ID: 1157383809

View in Genome Browser
Species Human (GRCh38)
Location 18:47246648-47246670
Sequence GCCGCCCCTGGCCCCCCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 926
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 896}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157383809_1157383820 -5 Left 1157383809 18:47246648-47246670 CCTTCTGGGGGGCCAGGGGCGGC 0: 1
1: 0
2: 1
3: 28
4: 896
Right 1157383820 18:47246666-47246688 GCGGCGGCGGGGGCGGGGGCAGG 0: 3
1: 107
2: 535
3: 1561
4: 5651
1157383809_1157383823 7 Left 1157383809 18:47246648-47246670 CCTTCTGGGGGGCCAGGGGCGGC 0: 1
1: 0
2: 1
3: 28
4: 896
Right 1157383823 18:47246678-47246700 GCGGGGGCAGGTCCGAGCCGGGG 0: 1
1: 1
2: 1
3: 21
4: 266
1157383809_1157383818 -10 Left 1157383809 18:47246648-47246670 CCTTCTGGGGGGCCAGGGGCGGC 0: 1
1: 0
2: 1
3: 28
4: 896
Right 1157383818 18:47246661-47246683 CAGGGGCGGCGGCGGGGGCGGGG 0: 1
1: 6
2: 158
3: 793
4: 2911
1157383809_1157383822 6 Left 1157383809 18:47246648-47246670 CCTTCTGGGGGGCCAGGGGCGGC 0: 1
1: 0
2: 1
3: 28
4: 896
Right 1157383822 18:47246677-47246699 GGCGGGGGCAGGTCCGAGCCGGG 0: 1
1: 0
2: 4
3: 34
4: 439
1157383809_1157383819 -9 Left 1157383809 18:47246648-47246670 CCTTCTGGGGGGCCAGGGGCGGC 0: 1
1: 0
2: 1
3: 28
4: 896
Right 1157383819 18:47246662-47246684 AGGGGCGGCGGCGGGGGCGGGGG 0: 1
1: 33
2: 417
3: 2651
4: 6304
1157383809_1157383821 5 Left 1157383809 18:47246648-47246670 CCTTCTGGGGGGCCAGGGGCGGC 0: 1
1: 0
2: 1
3: 28
4: 896
Right 1157383821 18:47246676-47246698 GGGCGGGGGCAGGTCCGAGCCGG 0: 1
1: 0
2: 2
3: 58
4: 544

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157383809 Original CRISPR GCCGCCCCTGGCCCCCCAGA AGG (reversed) Intronic
900097184 1:944665-944687 GCCCCTACAGGCCCCCCAGATGG + Exonic
901503879 1:9671863-9671885 GCCGCCCCTGGCCCCACTCAAGG + Intronic
902054481 1:13588908-13588930 GCCTGCCTTGGCCTCCCAGAGGG + Intronic
902629719 1:17697382-17697404 GCCTCCCCTCTCCCCTCAGAGGG + Exonic
903148269 1:21388339-21388361 GGCGCCCCTCACCTCCCAGACGG - Intergenic
903426499 1:23257710-23257732 GGCGCCCCTCACCTCCCAGACGG - Intergenic
903445037 1:23417369-23417391 GACTCCCCTGGACCCCCAAAAGG - Exonic
903467075 1:23559146-23559168 CCAGCCCCTGGACCCCCTGATGG - Exonic
903634067 1:24799780-24799802 GGCGCCCCTCACCTCCCAGACGG - Intronic
903634145 1:24799951-24799973 GGCGCCCCTCACCTCCCAGACGG - Intronic
903634196 1:24800078-24800100 GGCGCCCCTCACCTCCCAGACGG - Intronic
903634274 1:24800249-24800271 GGCGCCCCTCACCTCCCAGACGG - Intronic
903923746 1:26818377-26818399 GGCGCCCCTCACCTCCCAGACGG - Intergenic
903923817 1:26818553-26818575 GTCGCCCCTCACCTCCCAGATGG - Intergenic
904532047 1:31176464-31176486 GACGCTCCTCGCCTCCCAGATGG - Intergenic
904795166 1:33052294-33052316 GGCGCCCCTCACCTCCCAGACGG - Intronic
906314538 1:44777756-44777778 GCTGCCCCTGGGCCGCAAGAAGG + Exonic
906355929 1:45106129-45106151 GACGCCCCTCACCTCCCAGACGG - Intronic
906355955 1:45106200-45106222 GACGCCCCTCACCTCCCAGAGGG - Intronic
906487000 1:46241455-46241477 GGCGCCCCTCACCTCCCAGACGG - Intergenic
906487073 1:46241631-46241653 GGCGCCCCTCACCTCCCAGACGG - Intergenic
906748716 1:48239905-48239927 GCCCTCCCTGGGCCCCCAGGAGG - Intronic
906956879 1:50381881-50381903 GGCGCCCCTCACCTCCCAGACGG - Intergenic
907110961 1:51925962-51925984 GCCTCAGCTGGCCCCCCAGCAGG - Intronic
907387934 1:54138007-54138029 TCTGCCCCTGGGCCCCCACAAGG + Intronic
