGGGAGG + Intergenic
901242533 1:7703988-7704010 CCGGCTTTGGGGAGGGGGTGCGG - Intronic
901303933 1:8218612-8218634 CCTCCTTTATGGAAGTTGGGTGG - Intergenic
902177281 1:14660109-14660131 CCTGCTTCAGTGGGGCTGGGAGG + Intronic
902375309 1:16027568-16027590 CCTCCTTCAGGGAGGATGGAAGG + Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
902939923 1:19793696-19793718 ACTGCTGAAGCGAGGGTGGGAGG - Intronic
903342345 1:22662295-22662317 CCTGCTTCAGGGAGGAGGTGTGG - Intergenic
904209471 1:28877146-28877168 GCTGCTTTGGGGAGTGGGGGCGG + Intergenic
904401410 1:30259101-30259123 CCTGCTGAAGTGGGGGTGGGAGG - Intergenic
904454103 1:30636575-30636597 GCTGCTGCAGGGAGAGTGGGTGG + Intergenic
905182226 1:36174728-36174750 CCTGGGAGAGGGAGGGTGGGGGG - Intronic
905863370 1:41364414-41364436 CCTGCTGGCGGGGGGGTGGGGGG + Intronic
906809212 1:48809117-48809139 CCTACTTTAGGGAAGGAGGAGGG + Intronic
906810951 1:48826472-48826494 CCTGCTTTTGGTTGGGTGTGGGG - Intronic
907308681 1:53527450-53527472 CCTGCTTCAGAGAGCGAGGGAGG - Intronic
907338132 1:53713966-53713988 CCAGCTTTAGGGTGTGTGGCTGG + Intronic
909392412 1:75132597-75132619 CCTGATTAGGCGAGGGTGGGTGG + Intronic
910352794 1:86318793-86318815 CCTGGTCTAGAGATGGTGGGGGG + Intergenic
911044496 1:93617376-93617398 GCTGCTTTGGGGAGGGTTTGGGG - Intronic
911090155 1:94011426-94011448 CCTGCTGAAGAGAGGGGGGGTGG - Intronic
912361579 1:109100190-109100212 GCTGTTTTAGGGAGGGAGAGCGG + Intergenic
914957682 1:152178994-152179016 TCTGTTTTTGGGGGGGTGGGAGG - Intergenic
915305645 1:154975918-154975940 CCTGCTTGAGGGAGGAGGGTGGG + Intronic
915565654 1:156711250-156711272 CCTGCTATAAGGAGGGGTGGGGG - Intergenic
916345580 1:163787545-163787567 CCTGCTTAAGGCAGAGTGGGTGG + Intergenic
917213601 1:172655963-172655985 CTTGCTTTACGGGGGTTGGGAGG - Intergenic
917300287 1:173566393-173566415 CATGATTTAGGTAGGGTAGGTGG + Intronic
918892577 1:190294955-190294977 TCTGCTTGAGGGAAAGTGGGAGG - Intronic
918963348 1:191307211-191307233 GCTGCTTAAGGGAGGGTGCAGGG - Intergenic
918981742 1:191570369-191570391 CCTACTTGAGGGTGGGAGGGTGG + Intergenic
919727888 1:200895527-200895549 CCTGTGTTAGGGAGGGGGTGGGG + Intronic
919787429 1:201268713-201268735 GCTGCTGCAGGGAGGGAGGGCGG + Intergenic
920915229 1:210253268-210253290 CCTGCTGTGAGAAGGGTGGGTGG - Intergenic
922801030 1:228364881-228364903 CCTGCCACAGGCAGGGTGGGTGG - Intronic
1063459084 10:6204002-6204024 CCGGCTTTGGGGAGGGTCGGTGG + Intronic
1063842996 10:10092658-10092680 CCTTTTTGAGGGAGGGTGTGTGG + Intergenic
1064026948 10:11856508-11856530 GCTGCTTTTGTGAGGGTGGCTGG + Intronic
1064894381 10:20217555-20217577 CCTTCTGTAGGGAGGCTGGTGGG - Exonic
1065959989 10:30726488-30726510 CCTGCTTTAGGGAGGGCCTTAGG + Intergenic
1066283320 10:33939813-33939835 CCTGCTGTGGGGAGGATGAGGGG - Intergenic
1067077388 10:43196016-43196038 CCTGCTTTGGGGAGGGGGAGGGG - Exonic
1067131982 10:43573786-43573808 CCTGATGGAGGGAGTGTGGGTGG - Intronic
1067945550 10:50686101-50686123 CCTGCTTTAGGGAGGCTTCTTGG + Intergenic
1069678435 10:70266363-70266385 ACTGCTGTTGGGAGGCTGGGAGG + Exonic
1070848494 10:79543279-79543301 CCTGCATTAGGGTGGTTTGGAGG + Intergenic
1070867061 10:79712974-79712996 CCTGCTTTAGGGAGGCTTCTTGG + Intronic
1070880851 10:79851095-79851117 CCTGCTTTAGGGAGGCTTCTTGG + Intergenic
1070925291 10:80216894-80216916 CCTGCATTAGGGTGGTTTGGAGG - Intergenic
1070949154 10:80417074-80417096 CCTGGTTTAGGAAGGGGAGGGGG + Intronic
1071633975 10:87235197-87235219 CCTGCTTTAGGGAGGCTTCTTGG + Intronic
1071647423 10:87367414-87367436 CCTGCTTTAGGGAGGCTTCTTGG + Intronic
1072305163 10:94100314-94100336 CCTGATTTAGGGAGGGTGAGGGG - Intronic
1073212210 10:101814022-101814044 ACTGCTTTAGAAAGGGTGAGGGG + Intronic
1073321868 10:102620504-102620526 CCTGCTTTATGGAGGATCTGGGG + Intronic
1073820234 10:107253777-107253799 GCTGCATTAGGGAAGGTGGAGGG - Intergenic
1074214502 10:111370950-111370972 CCTACTTGAGGGTGGGTGGTAGG - Intergenic
1074422439 10:113321165-113321187 TCTCCTTTTGGGAGGATGGGCGG + Intergenic
1075614265 10:123880148-123880170 CCCTGTTCAGGGAGGGTGGGTGG - Intronic
