ID: 1157375207

View in Genome Browser
Species Human (GRCh38)
Location 18:47157445-47157467
Sequence CGGTTCTTACAGATCGAATA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 34}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157375207 Original CRISPR CGGTTCTTACAGATCGAATA AGG Exonic
911064596 1:93776938-93776960 GGGTTCTTACAGATGGAATCAGG + Intronic
919555257 1:199045125-199045147 TAGTTCTTACAGACTGAATAGGG + Intergenic
1078738487 11:14043939-14043961 AGGTTCTTACAAGTCAAATAAGG + Intronic
1102327530 12:112000802-112000824 CAGTTGTTACAGATTGAATACGG + Intronic
1105748097 13:23395744-23395766 TGTTTCTGACAGATAGAATAAGG - Intronic
1117532789 14:56675578-56675600 AGGTTCCTACAGATGGTATATGG - Intronic
1119721037 14:76890652-76890674 CACTTCTAACAGATTGAATATGG - Intergenic
1122255006 14:100470172-100470194 AGGTTCTTGCAGATGGAACAAGG + Intronic
1124158149 15:27246186-27246208 AGGTTCCTGGAGATCGAATATGG - Intronic
1142589055 17:993208-993230 CTGGTCTGACAGATGGAATAAGG - Intergenic
1153672256 18:7423009-7423031 CTGTTCTTTCAGATAAAATATGG - Intergenic
1157375207 18:47157445-47157467 CGGTTCTTACAGATCGAATAAGG + Exonic
1157842176 18:50968420-50968442 CGGTTCTTTCAGCTCTAAGATGG + Intronic
1159378277 18:67622570-67622592 GGGTTCTCATAGATAGAATAAGG - Intergenic
1165145189 19:33726043-33726065 CGGTTCTTACAGGAGGAAGAGGG - Intronic
929654900 2:43721041-43721063 AGGTTCTTACAGACCAGATAAGG + Intronic
931583426 2:63801920-63801942 TGCTACTTACAGATAGAATATGG - Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
940437142 2:153668792-153668814 AGCTTCTTACAGAACGGATAAGG + Intergenic
963295444 3:143541142-143541164 CGATTCTAACAAATAGAATATGG + Intronic
969528129 4:7714515-7714537 TGGTTCTAACAGATGGAATGAGG - Intronic
995720786 5:115130089-115130111 CAGTTCTTTTAGATGGAATAAGG - Intronic
996819589 5:127611822-127611844 AGGTTATTGCAGATTGAATATGG - Intergenic
1006875861 6:37295646-37295668 AGGTTCTTACAGATCAAATAAGG + Intronic
1014756307 6:125305047-125305069 GGGTTCTTAAAGATGGAAAAGGG + Intergenic
1021603497 7:22388170-22388192 TGGTTTTTACAGGTCGTATAAGG + Intergenic
1024801035 7:53078751-53078773 CTGTTTTTACAGATTGAATAGGG - Intergenic
1028125885 7:87113092-87113114 TGCTTCTTACAAATAGAATATGG + Intergenic
1033705167 7:143879571-143879593 CCGTTCTTACAGAACTAAGAAGG + Intronic
1033992546 7:147306066-147306088 GGGTTCTTACAGATACAATCAGG - Intronic
1048953560 8:139515476-139515498 CTGTTCTTACAGCACTAATAAGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1060250046 9:121979010-121979032 TGTTTCTAACAGATAGAATAGGG + Intronic
1197680426 X:129377086-129377108 CGGTTATTTAAGATCGGATAGGG + Intergenic
1197705006 X:129628697-129628719 CGCTTCTAACAAATAGAATATGG - Intergenic