907453533 1:54561997-54562019 GGCGCCCCTCACCTCCCAGACGG + Intronic
907453608 1:54562175-54562197 GGCGCCCCTCACCTCCCAGACGG + Intronic
910196233 1:84642376-84642398 GCCCCCCTTGGCCTCCCAAAGGG - Intergenic
910343982 1:86216369-86216391 GGCGCCCCTCACCTCCCAGACGG - Intergenic
912298305 1:108489512-108489534 GGCGCCCCTCACCTCCCAGACGG + Intergenic
912808215 1:112774014-112774036 GGCGCCCCTCACCTCCCAGATGG - Intergenic
912845000 1:113069769-113069791 GGCGCCCCTCACCTCCCAGACGG - Intergenic
912845074 1:113069946-113069968 GGCGCCCCTCACCTCCCAGACGG - Intergenic
912975844 1:114329516-114329538 GGAGCCCCTGGCCTCCCTGAGGG - Intergenic
913078392 1:115360292-115360314 GACGCCCCTCACCTCCCAGACGG + Intergenic
914775070 1:150728712-150728734 GGCGCCCCTCACCTCCCAGACGG + Intergenic
914965734 1:152256171-152256193 GGCGCCCCTCACCTCCCAGACGG + Intergenic
915234418 1:154470061-154470083 GCCGCCTCTGGGCCCCCACCTGG + Intronic
915463182 1:156081719-156081741 GGCGCCCCCGGCCGCCCCGACGG - Exonic
916223415 1:162466098-162466120 GGCGCCCCTCACCTCCCAGACGG - Intergenic
916320487 1:163498989-163499011 GACGCCCCTCACCTCCCAGATGG + Intergenic
916671972 1:167029785-167029807 GCTGCCCCCGACCTCCCAGACGG - Intergenic
917375886 1:174349816-174349838 GGCGCCCCTCACCTCCCAGACGG + Intronic
918221379 1:182439843-182439865 GGCGCCCCTCACCTCCCAGACGG + Intergenic
918228568 1:182509398-182509420 GGCGCCCCTCACCTCCCAGACGG + Intronic
918255196 1:182741582-182741604 GGCGCCCCTCACCTCCCAGACGG + Intergenic
918701800 1:187616404-187616426 GGCGCTCCTTGCCTCCCAGATGG - Intergenic
919520793 1:198584293-198584315 GGCGCCCCTCACCTCCCAGACGG + Intergenic
920106792 1:203559127-203559149 GCAGCCCCTGGCCTCAGAGATGG - Intergenic
920336914 1:205251010-205251032 GCCTCATCTGGCACCCCAGAGGG - Intronic
920380576 1:205532436-205532458 CCAGCCCCTGCCACCCCAGAGGG + Intronic
921142323 1:212320531-212320553 GGCGCCCCTCACCTCCCAGACGG + Intronic
921198301 1:212779638-212779660 GGCGCCCCTCACCTCCCAGATGG - Intronic
921414123 1:214869491-214869513 GGCGCCCCTCACCTCCCAGATGG + Intergenic
922632942 1:227133245-227133267 GGCGCCCCTCACCTCCCAGACGG - Intronic
922675010 1:227544462-227544484 GCCGCCGATGGCCCCCAAGAAGG - Intergenic
922693029 1:227710715-227710737 GGCGCCCCTCACCTCCCAGATGG + Intergenic
922725686 1:227922064-227922086 CCCTGCCCTGGACCCCCAGAGGG + Intronic
922725807 1:227922535-227922557 GCCTTCACTGGCCCCCCAGCAGG - Intronic
923147605 1:231209127-231209149 GCTGGCCCTGGCCACCCCGAAGG - Exonic
923583029 1:235236800-235236822 GCCGCGCCTGGCCCACAAAACGG + Intronic
1062768274 10:81477-81499 GCCTCCTGTGGCCCCACAGAAGG - Intergenic
1063353049 10:5373965-5373987 TCCACCCCTGGCCCCAGAGATGG - Exonic
1064052059 10:12067961-12067983 GCCCTCCTTGGCCTCCCAGAGGG + Intergenic
1065012153 10:21430326-21430348 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1065117075 10:22493475-22493497 GCAGCCCCTGGTCCTTCAGATGG + Intergenic
1065122916 10:22545460-22545482 GCCTCCCCTGGCACCCCATCTGG + Intronic
1065335982 10:24656422-24656444 GGCGCCCCTCACCTCCCAGACGG - Intronic
1065336054 10:24656599-24656621 GGCGCCCCTCACCTCCCAGACGG - Intronic
1065738111 10:28772074-28772096 GGCGCCCCTCACCTCCCAGATGG - Intergenic
1067086622 10:43243559-43243581 GGCGCCCCTCACCTCCCAGACGG - Intronic
1067086635 10:43243599-43243621 GACGCCCCTCACCTCCCAGATGG - Intronic
1067086680 10:43243746-43243768 GACGCCCCTCACCTCCCAGATGG - Intronic