1075795123 10:125114790-125114812 TCTGCATTTGGGTGGGTGGGTGG - Intronic
1075946852 10:126440645-126440667 CCTGCTTCAGTGAAGGTGGCAGG - Intronic
1076000371 10:126908118-126908140 CCCCCATCAGGGAGGGTGGGAGG + Intronic
1077213528 11:1384364-1384386 CCCGCCTTTGGGTGGGTGGGTGG - Intergenic
1077684161 11:4275208-4275230 CCTGTTGTGGGGCGGGTGGGGGG + Intergenic
1078115867 11:8449625-8449647 CCTGTTGTGGGGTGGGTGGGGGG + Intronic
1078436375 11:11328991-11329013 CCTGCCTAAGGGATGGTGGGGGG - Intronic
1079327197 11:19504474-19504496 GCTGCTTTGGGGAGGGAGGGAGG + Intronic
1079839675 11:25381309-25381331 CCTGTTTTAGGGTGGGAGGAGGG - Intergenic
1080664372 11:34322791-34322813 CCAGCTACTGGGAGGGTGGGGGG - Intronic
1081669863 11:44936928-44936950 CCCGCTTGGGAGAGGGTGGGGGG + Intronic
1083303483 11:61750995-61751017 ACTGCTTTAGGTAGGCTGGTTGG + Intergenic
1083762518 11:64826469-64826491 CCTGCATTAGGGAGGTTGCAGGG + Exonic
1084010998 11:66348204-66348226 CCTGTTTTATAGAGGTTGGGGGG + Intronic
1084346869 11:68558168-68558190 CCTTCTTTAGTGAGGGTGAAAGG + Intronic
1085697140 11:78714690-78714712 CCAGGTGTAGGGAGGATGGGAGG - Intronic
1086244254 11:84732788-84732810 CCTGTTGTGGGGTGGGTGGGGGG - Intronic
1088259359 11:107929173-107929195 CCTGCTTGGAGGAGGGTGGTCGG - Intronic
1089067797 11:115675073-115675095 CCTGCAGAGGGGAGGGTGGGTGG + Intergenic
1089577268 11:119454016-119454038 CTTCCTTCAGGGAGGGTGGGTGG + Intergenic
1089786015 11:120907805-120907827 GCTGGCTTAGGGAGGATGGGTGG + Intronic
1091660653 12:2380820-2380842 CCTGCTTGGGAGTGGGTGGGGGG + Intronic
1091727386 12:2855404-2855426 CCCACGTTTGGGAGGGTGGGAGG + Intronic
1091787517 12:3252015-3252037 CCTGCGTGAGTGAGGGTGAGGGG + Intronic
1092575843 12:9782000-9782022 CTTGGTTTAGGGTGGGCGGGTGG + Intergenic
1093637591 12:21489865-21489887 CCTCCTTTAGGGAGAGAGGAGGG + Intronic
1095464435 12:42475842-42475864 CCAGCATTTGGGAGGCTGGGGGG + Intronic
1096718195 12:53503359-53503381 CCTGGGTTAGGGAGGGAGAGGGG + Intronic
1098785255 12:74745298-74745320 CCTGCTTGAGGGAGGAGGGTAGG - Intergenic
1100179870 12:92073654-92073676 CCTACTTGAGGGTGGGGGGGTGG - Intronic
1100247043 12:92768857-92768879 TCTGTTTTAACGAGGGTGGGAGG - Intronic
1101353061 12:103950597-103950619 CCTGCCTTAGGGAGTATGGATGG + Exonic
1103019561 12:117523044-117523066 CCTGATTTAAGGAGGCTTGGAGG + Intronic
1104906012 12:132213948-132213970 CATGCTGCAGGGAGGGTGTGCGG - Intronic
1107275349 13:38671969-38671991 CTTTCTTTATGGAGGGTGGATGG - Intergenic
1107829138 13:44358812-44358834 CCTGCTTTAGGTAGCATGGAGGG + Intergenic
1108883170 13:55146375-55146397 CCTGCTTCAGGGAGGAAGGCTGG + Intergenic
1110406731 13:75159308-75159330 CCTGCTTGAGGGAGGAGGGTAGG + Intergenic
1110782018 13:79477683-79477705 CCTGCTTCTGGGAAGGTGGGAGG + Intergenic
1111137459 13:84067005-84067027 CCTGATTTAGGGAGGATGAGAGG - Intergenic
1112684309 13:101805730-101805752 CCTGCTTGTGGGAAGGGGGGTGG - Intronic
1112736289 13:102423106-102423128 CCTACTTGAGGGAGGACGGGGGG + Intergenic
1113122273 13:106936217-106936239 CCTACTTGAGGCAGGGAGGGTGG + Intergenic
1113992482 14:16038378-16038400 CCTACTTGAGGGAGGAGGGGTGG + Intergenic
1114963090 14:27919616-27919638 CCTGTTTTAGGGTGGGGGGAGGG - Intergenic
1115275541 14:31604697-31604719 CCTTTTTTTGGGAGGGTGGGGGG + Intronic
1115668586 14:35582703-35582725 CTTGCTTTATGGAGGGGGAGGGG + Intronic
1118216808 14:63816526-63816548 CCTGCTTCAGGGAAGAAGGGTGG - Intergenic
1118706377 14:68484248-68484270 TTTGCTTTAGGGAGAGTGAGTGG - Intronic
1119182625 14:72614911-72614933 CCTGGGGAAGGGAGGGTGGGAGG - Intergenic
1120067532 14:80060965-80060987 CGTGGTTTGGGGTGGGTGGGTGG + Intergenic
1120891146 14:89492339-89492361 CCATCTTTGGGGTGGGTGGGAGG - Intronic
1121173147 14:91870997-91871019 CCTGCTTCAGGGTGGGAGGCAGG + Intronic
1121250692 14:92497485-92497507 CCAGCTTTAAGGAGGGAGAGGGG - Exonic
1121425148 14:93845354-93845376 CATGCTTTGGGGAGTGTGGAGGG + Intergenic
1121675152 14:95746482-95746504 CCTGCCTAAGGGAGGATGAGAGG - Intergenic
1121986826 14:98515018-98515040 CCTGCTTTAGGGATGGGGTGGGG - Intergenic
1122699996 14:103581916-103581938 CCTGCTCTGTGGAGGGAGGGTGG + Intronic
