ID: 1157380256

View in Genome Browser
Species Human (GRCh38)
Location 18:47208073-47208095
Sequence TCTTATCTATAAAATGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157380256_1157380258 29 Left 1157380256 18:47208073-47208095 CCATCCACATTTTATAGATAAGA No data
Right 1157380258 18:47208125-47208147 CTCAAGATAACACAGAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157380256 Original CRISPR TCTTATCTATAAAATGTGGA TGG (reversed) Intergenic
No off target data available for this crispr