1067100375 10:43329939-43329961 GACGCCCCTCACCTCCCAGATGG - Intergenic
1067362414 10:45594697-45594719 GCCGCCGCTGGCCGCCAATAAGG - Intronic
1068730303 10:60350801-60350823 GCAGCCCCTGGCTCACCAGGTGG + Intronic
1069052717 10:63811764-63811786 GACGCCCCTCACCTCCCAGATGG + Intergenic
1069674686 10:70239080-70239102 GGCGCCCCTCACCTCCCAGATGG + Intergenic
1069741246 10:70687594-70687616 GGCGCCCCTCACCTCCCAGACGG + Intronic
1070317842 10:75333061-75333083 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1070318154 10:75333838-75333860 GACGCTCCTGACCTCCCAGACGG + Intergenic
1070644923 10:78195223-78195245 GCCATCCCCGGCCCCCCACAGGG - Intergenic
1070880551 10:79849944-79849966 GACGTCCCTGACCCCCAAGAAGG + Exonic
1071544847 10:86521520-86521542 GCCGCTCCTGCCCCCCCAACCGG - Exonic
1072013276 10:91323074-91323096 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1072116706 10:92375413-92375435 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1072116778 10:92375589-92375611 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1072149764 10:92674871-92674893 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1072149837 10:92675046-92675068 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1072480859 10:95809381-95809403 GGCGCCCCCCACCCCCCAGACGG + Intronic
1072648577 10:97276408-97276430 GGCGCCCCTCACCTCCCAGACGG - Intronic
1072949481 10:99838512-99838534 GGCGCCCCTCACCTCCCAGACGG + Intronic
1072956548 10:99892076-99892098 GGCGCCCCTCACCTCCCAGATGG - Intronic
1072980327 10:100093347-100093369 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1073111282 10:101064450-101064472 GCAGCCCAGGGCCCTCCAGAAGG + Intronic
1073386275 10:103129380-103129402 GGCGCCCCTCACCTCCCAGACGG - Intronic
1073785054 10:106879839-106879861 GCCTCCCCAGAGCCCCCAGATGG + Intronic
1075050876 10:119182119-119182141 GGCGCCCCTCACCTCCCAGATGG + Intergenic
1075892960 10:125970286-125970308 GGCGCCCCCTGCCTCCCAGACGG + Intronic
1076140848 10:128077613-128077635 GCAGCCCCAGGCCCGCCAGGAGG + Exonic
1076405598 10:130210520-130210542 CCCTCCCCTGGGCCTCCAGAAGG - Intergenic
1076747117 10:132520028-132520050 GCTGCCTCTGGGCCCCCAGGCGG + Intergenic
1076850473 10:133089999-133090021 GCAGCCCCAGGCCTCCCAGTTGG + Intronic
1076850696 10:133091218-133091240 GCAGCCCCAGGCCTCCCAGTTGG - Intronic
1076992318 11:281941-281963 CCAGACCCTGGCTCCCCAGATGG + Intronic
1077217875 11:1402582-1402604 GCTGCCCCTCACCCCCCAGGAGG - Intronic
1077397635 11:2332748-2332770 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1077439298 11:2560527-2560549 CCCCCCCCCGCCCCCCCAGAAGG - Intronic
1077668473 11:4137355-4137377 GGCGCCCCTCACCTCCCAGACGG + Intronic
1080098149 11:28430630-28430652 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1080098197 11:28430757-28430779 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1080538381 11:33243781-33243803 GACGCTCCTGACCTCCCAGACGG - Intergenic
1080628370 11:34051667-34051689 CCCGCCCCTCGCGACCCAGAGGG + Exonic
1081288817 11:41304253-41304275 GGCGCCCCTCACCTCCCAGACGG - Intronic
1081288890 11:41304429-41304451 GGCGCCCCTCACCTCCCAGACGG - Intronic
1081851594 11:46278265-46278287 GGCGCGCCTGGGCCCCTAGAAGG + Intronic
1081956328 11:47097181-47097203 GGCGCCCCTCACCTCCCAGACGG - Intronic
1081956402 11:47097357-47097379 GGCGCCCCTCACCTCCCAGACGG - Intronic