1122931910 14:104937000-104937022 CCAGCTGGAGGGAGGGAGGGAGG + Exonic
1123568627 15:21578768-21578790 ACTTCTATAGGGAGGGAGGGAGG + Intergenic
1123604736 15:22014090-22014112 ACTTCTATAGGGAGGGAGGGAGG + Intergenic
1123755488 15:23394671-23394693 CCTGCAGGAGGAAGGGTGGGGGG + Intergenic
1124634687 15:31357526-31357548 CCTGCCTGGGGGAGGGAGGGTGG + Intronic
1125038928 15:35160603-35160625 CCTACTTGAGGGAGTGTGAGAGG - Intergenic
1125745330 15:41993766-41993788 CTTGCTTTTGGGAAGGTGGGAGG + Intronic
1126343064 15:47664974-47664996 CCTGCTTTAATGGAGGTGGGGGG + Intronic
1126724627 15:51619836-51619858 CCTGCTCTGGAGAGGGTGTGTGG - Intronic
1127304629 15:57692764-57692786 CCTGATTTAGGGATGGGAGGGGG + Intronic
1127477071 15:59344732-59344754 CCTGCTTGGGGAAAGGTGGGAGG - Intronic
1127950222 15:63798072-63798094 AGTGCTTTAGTGAGGTTGGGTGG - Intronic
1128783195 15:70376410-70376432 GCTGCTTCAGGAAGGGAGGGAGG + Intergenic
1129941151 15:79497655-79497677 CCTGCTTTAGAAAAGGTAGGAGG + Intergenic
1130282543 15:82531227-82531249 CATGCTTGGTGGAGGGTGGGAGG + Intergenic
1130678300 15:85973834-85973856 CCTGCCTTAGAGCTGGTGGGAGG + Intergenic
1131423579 15:92327226-92327248 GCTGCTGCATGGAGGGTGGGTGG - Intergenic
1131748089 15:95471798-95471820 CTGGCTTTAGGGAGGGAGAGAGG - Intergenic
1202976982 15_KI270727v1_random:305855-305877 ACTTCTATAGGGAGGGAGGGAGG + Intergenic
1132618713 16:854553-854575 CCTACTTCAGGGACCGTGGGTGG - Exonic
1132674714 16:1116934-1116956 CCTGAGTTGGGGAGGGTAGGCGG - Intergenic
1132731954 16:1367063-1367085 CCTGCTCTGGGCAGGGTGAGGGG - Intronic
1133102907 16:3489902-3489924 CCAGATTTTGGGTGGGTGGGGGG - Intergenic
1133222845 16:4326576-4326598 CCTGCTTGGGGGAGGGTGGCTGG - Intronic
1133224685 16:4335253-4335275 CCTGCTCCAGGGAGGGCGGGGGG - Exonic
1133452049 16:5911862-5911884 CGGGCTTTAGGGAGGGTATGAGG - Intergenic
1133809373 16:9149299-9149321 CCTTCTTTCGGGATGGTGGTGGG + Intergenic
1134766666 16:16764858-16764880 CCTGCTTGAGGGAGGAGGGTGGG - Intergenic
1135924921 16:26685203-26685225 CCTGTTGTAGGGTGGGGGGGGGG - Intergenic
1136026509 16:27472277-27472299 CGTGCTTTTGGCTGGGTGGGAGG - Intronic
1136530442 16:30864844-30864866 CCTTCTTAAGGGTGGGGGGGTGG - Intronic
1136911863 16:34150286-34150308 CCTACTTGAGGGAGGAGGGGTGG + Intergenic
1137603755 16:49773846-49773868 CCTGCTTGAGGGAGGCAAGGAGG + Intronic
1137729801 16:50681089-50681111 CCTGCTGGGGGCAGGGTGGGAGG - Intronic
1138200863 16:55087363-55087385 CCTGGGGTAGGGAGGGTGGGTGG + Intergenic
1138431739 16:56973254-56973276 CCAGCTTCAGGGAGATTGGGAGG - Intronic
1139543817 16:67639207-67639229 CCTGCTTGAGGGAGGCTGGGGGG + Intergenic
1139846618 16:69925700-69925722 ACTCCTTTAGCGATGGTGGGTGG - Intronic
1140317755 16:73915379-73915401 CCTCCTTTAGGAAGGGAGGCAGG + Intergenic
1140475836 16:75238876-75238898 CCTGCCTTTGGGAGGCTGGGAGG - Intronic
1141268605 16:82519362-82519384 CCTGCTTTGGGAAGGATTGGTGG + Intergenic
1141694270 16:85612372-85612394 CCTGGGTGAGGTAGGGTGGGGGG + Intronic
1142122976 16:88396415-88396437 CCTCCTGAAGGGAGGCTGGGAGG + Intergenic
1142198831 16:88751410-88751432 TCTGCTTCCGGGAGGGTGGAAGG - Intronic
1143077259 17:4354978-4355000 CCAGCTATAGGGAGGGAGGGAGG + Intronic
1144038611 17:11388977-11388999 TCTGCTTTCTGGAGGGTGGTGGG - Intronic
1144061177 17:11583996-11584018 GCTGCTGCAGGGAGGGTGTGGGG - Intergenic
1144140511 17:12342797-12342819 CCTGCTGGAGGGATGGGGGGAGG - Intergenic
1144438096 17:15259216-15259238 CCTGAGTCAGGGAGGGAGGGAGG + Intronic
1144495229 17:15741568-15741590 CCATCTGTAGGGAGGGAGGGTGG - Intronic
1144587315 17:16495043-16495065 CCTGCTTGAGGGTGTGTGGTTGG + Intergenic
1144666354 17:17104927-17104949 CTTGGTTTAGGGAGGGTGGTTGG + Intronic
1146736714 17:35244341-35244363 GATGCTTGAGGGAGGATGGGGGG + Intronic
1146906267 17:36620291-36620313 TCTGCCTTTGGGTGGGTGGGAGG + Intergenic
1147160775 17:38568344-38568366 CCTGCTCCTGGGAGGGTGGAGGG - Intronic
1147732998 17:42615492-42615514 CCTGATACAGTGAGGGTGGGAGG - Intergenic
1147819093 17:43231293-43231315 CCTGCTTTGTTGAGGGAGGGAGG - Intergenic
1147832376 17:43305998-43306020 CCTGCTTTGTTGAGGGAGGGAGG - Intergenic
