ID: 1157381939

View in Genome Browser
Species Human (GRCh38)
Location 18:47226445-47226467
Sequence GAGGGGCCCCACCATTATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 84}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157381939 Original CRISPR GAGGGGCCCCACCATTATCA AGG (reversed) Intronic
900845610 1:5097979-5098001 GGGTGGTCCCACTATTATCAAGG + Intergenic
900885686 1:5413814-5413836 GAGTGGCACCCCCATTATCATGG + Intergenic
901160576 1:7173936-7173958 GAGGGGCCCAGCCTTTACCATGG + Intronic
902122646 1:14180555-14180577 GAGGTGCCTCATCAATATCATGG - Intergenic
912951255 1:114122145-114122167 AAGGTGCTGCACCATTATCAGGG + Intronic
913478622 1:119263119-119263141 GAAGGTCCCCACCAAAATCAGGG - Intergenic
915122870 1:153642444-153642466 GTAGGGCCCGACAATTATCAGGG - Intronic
920440953 1:205980024-205980046 TGGGGGCACCACCATCATCAAGG - Intronic
924414792 1:243849142-243849164 GAAGGGCCCCACCGGCATCATGG + Intronic
1064955248 10:20901041-20901063 GAGGGGCTCCACTATTTTTAAGG - Intronic
1069710988 10:70488668-70488690 GAGGGACCCCACCACTGCCATGG + Intronic
1074905490 10:117859655-117859677 GTGGTGCCCAAACATTATCAGGG + Intergenic
1074969223 10:118521897-118521919 ATGGGGCCTCACCATTCTCAGGG - Intergenic
1081582254 11:44360394-44360416 CAGGGGTCCCAGCATGATCAGGG - Intergenic
1089255276 11:117190672-117190694 GAGCAGCCCCTCCATCATCAGGG - Exonic
1089286477 11:117411057-117411079 GAGGCGCCCCTCCATGACCAGGG + Intronic
1091986664 12:4915154-4915176 CAGGGTCCCCACCATTCTCTGGG - Exonic
1094282833 12:28759493-28759515 GAGTTGCCCCAGCATTCTCATGG + Intergenic
1099588030 12:84546293-84546315 GAGGGGCCAAACCATTAGCAAGG - Intergenic
1100196889 12:92256496-92256518 GAGGGGCCCCTCCATTGTTAGGG + Intergenic
1103015115 12:117488155-117488177 GAGAGGCCTCACAATTATGATGG - Intronic
1104081133 12:125431293-125431315 AAGGGGACCCCCCATTACCAAGG - Intronic
1104088359 12:125494689-125494711 GAGGGACCCAGCCATTTTCAGGG - Intronic
1105603032 13:21903881-21903903 GAGGGGCTCCATCATCAGCATGG - Intergenic
1107344541 13:39444843-39444865 CAGGGGCCACACCATTCCCATGG - Intronic
1115706570 14:36005443-36005465 GAAGGGGTCCACCATTTTCACGG - Intergenic
1115820471 14:37207329-37207351 GAGAGGCCTCACAATCATCATGG - Intronic
1118059058 14:62115969-62115991 CAGCGGCCCCACCACTCTCAGGG - Intergenic
1121211600 14:92211555-92211577 GGGGGGCCTCACCATTATGGTGG + Intergenic
1122188555 14:100021515-100021537 GTGTTGCCCCACCATGATCACGG - Intronic
1129767337 15:78178734-78178756 GTGGGGCCGCACCATATTCATGG - Exonic
1132250893 15:100334785-100334807 GAGGGACCCCCACATTACCAAGG - Intronic
1141261664 16:82459964-82459986 GAGGTGCCACACCAGTAACAAGG + Intergenic
1143355454 17:6324671-6324693 GAGGTACACCAGCATTATCAAGG + Intergenic
1144483496 17:15646292-15646314 GAGGCACCCCATCATTTTCAAGG - Intronic
1144915191 17:18718735-18718757 GAGGCACCCCATCATTTTCAAGG + Intronic
1153885067 18:9457304-9457326 GAGGGGCACCAGCATTACTAAGG - Intergenic
1156897237 18:42259667-42259689 TAGGGGCCCTACCAGCATCAAGG + Intergenic
1157381939 18:47226445-47226467 GAGGGGCCCCACCATTATCAAGG - Intronic
1158937278 18:62376165-62376187 GAGGGGTCTCACCATAACCAGGG - Intronic
1161043140 19:2120690-2120712 AATGGGCCCGACCATTGTCAGGG + Intronic
1161485002 19:4530626-4530648 GAGGGGCCCCACCAGTAAACAGG + Intronic