1082253318 11:50005680-50005702 TCAGTCCCTGGCCCCCCAGTAGG + Intergenic
1083130767 11:60622322-60622344 GGCGCCCCTCACCTCCCAGATGG - Intergenic
1083154777 11:60815687-60815709 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1083382517 11:62279236-62279258 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1083645889 11:64171933-64171955 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1083645964 11:64172109-64172131 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1083764338 11:64834908-64834930 GCAGGCCCTGGCCACCAAGATGG - Exonic
1084639195 11:70414395-70414417 GCCTTCCTTGGCTCCCCAGATGG + Intronic
1084645762 11:70456878-70456900 GGCGCCCCTCACCTCCCAGATGG + Intergenic
1084645776 11:70456915-70456937 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1084645788 11:70456952-70456974 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1084645847 11:70457140-70457162 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1084680302 11:70662872-70662894 GCCCCCGCAGGCCACCCAGAAGG - Intronic
1084924689 11:72502450-72502472 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1085111928 11:73897062-73897084 GGCGCCCCTCACCTCCCAGACGG + Intronic
1085116646 11:73936720-73936742 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1085388031 11:76168312-76168334 ACCGCCCCTGGCCACCCTCAAGG + Intergenic
1085412082 11:76297344-76297366 GGCCCCCCTGGCCCAGCAGAGGG - Intergenic
1085430528 11:76444504-76444526 GTGGCCTCTAGCCCCCCAGATGG - Intergenic
1085513185 11:77098459-77098481 GGCGCCCCTCACCTCCCAGACGG + Intronic
1085513259 11:77098635-77098657 GGCGCCCCTCACCTCCCAGACGG + Intronic
1085563325 11:77490537-77490559 GACGCCCCTCACCTCCCAGACGG - Intergenic
1085667887 11:78431793-78431815 GCCGGCCTTGGCCTCCCAAAAGG + Intergenic
1086792886 11:91063768-91063790 GGCGCCCCTCGCCTCCCGGACGG - Intergenic
1086881687 11:92158143-92158165 GTCGCCCCTTACCTCCCAGATGG - Intergenic
1087057195 11:93947026-93947048 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1087723557 11:101693931-101693953 GCTCCCCCTGGTTCCCCAGAGGG - Intronic
1087738921 11:101865673-101865695 GCCTGCCTTGGCCTCCCAGAGGG - Intronic
1089600367 11:119610617-119610639 GCTCCCCCTGCCTCCCCAGAAGG - Intergenic
1089626800 11:119756010-119756032 GCCACCACAGGCCCCCCACAGGG - Intergenic
1090204134 11:124875563-124875585 GCCCCCAGTGGCCCCCCACAGGG + Exonic
1090356926 11:126146615-126146637 CCCACCCCGGGCTCCCCAGAGGG - Intergenic
1090733886 11:129594546-129594568 GCCTGCCCTGGCTCCCCAGATGG - Intergenic
1090790964 11:130091450-130091472 GGCGCCCCTCACCTCCCAGACGG + Intronic
1091326211 11:134690114-134690136 GCCACCCCTGGCCACAGAGAGGG - Intergenic
1091585409 12:1813283-1813305 GCCCACCCTGGACCCCCTGAAGG - Intronic
1091762317 12:3095585-3095607 GGCGCCCCTCACCTCCCAGACGG + Intronic
1092085979 12:5760678-5760700 CCTGTCCCTGGCCCTCCAGAAGG + Intronic
1092249432 12:6884371-6884393 GAAGCCCTTGGCCCCCAAGAAGG + Intronic
1092348185 12:7733768-7733790 ACCGCACCTGGCCCCCAAGCTGG + Intronic
1092453491 12:8624899-8624921 GGCGCTCCTCGCCTCCCAGACGG - Intergenic
1092806126 12:12224913-12224935 ACCGCCCCTGGCCATTCAGAAGG - Intronic
1093491890 12:19714349-19714371 GCCCACCCTGGCCTCCCAAAGGG + Intronic
1094025895 12:25959107-25959129 GCCCCCGCAGGCCGCCCAGAGGG - Exonic
1094571310 12:31643848-31643870 ACCGCACCTGGCCCCCTAGCAGG + Intergenic