1147999968 17:44381974-44381996 CCTGCTGAAGGAAGTGTGGGGGG - Intronic
1148389345 17:47259332-47259354 CTTTTTTTTGGGAGGGTGGGTGG + Intronic
1148463064 17:47849117-47849139 CCTGCTTGAGGGAAGGGGGTGGG - Intronic
1148555935 17:48578549-48578571 CCTGGTGTTGGGTGGGTGGGTGG - Exonic
1148852864 17:50563081-50563103 TCTGCTTTGGGGAAGGGGGGTGG + Intronic
1149695807 17:58615276-58615298 CCTGCTGCAGTGTGGGTGGGTGG + Exonic
1150185754 17:63179783-63179805 CCTTATTTTGGGAGGGTGAGGGG - Intronic
1150328352 17:64274646-64274668 CCTGGTTTCCGGAGGCTGGGAGG + Intergenic
1150649511 17:67000715-67000737 ACTGCTTTCGGGACGGGGGGAGG + Intronic
1151453225 17:74211962-74211984 CCTGCTGTAGGGAGAGGGGATGG - Intergenic
1151820013 17:76492185-76492207 CCTCCTTTAGGGTGGGGCGGGGG + Intronic
1151977914 17:77492761-77492783 CCTGCTGAAGGGTGGGTTGGGGG + Intronic
1152114832 17:78378981-78379003 CCTTCTTGAGGGAGGGTGGGCGG + Intronic
1152140795 17:78535195-78535217 CCTGCTTTGGGGACAGTGGGAGG + Intronic
1152519810 17:80848845-80848867 CTTCCTTGAGGGAGTGTGGGTGG - Intronic
1153045894 18:855557-855579 CCAGCACTTGGGAGGGTGGGTGG + Intergenic
1154201324 18:12302556-12302578 CCTGCTGCAGGGAGGCTGGTGGG - Intergenic
1155258279 18:24017108-24017130 CCTTTTTTAGAGATGGTGGGAGG + Intronic
1156344697 18:36246510-36246532 CCTGCTCTAGTGAAGGTGGCGGG + Intronic
1156699513 18:39808771-39808793 CCTACTTGAGGGGGGGAGGGTGG - Intergenic
1157113962 18:44845814-44845836 CCTGCCTGGGGGATGGTGGGAGG + Intronic
1157374883 18:47153369-47153391 CCTGCTTTAGGGAGGGTGGGAGG - Intronic
1158107875 18:53905682-53905704 GCTGCTTTAGGATGGGTTGGAGG + Intergenic
1158278814 18:55798627-55798649 CCTGTTGTGGGGTGGGTGGGGGG - Intergenic
1158586009 18:58735661-58735683 CCTATTTGAGGGTGGGTGGGTGG + Intronic
1158727216 18:59984459-59984481 CCTGCTTTTGGGGCGGGGGGGGG - Intergenic
1159116125 18:64114983-64115005 CCTGCATGGAGGAGGGTGGGAGG - Intergenic
1159923288 18:74246085-74246107 CTAGCTTGAGGGTGGGTGGGTGG - Intergenic
1160394984 18:78564324-78564346 CCTGCCTTAGGGAGGGGAGGAGG - Intergenic
1160913016 19:1483498-1483520 CCTGCTGGGGGGTGGGTGGGCGG + Intronic
1161209283 19:3057794-3057816 CCTGGATAACGGAGGGTGGGGGG - Intronic
1161707659 19:5829609-5829631 CCAGCTTTGCGGGGGGTGGGGGG - Intergenic
1161759813 19:6162864-6162886 CCTGGTGGGGGGAGGGTGGGCGG + Intronic
1162998154 19:14349542-14349564 CCTGCTGTGGGTAGAGTGGGTGG + Intergenic
1163283375 19:16330885-16330907 CCTGTTTCTGGGTGGGTGGGGGG + Intergenic
1163655914 19:18544643-18544665 CTTGCCTTGGGGAGGTTGGGAGG - Intergenic
1166877126 19:45904045-45904067 CCTGCTGTGTGGAGGGTGGGTGG + Intergenic
1168650061 19:58087033-58087055 CCTTCTCTAGGGCAGGTGGGAGG - Intronic
925079997 2:1056286-1056308 CGTGCTGTGGGGAGGGAGGGAGG + Intronic
925080034 2:1056385-1056407 CCCGCTGTGGGGAGGGAGGGAGG + Intronic
925080074 2:1056530-1056552 CCCGCTGTGGGGAGGGAGGGAGG + Intronic
925080097 2:1056602-1056624 CCCGCTGTGGGGAGGGAGGGAGG + Intronic
925080138 2:1056738-1056760 CCTGCTGTGGGGAGGGAGGGAGG + Intronic
925080196 2:1056947-1056969 CCCGCTGTGGGGAGGGAGGGAGG + Intronic
925382073 2:3435511-3435533 ACTGCTTTTGGGAGGTGGGGAGG - Intronic
925809241 2:7682725-7682747 CCTGCATGTGGGTGGGTGGGTGG + Intergenic
926136834 2:10342498-10342520 CCAGCCTGGGGGAGGGTGGGAGG + Intronic
926397943 2:12465005-12465027 CCTGCTATAAGAAGAGTGGGGGG + Intergenic
926663167 2:15491180-15491202 CCTGCTTCATGGAGGAAGGGTGG - Intronic
927156582 2:20224576-20224598 CCCGCGCTGGGGAGGGTGGGGGG - Intronic
927207523 2:20619457-20619479 CCTGCTTTGCTGTGGGTGGGAGG - Intronic
927650997 2:24913687-24913709 GCTGCCGTAGGGAGGGTGAGAGG - Intronic
927699422 2:25258475-25258497 CCTGCAGTAGGTAGGCTGGGGGG + Intronic
929438809 2:41949334-41949356 CCTGCTGTAGGCAGGGGGAGAGG + Intronic
929669115 2:43855048-43855070 CCTGCTTTCGGCAGGGTGCCTGG + Intronic
931762800 2:65432084-65432106 CCTGATTTGGGGAGGGGGGGCGG + Exonic
933708533 2:85308751-85308773 CCAGCTTTAGGAAAGGAGGGTGG + Intronic
935571137 2:104661135-104661157 CCTGCCTCTGGGAGGGTGGAGGG - Intergenic
935577651 2:104727576-104727598 CCTGTTTTATGGAGAGTAGGAGG + Intergenic
