ID: 1157380384

View in Genome Browser
Species Human (GRCh38)
Location 18:47209574-47209596
Sequence GGATGGAAACAAAATCAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157380379_1157380384 13 Left 1157380379 18:47209538-47209560 CCAGGGTCTACTTAGAGAAATCC No data
Right 1157380384 18:47209574-47209596 GGATGGAAACAAAATCAGCATGG No data
1157380383_1157380384 -9 Left 1157380383 18:47209560-47209582 CCTGTTGTCTGCAAGGATGGAAA No data
Right 1157380384 18:47209574-47209596 GGATGGAAACAAAATCAGCATGG No data
1157380382_1157380384 -8 Left 1157380382 18:47209559-47209581 CCCTGTTGTCTGCAAGGATGGAA No data
Right 1157380384 18:47209574-47209596 GGATGGAAACAAAATCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157380384 Original CRISPR GGATGGAAACAAAATCAGCA TGG Intergenic
No off target data available for this crispr