1095068629 12:37814648-37814670 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1095439631 12:42228052-42228074 GGCGCCCCTCACCTCCCAGACGG - Intronic
1095452825 12:42350186-42350208 GGCGCCCCTCACCTCCCAGACGG + Intronic
1095801674 12:46275494-46275516 ACCGCGCCTGGCCTCCCAAAAGG - Intergenic
1096022152 12:48332825-48332847 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1096336972 12:50764172-50764194 GCCCCGCCTGACCCCCGAGAAGG + Intronic
1096557016 12:52409844-52409866 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1097164765 12:57078074-57078096 ACCGCCCCCGGCCCGCGAGATGG - Intronic
1097626774 12:62010726-62010748 GACGCCCCTCACCTCCCAGACGG - Intronic
1097626789 12:62010763-62010785 GGCGCCCCTCACCTCCCAGACGG - Intronic
1097648460 12:62264227-62264249 GCCTACCTTGGCCTCCCAGAGGG + Intronic
1098019080 12:66135037-66135059 GGCGCCCCTCACCTCCCAGACGG - Intronic
1098019151 12:66135213-66135235 GGCGCCCCTCACCTCCCAGACGG - Intronic
1098023102 12:66174992-66175014 GACGCCCCTCACCTCCCAGACGG - Intergenic
1098375210 12:69807400-69807422 GGCGCCCCTCACCTCCCAGACGG + Intronic
1098458348 12:70702171-70702193 GCATCCCCTTGCCCCCCAGCGGG - Intronic
1099658959 12:85530711-85530733 GGAGCCCCTGGGGCCCCAGACGG - Intergenic
1100582204 12:95947844-95947866 GGCGCCCCTCACCTCCCAGACGG - Intronic
1100646922 12:96541529-96541551 GCCTGCCCTGGCCTCCCAAAGGG + Intronic
1100995016 12:100294339-100294361 GGCGCCCCTCACCTCCCAGACGG + Intronic
1101399711 12:104376882-104376904 CCCGCCCCTGCCCTCGCAGAGGG - Intergenic
1102174750 12:110867307-110867329 GGCGCCCCTCACCTCCCAGACGG + Intronic
1102174902 12:110867659-110867681 GGCGCCCCTCACCTCCCAGACGG + Intronic
1102293862 12:111723100-111723122 GGCGCCCCTCACCTCCCAGACGG + Intronic
1102293939 12:111723276-111723298 GGCGCCCCTCACCTCCCAGACGG + Intronic
1102578549 12:113872426-113872448 GGCGCCCCTCACCTCCCAGACGG - Intronic
1102656299 12:114484994-114485016 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1102874843 12:116441493-116441515 GCCTTCCCTGGCCACCCACAGGG + Intergenic
1103350145 12:120278286-120278308 GACGCCCCTCACCTCCCAGACGG + Intergenic
1103457106 12:121076279-121076301 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1104639697 12:130459584-130459606 GCCGCCCTTAGCCCCCTTGATGG - Intronic
1104987016 12:132603021-132603043 GCCTCCCCAGGCTTCCCAGAAGG + Intergenic
1105367875 13:19779588-19779610 GGCGCCCCTCACCTCCCAGACGG - Intronic
1105367950 13:19779766-19779788 GGCGCCCCTCACCTCCCAGACGG - Intronic
1105846961 13:24301662-24301684 CCTGCCCCTGGCCTGCCAGAAGG - Intronic
1106680163 13:32000268-32000290 GGCGCCCCTCGCCTCCCGGATGG - Intergenic
1106918703 13:34540922-34540944 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1108351522 13:49593407-49593429 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1108351621 13:49593632-49593654 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1108747334 13:53409009-53409031 CCCGCCCGTGGCCCTCCAGCCGG + Intergenic
1111179164 13:84639285-84639307 GAACCCCCTGGCCCCCCAAAAGG + Intergenic
1112420311 13:99242413-99242435 GGCGCCCCTCACCTCCCAGACGG + Intronic
1112420389 13:99242589-99242611 GGCGCCCCTCACCTCCCAGACGG + Intronic
1113666331 13:112144061-112144083 GCCGCCCCTGCCCCCCATGCGGG + Intergenic
1113695421 13:112342637-112342659 ACCCTCCCTGGCCCCCCGGAGGG + Intergenic
1114244739 14:20902280-20902302 GCCACCCCTCACCCCCCAGCTGG + Intergenic