935802730 2:106714863-106714885 CATGCTTTATGGAGCCTGGGGGG - Intergenic
935833633 2:107026046-107026068 CAAGCTTCAGGGTGGGTGGGTGG - Intergenic
936383665 2:112010259-112010281 CCTGCTTTATGGTGGGTAAGTGG + Intronic
936530689 2:113275290-113275312 CTTGCATTGTGGAGGGTGGGGGG + Intronic
936849769 2:116881702-116881724 CCTGTGTTGGTGAGGGTGGGTGG + Intergenic
937200905 2:120204051-120204073 TCTGCTCTAGAGAGGGTGGAAGG + Intergenic
937561551 2:123230924-123230946 CCTGCTTTGGTGAAGGTGGTAGG + Intergenic
938218187 2:129541040-129541062 CCTGTTGTAGGGTGGGGGGGAGG + Intergenic
938241059 2:129742574-129742596 CCTGTGCTAGGGAGGCTGGGAGG - Intergenic
939081968 2:137673489-137673511 CCTGATTTAGTGAGTGAGGGAGG + Intronic
942053658 2:172163097-172163119 ACTGCTGCAGGGAGGGTGTGGGG - Intergenic
942984112 2:182119052-182119074 CCTGCTGTGGGGTGGGTGGTGGG - Intronic
943616782 2:190101502-190101524 GCTGCTCCAGGAAGGGTGGGAGG - Intronic
945974606 2:216260432-216260454 CCTGTTTTAGCAAGGGTGGTGGG + Intronic
946180673 2:217947162-217947184 CCTGCATTGGGGTGGGAGGGAGG - Intronic
946223560 2:218249629-218249651 TCTGCTATAGGGAGGGATGGGGG - Intronic
946710226 2:222497835-222497857 CCTACTTTAGAGAAGGTGGTTGG + Intronic
947095381 2:226561202-226561224 GCTGCTTTAGGGAGGCAGGTTGG - Intergenic
947962726 2:234253209-234253231 TCTGCATTAGGAAGGGTGGATGG + Intergenic
948599792 2:239101663-239101685 CCTGGTTCAGGGTGGCTGGGAGG + Intronic
948738588 2:240026982-240027004 CTTGGTTTAGGAAGGGGGGGGGG + Intergenic
1168856867 20:1014735-1014757 CCGGCTGCAGGGAGAGTGGGAGG + Intergenic
1169155205 20:3323737-3323759 CCTGCTCTGGGGAGGCTGAGTGG + Intronic
1169185559 20:3614124-3614146 CCTGTTTCTGGGAGGGTGGCGGG + Intronic
1169676814 20:8163734-8163756 CCTGCTTTAGACAGGGTGTGTGG + Intronic
1169847022 20:10005042-10005064 CCTGCCATGGGGAGGGTGAGGGG + Intronic
1170247355 20:14237691-14237713 CCTGTTTTGGGGTGGGGGGGAGG - Intronic
1170304232 20:14919976-14919998 CCTGCTGGGGGCAGGGTGGGAGG - Intronic
1171249981 20:23639482-23639504 CCAGCATTAGGGTGTGTGGGAGG + Intergenic
1171769367 20:29310768-29310790 CCTACTTGAGGGAGGAGGGGTGG - Intergenic
1172121629 20:32602259-32602281 GCTGTGTTATGGAGGGTGGGTGG - Intronic
1172460424 20:35114208-35114230 GCTGCTTTAGATAGGGTGGGTGG - Intergenic
1172808370 20:37629581-37629603 ACTGCTTTAAGGAGGCTGAGAGG + Intergenic
1173624912 20:44465732-44465754 CCTGCTTCAGGGAGGTGGTGTGG + Intergenic
1175202879 20:57290119-57290141 CCTGGTTTAGGGAGGGGGCTTGG + Intergenic
1175381595 20:58567777-58567799 CCTTCTTTAGAGAGGGGTGGGGG - Intergenic
1175497801 20:59426681-59426703 GCAGCTTTATGGAGGATGGGAGG + Intergenic
1176551895 21:8226769-8226791 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176552273 21:8231207-8231229 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176570804 21:8409768-8409790 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176571178 21:8413783-8413805 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176578712 21:8453915-8453937 TCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1176579092 21:8458345-8458367 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1178703353 21:34852704-34852726 CCTGCTTTAGGTGGGAGGGGAGG + Intronic
1179080494 21:38166325-38166347 CTGGCTTCAGGGAGGGTGAGGGG - Intronic
1179727241 21:43347353-43347375 CCTGCTTTCTGTAGGGTTGGGGG - Intergenic
1180314789 22:11269139-11269161 CCTACTTGAGGGAGGAGGGGTGG - Intergenic
1180340588 22:11614565-11614587 CCTACTTGAGGGAGGAGGGGTGG + Intergenic
1180791215 22:18576718-18576740 CCTGCTGTTGGGGGAGTGGGGGG + Intergenic
1181230523 22:21418596-21418618 CCTGCTGTTGGGGGAGTGGGGGG - Intronic
1181248127 22:21516273-21516295 CCTGCTGTTGGGGGAGTGGGGGG + Intergenic
1182287654 22:29257878-29257900 CATGCCTTAGGGAGCGTGGGAGG - Intronic
1182431608 22:30302176-30302198 CCTGCCTTAGGGAGGATGGTAGG + Intronic
1182462296 22:30491484-30491506 CCAGCTCTCGGGAGGGTGGGGGG - Intronic
1182552267 22:31106827-31106849 CCTGGTTGGGGGAGGATGGGAGG + Intronic
1182569512 22:31226025-31226047 CCAGCTGGAGGCAGGGTGGGGGG + Intronic
1182572265 22:31248313-31248335 CCTGAATGAGGGAGGGAGGGAGG - Intronic