1165718738 19:38063767-38063789 GAGTGTCCCCACTATCATCATGG - Intronic
1168671526 19:58244460-58244482 GAGGGCCCTCACCATTTACAGGG - Intronic
926111530 2:10187182-10187204 GAGCGGCCCCAGCAGCATCAGGG - Intronic
933093125 2:78146066-78146088 GAGAAGCCCCACCATCGTCAGGG + Intergenic
933270219 2:80225099-80225121 GAGTGGCCCCACCAGTGCCATGG + Intronic
943120470 2:183728315-183728337 GATGCGCCCCAGCATTATGAAGG - Intergenic
945635374 2:212342450-212342472 GAGAGGCCTCACAATTATGACGG - Intronic
946148726 2:217749762-217749784 GAGGGCCCCCAGCATAATGAAGG - Intronic
947200198 2:227608157-227608179 GAGGGGATCCTGCATTATCAAGG - Intergenic
1169966485 20:11223443-11223465 AAGGGGGCCCACCATTATGGTGG + Intergenic
1170018428 20:11809207-11809229 GTGGGGCCCCACCATGAATAGGG + Intergenic
1173057890 20:39634126-39634148 GACAGGCCCCACCATGAGCATGG - Intergenic
1174336772 20:49867943-49867965 GAGTGGACTCACCATTTTCAGGG + Intronic
1175919316 20:62442634-62442656 GGGGGGCCCCAGCGTTACCAAGG - Intergenic
1181067390 22:20313338-20313360 GAGTGCCCCCACCATTGGCAGGG - Intergenic
1181467005 22:23115691-23115713 GTGGGGCCCCTCCATTTGCAGGG - Intronic
1184142494 22:42586022-42586044 GAGGGGACCCACCATTTACTGGG + Intronic
950663791 3:14482729-14482751 CAGGGGCCCCCCCAGTTTCAAGG - Intronic
955347278 3:58170463-58170485 TAGGGGCCCCAGCATTATCGTGG + Intronic
962278594 3:134033625-134033647 GATGGGCCACAGCAATATCAAGG + Intronic
963810822 3:149774608-149774630 GAGGTGCCCCACCAATGTTAAGG - Intronic
968034763 3:195538087-195538109 TAGGGGCACCACCATTTACATGG + Intronic
969075880 4:4577263-4577285 GAGGTGCCCCACCCCTAGCATGG - Intergenic
986088958 5:4483227-4483249 TATGGCCCCCTCCATTATCAGGG - Intergenic
987114331 5:14714216-14714238 GAGGGCCCACACCATTAGGAGGG - Intronic
994743344 5:103648025-103648047 GAGGAGCCTCACATTTATCATGG + Intergenic
997970608 5:138398369-138398391 GTGTGGCTCCACCATCATCATGG - Exonic
999527008 5:152417898-152417920 GATAGGGCCCAACATTATCAAGG - Intronic
1005788701 6:29273884-29273906 GAGGGCACCCACCATTGCCAAGG + Intergenic
1007608315 6:43132121-43132143 GAGGGGCCCACCCATCATCCTGG + Exonic
1009508581 6:64518775-64518797 AAGGGGCCCCCCCCTTCTCAGGG + Intronic
1017026535 6:150186110-150186132 GTGGGGCCCCACTGTTCTCAGGG + Intronic
1017987329 6:159455697-159455719 GAGGAGCACCACCACTACCAGGG + Intergenic
1019662672 7:2233371-2233393 GTCAGGCCCCACCATTATTATGG + Intergenic
1021687096 7:23197558-23197580 GAGGTGGCCCACCATCACCATGG + Intronic
1024822740 7:53352537-53352559 GAGGGGCCCCACCAGCAAGAAGG - Intergenic
1028116380 7:87002443-87002465 GAGGGAGCCAACCATTCTCATGG - Intronic
1033564032 7:142561239-142561261 AAGAGCCCCCACCATTCTCATGG - Intergenic
1034838987 7:154378130-154378152 GAGTGGCCCCACCATTGTGCTGG - Intronic
1039615013 8:38948607-38948629 GTGGGGGCCCAGCATAATCAGGG + Intronic
1044555885 8:93561436-93561458 GATGGGCACCTCCAATATCAAGG + Intergenic
1052716020 9:32118435-32118457 AAGGAGCCACACCATCATCAGGG + Intergenic
1057260177 9:93578462-93578484 CAGAGGCCCCACCACTTTCAGGG - Intronic
1057968567 9:99530111-99530133 GAGGAGCCCCACCATTCAAAGGG - Intergenic
1059876701 9:118643349-118643371 GAGTGGCCCCAGCATTAGCCAGG + Intergenic
1186207417 X:7215387-7215409 GAGGGTCCCCACATTTATCCAGG - Intergenic
1189584500 X:42444422-42444444 GAGGGGCCCCACAATTTTGTAGG + Intergenic