1114665770 14:24376472-24376494 GCCCCCTCTGTACCCCCAGACGG + Exonic
1115259297 14:31436995-31437017 GGCGCCCCTCGCCTCCCGGACGG + Intronic
1115325052 14:32128614-32128636 GCCGCGCCTGGCCGCCCGGCAGG + Intronic
1116191773 14:41674158-41674180 GGCGCCCCTCACCTCCCAGACGG + Intronic
1116480564 14:45389675-45389697 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1116502164 14:45635274-45635296 GACGCCCCTCACCTCCCAGATGG - Intergenic
1117716691 14:58588557-58588579 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1118114587 14:62761107-62761129 GCCGGCCTTGGCCTCCCAAAGGG - Intronic
1118329569 14:64804908-64804930 GCAGCCCCGGGGCCCACAGAAGG + Intronic
1118428433 14:65692314-65692336 GGCGCCCCTCACCTCCCAGACGG + Intronic
1118770414 14:68939102-68939124 GCCATCCAAGGCCCCCCAGAAGG + Intronic
1119519213 14:75273385-75273407 GCCACCCCTGGCCCTGCACATGG + Intergenic
1119520824 14:75283926-75283948 ACCGCTCCTGGCCCACCAGCTGG - Intergenic
1119711026 14:76822130-76822152 GGCGCCCCTCACCTCCCAGACGG - Intronic
1119734780 14:76974964-76974986 CCCGCCCCTGCACCTCCAGAGGG + Intergenic
1120991789 14:90383621-90383643 GCGGCCCGTGGCCCTCCATAGGG + Intergenic
1121306595 14:92911425-92911447 GGCGCCCCTCACCTCCCAGATGG + Intergenic
1121331504 14:93052590-93052612 GCCGTCTCTGGCCCCACTGAAGG - Intronic
1122635680 14:103128595-103128617 GCCACCCAAGGCCCCCGAGACGG - Intronic
1122720564 14:103719705-103719727 GCAGCCCCTGGCACCTCACAGGG - Intronic
1122811478 14:104291474-104291496 GCCGCCCCAGGGACCCCTGAAGG - Intergenic
1122909052 14:104817611-104817633 GCCCACCCTGGCCTCCCAAAGGG + Intergenic
1122963576 14:105111495-105111517 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1122963729 14:105111848-105111870 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1123025313 14:105421174-105421196 GCCTCCCCTGTCCTCTCAGAGGG + Intronic
1123580377 15:21709897-21709919 GCCGCCCCTGGGCTGCAAGAAGG - Intergenic
1123617025 15:22152520-22152542 GCCGCCCCTGGGCTGCAAGAAGG - Intergenic
1124245969 15:28070571-28070593 GGCGCCCCTCACCTCCCAGACGG - Intronic
1124588499 15:31033297-31033319 GCCCCACGTGGCCCCACAGAGGG + Intronic
1125031890 15:35082371-35082393 GACGCCCCTCACCTCCCAGATGG - Intergenic
1125079269 15:35656270-35656292 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1125079345 15:35656447-35656469 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1125079418 15:35656623-35656645 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1125566617 15:40683001-40683023 GGCGCCCCTCACCCCCCGGACGG - Intergenic
1125566852 15:40683529-40683551 GGCGCCCCTGACCTCCCGGACGG - Intergenic
1125659353 15:41382912-41382934 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1125659402 15:41383039-41383061 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1127073103 15:55303340-55303362 GGCGCCCCTCACCTCCCAGACGG - Intronic
1127073150 15:55303466-55303488 GGCGCCCCTCACCTCCCAGACGG - Intronic
1127088360 15:55445600-55445622 GGCGCTCCTCGCCTCCCAGATGG + Intronic
1127154158 15:56109996-56110018 GGCGCCCCTCGCCTCCCGGACGG - Intronic
1127782824 15:62332160-62332182 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1128452049 15:67811414-67811436 GCAGCCCCTGGGGCCCCACAGGG + Intergenic
1128489698 15:68134575-68134597 GGCGCCCCCCACCCCCCAGACGG + Intronic
1128522925 15:68387274-68387296 GCTCTCCCTGGCCCCACAGATGG + Intronic