1183204324 22:36408167-36408189 CCTGCTTGAGGGAGAGCAGGAGG - Intergenic
1184195384 22:42924141-42924163 CCAGCTTTAGGGAGCGGGGGAGG + Intronic
1184292594 22:43506026-43506048 CCTGGGTTGGGGTGGGTGGGAGG + Exonic
1184696078 22:46139824-46139846 CCTGAGTTAAGGCGGGTGGGGGG - Intergenic
1203256915 22_KI270733v1_random:143688-143710 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1203257279 22_KI270733v1_random:147981-148003 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
949773720 3:7607881-7607903 CCTACTTGGGGGAGGGTGAGAGG - Intronic
950230397 3:11271060-11271082 CTGCCTTTGGGGAGGGTGGGGGG + Intergenic
950575551 3:13830141-13830163 CCTGCTTGGGGGAGGGTGGCTGG - Intronic
950880811 3:16321396-16321418 GCTGCTTCAGGGAGTGGGGGTGG + Intronic
951206726 3:19933615-19933637 CCTCCTTTGGGCAGGGTGTGTGG - Exonic
953052053 3:39353462-39353484 CCTGCTGTAGGGTGGGAGGAGGG + Intergenic
953767597 3:45755645-45755667 CCAGCTTATTGGAGGGTGGGTGG + Exonic
954177573 3:48856720-48856742 GCTGCTCTAGGGAGGGTGTGTGG - Intergenic
954193586 3:48982644-48982666 CCTGCCTTTGGGAGTGTGGAGGG + Intronic
954222218 3:49161794-49161816 CCTGCTTTAGAGAGGGGGCTGGG - Intergenic
954274731 3:49534845-49534867 CCTGATTGAGGGTGGGTGGGTGG + Exonic
954478657 3:50775741-50775763 CTTGCTGGAGGGAGGGTGGAAGG - Intronic
955971815 3:64444754-64444776 CCTGCTTGGGGAAGGGTGCGCGG + Intronic
956854945 3:73266949-73266971 CCTACTTGAGGGTGGGGGGGTGG + Intergenic
958809821 3:98848123-98848145 GGGGCTTTTGGGAGGGTGGGAGG - Intronic
959847107 3:111046133-111046155 CTTGCTTCAGGGAAGGAGGGTGG - Intergenic
959847133 3:111046309-111046331 CTTGCTTCAGGGAAGGAGGGTGG - Intergenic
961372829 3:126441718-126441740 CCAGCTGTAGGCGGGGTGGGAGG - Intronic
961554796 3:127690460-127690482 GCTGCTGGAGGGAGGGTGGAGGG + Exonic
961734449 3:128992811-128992833 CCTGCTTTAGGGTTGTTGAGAGG + Intronic
962848639 3:139291229-139291251 CCTGGCTTAGGGAGTGAGGGAGG - Intronic
964433795 3:156631668-156631690 CCTGGTATAGGGTGGGTGGAGGG + Intergenic
965103687 3:164334117-164334139 CCTGGTTTAGGAAGGGGAGGGGG + Intergenic
965695022 3:171399344-171399366 CCTGCCTCTGGGAGGGAGGGAGG - Intronic
965867500 3:173222899-173222921 TCTGCTTTAGGGGAGGAGGGTGG + Intergenic
967688536 3:192445811-192445833 GCCACTTTAGGGAAGGTGGGAGG - Intronic
968881025 4:3300289-3300311 GGTGCTTTAGGCAGGGTGAGGGG + Intronic
969339844 4:6533326-6533348 CTTGTTTGAGGGAGGCTGGGAGG - Intronic
970035471 4:11730130-11730152 CCAACTATAAGGAGGGTGGGGGG + Intergenic
970945301 4:21683968-21683990 CCTGCTTGAGGGAGGAGGGTGGG + Intronic
971727417 4:30331479-30331501 CCGGCTCCAGCGAGGGTGGGAGG + Intergenic
973194765 4:47426944-47426966 CCTGCTCCAGAGAGTGTGGGAGG + Intergenic
975800926 4:78058324-78058346 AGTGCTTTTGGGTGGGTGGGTGG + Intronic
977454827 4:97246035-97246057 ACTGGTTTGGGGAGGGTGGCAGG - Intronic
978398232 4:108305284-108305306 CCTCCTTCAGGGAGGCAGGGAGG + Intergenic
979363798 4:119796258-119796280 CCTGCTTAAGAGAGAGTAGGAGG + Intergenic
980009734 4:127581616-127581638 CCTGCTTGAGGGAGGGTGCATGG + Intergenic
980120239 4:128720538-128720560 CCTCCTTCAGGGAGGGGGAGGGG + Intergenic
980244746 4:130224377-130224399 CCTGCTGGAAGGAGGGAGGGAGG + Intergenic
980342675 4:131570302-131570324 CCTGCCTTAGAGAGGAAGGGAGG - Intergenic
982166063 4:152614562-152614584 CCTGCCCTGGGGAGGGTGTGAGG - Intergenic
982251697 4:153413720-153413742 GCTGCACTGGGGAGGGTGGGAGG - Intronic
983488138 4:168355596-168355618 CCTGCTTTAGGTGGGGTAGATGG + Intergenic
985884176 5:2663632-2663654 CCTGATTTAGGAAGTGTGTGGGG - Intergenic
989377758 5:40782847-40782869 CCTTCTTTTGGGTGGTTGGGGGG - Intronic
990207716 5:53448001-53448023 AGTGCTTTACAGAGGGTGGGTGG + Intergenic
990431148 5:55736911-55736933 CCTGCTTTTGGGGTGGGGGGTGG + Intronic
990567344 5:57042767-57042789 CCTGCATTAGGAAGGCTGGCAGG - Intergenic
990611321 5:57459607-57459629 CCTGCTTGAGGGAGGATAGTAGG + Intergenic
991590807 5:68249756-68249778 CCTGCTTGTGGTGGGGTGGGGGG + Intronic
992227725 5:74635246-74635268 CCTGCTTTAGAGAGACTGAGGGG + Exonic
993614831 5:90098047-90098069 GCTACTGTGGGGAGGGTGGGAGG + Intergenic
994995946 5:107063295-107063317 CCTGCTTCAGGGAAGAGGGGTGG + Intergenic
995523301 5:113031152-113031174 CCTGCTTTTGGGAGAGAGGATGG + Intronic
995849442 5:116529833-116529855 GCTGCTTGAGGGCGGGTTGGGGG + Intronic
996024046 5:118623596-118623618 CCTGTTTTAGGGTGGGGGAGTGG + Intergenic
996241442 5:121208113-121208135 CCTGCTGTCGGGTGGGGGGGAGG - Intergenic
996738007 5:126775342-126775364 CTTGCTTTTTGGGGGGTGGGGGG - Intergenic
997803390 5:136889222-136889244 ACTGGTTTAGTGGGGGTGGGGGG - Intergenic
997923741 5:138008766-138008788 CCTGCTTTAGGTAGTTTGGATGG - Intronic
998541415 5:142985654-142985676 CCTGTTGTAGGGTGGGGGGGAGG - Intronic
999453541 5:151696489-151696511 GCTGCTCTGGGGAGGGTCGGAGG + Intergenic
1000128561 5:158272069-158272091 GTTGCTTTAGAGAGGGTGGCAGG - Intergenic
1001589800 5:172857591-172857613 AATGCTTAAGGGTGGGTGGGGGG - Intronic
1001809720 5:174618503-174618525 CATGGTTCAGGGAGGGTGGGTGG - Intergenic
1002064553 5:176645555-176645577 TCTGCTAGAGGGAAGGTGGGTGG + Intronic
1002642387 5:180636411-180636433 ACTGCTGTAGGGAGGGCAGGTGG - Intronic
1003157486 6:3608739-3608761 CCTGCTTTAGTGTGAGTGGAAGG - Intergenic
1004117278 6:12781768-12781790 CCTCCTGGAGGGAGGGAGGGTGG + Intronic
1007323013 6:41040732-41040754 CCCTCTTTAGGGCGGCTGGGAGG + Intronic
1008880539 6:56376830-56376852 CCTTGTTTGGGGGGGGTGGGGGG - Intronic
1010126701 6:72440819-72440841 CCTACTTTGTGGGGGGTGGGGGG - Intergenic
1010188889 6:73174637-73174659 GCAGCTTCAGGGAGGGTGGGAGG - Intronic
1010782519 6:79960073-79960095 CCTGTTGTGGGGTGGGTGGGGGG + Intergenic
1014410040 6:121103577-121103599 CCTGTTGTAGGGAGGGGGGAGGG + Intronic
1014529830 6:122545632-122545654 CCTTCTTTGTGGAGGGTGGCAGG + Intronic
1015565601 6:134567335-134567357 CCTGCTTTAGTAAGGATGGAAGG + Intergenic
1015957620 6:138614918-138614940 CCTGGGGTAGGGTGGGTGGGTGG - Intronic
1017220067 6:151955872-151955894 CCTACGTGAGGGAGGGTGAGAGG - Intronic
1018063163 6:160106167-160106189 CATGCTGGAGGGAGGCTGGGCGG + Exonic
1019499617 7:1358457-1358479 ACGGCTTTGGGGTGGGTGGGAGG - Intergenic
1019544151 7:1565155-1565177 CCTGCCCGAGGGAGGTTGGGTGG + Intergenic
1019603549 7:1897384-1897406 GCTGCTTCAGGAAGGGTGGAGGG - Intronic
1019894226 7:3971238-3971260 GCTGATTTAGGAGGGGTGGGTGG + Intronic
1020780380 7:12510164-12510186 GCTAATTTTGGGAGGGTGGGGGG + Intergenic
1021613763 7:22481986-22482008 CCTGCTCTGGGGAGACTGGGTGG + Intronic
1021898026 7:25255985-25256007 CCTTCTATAGGGAGTGGGGGTGG - Intergenic
1021941609 7:25684751-25684773 GCTCCTCTAGGGAGGGTGAGAGG + Intergenic
1022477876 7:30723594-30723616 CATCCTTTAGGGATGGTGGCAGG + Intronic
1022847712 7:34227462-34227484 CATGTTATGGGGAGGGTGGGTGG - Intergenic
1023849195 7:44140822-44140844 CCAGCTCTAGGGAAGGTGGGAGG + Intronic
1024524422 7:50336375-50336397 CCTTCTTTAGGAAGGGGTGGAGG + Intronic
1024966020 7:55022409-55022431 CCTCCTTTGAGGAGGGAGGGTGG - Intronic
1025010618 7:55394739-55394761 GCTGATTCTGGGAGGGTGGGTGG - Intronic
1025193392 7:56913424-56913446 CCAGCTATGGGGGGGGTGGGGGG - Intergenic
1025678550 7:63663505-63663527 CCAGCTATGGGGGGGGTGGGGGG + Intergenic
1026739093 7:72967239-72967261 CCTTTTTTGGGGGGGGTGGGGGG + Intronic
1026821085 7:73549499-73549521 CCTTTTTTAGAGATGGTGGGGGG - Intronic
1027104638 7:75397834-75397856 CCTTTTTTGGGGGGGGTGGGGGG - Intronic
1029131368 7:98333732-98333754 CTTAGTTTGGGGAGGGTGGGCGG - Intronic
1029915219 7:104201844-104201866 AGTGCTTTAGGATGGGTGGGAGG + Intronic
1030289347 7:107856907-107856929 CCTGCTCCAGGGAAGGTGGTTGG - Intergenic
1031131583 7:117839098-117839120 CCCACTTTAGGTAGGGTGGTTGG - Intronic
1031793648 7:126142571-126142593 CCTGCTTCAAGGAAGATGGGTGG + Intergenic
1032484787 7:132277306-132277328 ACTGATTTAGGGAAGGTGGGAGG - Intronic
1034257991 7:149734850-149734872 CCTGCTTTGGGCTGGGAGGGAGG + Intergenic
1034824622 7:154250388-154250410 CCTGCATTTGGGAGGGCGTGTGG + Intronic
1034845366 7:154439766-154439788 GCTGCTTTAGCAAGGGTGGTGGG + Intronic
1036072497 8:5456794-5456816 CCTGCTTCTGGCAGGGTGGCAGG - Intergenic
1036740315 8:11355202-11355224 CTGCCTGTAGGGAGGGTGGGGGG + Intergenic