1128970406 15:72101370-72101392 GGCGCCCCTCACCTCCCAGATGG - Intronic
1128970557 15:72101722-72101744 GGCGCCCCTCACCTCCCAGACGG - Intronic
1129054050 15:72807039-72807061 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1129352238 15:74962851-74962873 GCTGGCTCTGGCCCCACAGATGG + Intronic
1129463097 15:75709795-75709817 CCCACCCCAGGCCCCCCAGGCGG + Intronic
1129721787 15:77881606-77881628 CCCACCCCAGGCCCCCCAGGCGG - Intergenic
1130340589 15:82997788-82997810 GGCGCCCCTCACCTCCCAGACGG + Intronic
1130340643 15:82997918-82997940 GGCGCCCCTCACCTCCCAGACGG + Intronic
1131058607 15:89391022-89391044 GCAGGCCCTGGCCCAGCAGAAGG + Intergenic
1131127354 15:89868246-89868268 GGCGCCCCTCACCTCCCAGACGG - Intronic
1131127427 15:89868422-89868444 GGCGCCCCTCACCTCCCAGACGG - Intronic
1131127503 15:89868598-89868620 GGCGCCCCTCACCTCCCAGACGG - Intronic
1131127554 15:89868725-89868747 GGCGCCCCTCACCTCCCAGACGG - Intronic
1132250318 15:100331103-100331125 CACGCCCATGGCCCCCCGGAGGG + Intronic
1132339443 15:101068751-101068773 GGCGCCCCAGCCCCTCCAGACGG - Exonic
1132359425 15:101200583-101200605 CCAGCCCCTGCACCCCCAGATGG + Intronic
1202989247 15_KI270727v1_random:444142-444164 GCCGCCCCTGGGCTGCAAGAAGG - Intergenic
1132457174 16:30608-30630 GCCTCCTGTGGCCCCACAGAAGG - Intergenic
1132492225 16:238519-238541 GCCCCCCTTGGCCTCCCAAAGGG - Intronic
1132675163 16:1118392-1118414 GCCTCCCCTGGGACCCCAGGAGG - Intergenic
1132681591 16:1144662-1144684 GCCGCCACTGGCACCCCAAGTGG + Intergenic
1132835430 16:1950638-1950660 GATGCCCCTGGCACCCCAGAAGG + Intronic
1132880777 16:2160845-2160867 GCATGCCCTGGCCCCCCAGAGGG - Intronic
1132900617 16:2251966-2251988 GCAGCCCCTGGCCTCCCTGACGG - Intronic
1133270704 16:4609680-4609702 GCCACCCCTGGCCCCCCAACAGG - Exonic
1133833896 16:9350366-9350388 GACGCCCCTCACCTCCCAGATGG + Intergenic
1133833978 16:9350623-9350645 GGCGCCCCTCACCTCCCAGATGG + Intergenic
1133833992 16:9350660-9350682 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1134065283 16:11224479-11224501 GCCGGCCCTGGCCCGGGAGAGGG + Intergenic
1134241941 16:12512979-12513001 GCTTCCCTTGTCCCCCCAGAGGG + Intronic
1135172282 16:20195920-20195942 GCCCGCCCTGGCCTCCCAAAGGG + Intergenic
1135270884 16:21068558-21068580 GCCTGCCTTGGCCTCCCAGAGGG + Intronic
1135712466 16:24729593-24729615 ACGGCCACTGGCCCCCAAGATGG - Intergenic
1135922243 16:26661543-26661565 TCCATCCCTGGACCCCCAGATGG - Intergenic
1136160670 16:28416918-28416940 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1136268931 16:29137143-29137165 GCCTCCCCGGGGCCCTCAGAGGG + Intergenic
1136298431 16:29317183-29317205 GCCTCTCATGGCCCCACAGATGG + Intergenic
1136373424 16:29850064-29850086 GCCTGCCTTGGCCCCCCAAAGGG + Intergenic
1136426243 16:30170007-30170029 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1136541526 16:30930114-30930136 GCCGTCCCCGTCCCCGCAGAGGG + Exonic
1136568042 16:31081559-31081581 CCCGCCCGTGGCCCTCCAGCCGG - Exonic
1136690655 16:32025839-32025861 CTCACTCCTGGCCCCCCAGAGGG - Intergenic
1136791240 16:32969400-32969422 CTCACTCCTGGCCCCCCAGAGGG - Intergenic
1136878574 16:33884532-33884554 CTCACTCCTGGCCCCCCAGAGGG + Intergenic
1137547742 16:49416041-49416063 CCTGTCACTGGCCCCCCAGAGGG + Intergenic
1138307360 16:55989516-55989538 GACGCCCCTCACCTCCCAGATGG - Intergenic
1138400390 16:56739805-56739827 GGCGCCCCTCACCTCCCAGACGG + Intronic