1037020595 8:13965769-13965791 CTTGGTTTTGGGAGGGAGGGAGG - Intergenic
1037628976 8:20635150-20635172 CCTCTTTTAGGGACTGTGGGTGG + Intergenic
1038013540 8:23494098-23494120 CCAGCAGCAGGGAGGGTGGGTGG - Intergenic
1038336164 8:26647370-26647392 CCAGGGTTAGGGAGGGTGGAGGG - Intronic
1038406807 8:27328147-27328169 TCTTCTTGAGGGATGGTGGGTGG + Intronic
1038916307 8:32027473-32027495 CCTAGATTAGGGAGGGAGGGAGG - Intronic
1038945854 8:32359065-32359087 CCTGCTAGAGAGATGGTGGGTGG + Intronic
1040385541 8:46912770-46912792 GCTGTTTTCGGGAGAGTGGGTGG - Intergenic
1041889183 8:62849602-62849624 CCTGTTGTGGGGTGGGTGGGGGG - Intronic
1045117822 8:99002991-99003013 GCTGTTGCAGGGAGGGTGGGAGG + Intergenic
1045415228 8:101959855-101959877 TCTGCAGTAGGGAGGGTGGGTGG - Intronic
1045506268 8:102780960-102780982 ACAGCCTCAGGGAGGGTGGGAGG + Intergenic
1046024685 8:108708028-108708050 CCTACTTTAGGGTGGATGGTGGG - Intronic
1048214184 8:132480666-132480688 CCTGCTTTTGGGGGGGGGTGGGG - Exonic
1048818312 8:138355008-138355030 CCTGCTGTAGGGTGGGAGGAAGG - Intronic
1051721323 9:20040385-20040407 CCAGCTTTAGGGTGGGAAGGAGG + Intergenic
1055225905 9:73994898-73994920 CCTTTTTTTTGGAGGGTGGGGGG + Intergenic
1055751697 9:79513771-79513793 TCTGCTTTTGGTGGGGTGGGGGG + Intergenic
1056254520 9:84785217-84785239 CCTGTGTGATGGAGGGTGGGAGG - Intronic
1056292735 9:85160343-85160365 GCTGCTGCAGGGAGGGTGGGAGG - Intergenic
1056292875 9:85161314-85161336 GCTGCTGCAGGGAGGGTGGGAGG - Intergenic
1056927758 9:90849103-90849125 CCTGCTTTGGGCAAGTTGGGGGG + Intronic
1057353377 9:94317954-94317976 CCTGCTTTAGGGAGGCTTCTCGG - Intergenic
1057422295 9:94922115-94922137 GCAGCTGTGGGGAGGGTGGGTGG - Intronic
1057519742 9:95751653-95751675 GCTGCATGAGGGAGGGAGGGAGG + Intergenic
1057654374 9:96939638-96939660 CCTGCTTTAGGGAGGCTTCTCGG + Intronic
1057664580 9:97034905-97034927 CCTCCCTTATGGAGGGTGGTAGG - Intronic
1057857721 9:98614772-98614794 GATGCTTTGGGGAGGGAGGGAGG + Intronic
1059801959 9:117759053-117759075 CCTGTTGTTGGGTGGGTGGGGGG - Intergenic
1060205924 9:121682855-121682877 CCTCCTATAGGGAGAGTTGGGGG + Intronic
1061364984 9:130168002-130168024 ACTGCTTGGGGAAGGGTGGGGGG - Intergenic
1061679967 9:132238131-132238153 CTTGCTGGAGGGTGGGTGGGTGG + Intronic
1062021211 9:134320226-134320248 TCTGCTGGACGGAGGGTGGGGGG - Intronic
1062500760 9:136851084-136851106 CCTGCTTTAGTTAGGGTCTGGGG - Intronic
1203473073 Un_GL000220v1:125373-125395 TCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1203473453 Un_GL000220v1:129803-129825 CCTGCTTGAGGGAGGAGGGGTGG + Intergenic
1203363096 Un_KI270442v1:235152-235174 CCTACTTGAGGGAGGAGGGGTGG - Intergenic
1185952472 X:4451946-4451968 CCTGCTTCAGTGAGGGAGGCTGG + Intergenic
1186219679 X:7336242-7336264 CCTCCTTTGGGGCGGGTGGGGGG - Intronic
1186229144 X:7434456-7434478 CCTCGTTTAGGGAGGGTAGAGGG - Intergenic
1186334505 X:8572282-8572304 CCTGCTTGGGGGAGGTGGGGAGG - Intronic
1188137225 X:26504945-26504967 CCTGCTTCAGGTAGAGGGGGTGG - Intergenic
1188270599 X:28135408-28135430 CAGGGTTTAGGGATGGTGGGAGG - Intergenic
1189017897 X:37303217-37303239 CCTGTTTTAGAGAGGATTGGGGG + Intergenic
1189498359 X:41529948-41529970 CTTGCTTTAGGGATGGTTAGGGG + Intronic
1190054457 X:47173715-47173737 CCTGCAAGAGGGAGGGAGGGAGG - Intronic
1190416167 X:50182614-50182636 CCCACTTTACAGAGGGTGGGTGG - Intergenic
1190526532 X:51333737-51333759 CCTGCTTTTGGGCGGGGGGGGGG + Intronic
1190726291 X:53192871-53192893 CCTGCTTCTTGGGGGGTGGGCGG - Exonic
1192146331 X:68685439-68685461 CCTGACTTGGGGATGGTGGGGGG - Intronic
1193219720 X:78910125-78910147 GCTGCTTCAGGGGGGATGGGAGG + Intergenic
1193575188 X:83186684-83186706 GCTGCTTCGGGGAGGGTAGGGGG - Intergenic
1194264005 X:91733633-91733655 CCAGCTTTGGGGAGTCTGGGAGG - Intergenic
1195778990 X:108439907-108439929 CCGGCTTTGGGGAGGGGAGGGGG + Exonic
1198457924 X:136835658-136835680 GCTGCTTGAGGGAGGGAGGGAGG + Intergenic
1199310691 X:146316470-146316492 CCTACTTGAGGGAGGTTAGGAGG + Intergenic
1200485973 Y:3768625-3768647 TCTGCTTCAGGGAAGATGGGTGG - Intergenic
1201075230 Y:10181636-10181658 CCTACTTGAGGGAGGAAGGGTGG + Intergenic