1138400491 16:56740031-56740053 GGCGCCCCTCACCTCCCAGACGG + Intronic
1138466999 16:57200491-57200513 GGCGCCCCTCACCTCCCAGACGG + Intronic
1138467170 16:57200914-57200936 GGCGCCCCTCACCTCCCAGACGG + Intronic
1138642230 16:58396220-58396242 GGCGCCCCTCACCTCCCAGACGG + Intronic
1139546707 16:67653117-67653139 GCCGCCCCTGGGCCCCCGGCCGG + Exonic
1139885561 16:70204978-70205000 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1139885610 16:70205105-70205127 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1140032669 16:71350938-71350960 GCCGTACCTGGGCCTCCAGAGGG - Intergenic
1141483997 16:84326701-84326723 CCCTCCCCAGGCCCCCCAGCTGG - Intronic
1141834930 16:86532267-86532289 GCAGCCCCTGGCTCCCCACCAGG - Exonic
1142060095 16:88023678-88023700 GCCTCTCATGGCCCCACAGATGG + Intronic
1142071743 16:88094358-88094380 GCCGCCCGTGGACCCTGAGAAGG - Intronic
1142072237 16:88097511-88097533 GCCTCCCCAGGGCCCTCAGAGGG + Intronic
1142133394 16:88441117-88441139 GCCCCCCCTCACCCCCCAGGAGG + Intergenic
1142411591 16:89919758-89919780 GACGACACTGGCCACCCAGATGG - Exonic
1203093449 16_KI270728v1_random:1230862-1230884 CTCACTCCTGGCCCCCCAGAGGG - Intergenic
1142983385 17:3684136-3684158 GCCGCTCCCGGCCCCACTGAAGG + Intronic
1143321343 17:6070806-6070828 GCCGCCCCGGGCCCCCGGGAAGG - Intronic
1143352338 17:6297993-6298015 GCCTCCCCTGGCTCACCAGCTGG + Intergenic
1144482101 17:15637428-15637450 GGCGCCCCTCACCTCCCAGATGG - Intronic
1144536555 17:16095734-16095756 GGCGCCCCTCACCTCCCAGACGG - Intronic
1144583495 17:16473709-16473731 GCTGCCCCTGGACCCTCAGGTGG - Intronic
1144685709 17:17224781-17224803 GCCGGCCTTGGCCTCCCAAAGGG + Intronic
1144710458 17:17398434-17398456 GCTGCCCCTGGCCTCTCTGAAGG - Intergenic
1144716894 17:17442372-17442394 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1145174224 17:20685371-20685393 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1145206005 17:20984974-20984996 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1145684488 17:26638953-26638975 GGCGCCCCTCACCCCCCGGACGG - Intergenic
1145862875 17:28224009-28224031 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1145862950 17:28224185-28224207 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1145896226 17:28459173-28459195 GGCGCCCCTCACCTCCCAGACGG - Intronic
1145920078 17:28604039-28604061 GGCGCCCCTCACCTCCCAGACGG + Intronic
1146444171 17:32922288-32922310 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1147153519 17:38531982-38532004 CTCACTCCTGGCCCCCCAGAGGG - Exonic
1147543657 17:41381863-41381885 GCTGCTGCTGGCCCCCCATATGG + Intronic
1147963517 17:44180960-44180982 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1148404411 17:47398143-47398165 GGCGCCCCTCACCTCCCAGACGG - Intronic
1148406534 17:47420894-47420916 GGCGCCCCTCACCTCCCAGACGG - Intronic
1148567382 17:48641716-48641738 GCCGCCCCTGCCGCCCCTGTGGG - Intergenic
1148632842 17:49125646-49125668 GACGCTCCTCACCCCCCAGACGG - Intergenic
1148975946 17:51528334-51528356 GGCCCCCGTGGCCTCCCAGAAGG + Intergenic
1149909070 17:60551829-60551851 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1149909142 17:60552005-60552027 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1149909266 17:60552281-60552303 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1151252719 17:72849741-72849763 GCAGCCACTGGCCTTCCAGAGGG - Exonic
1151817211 17:76477195-76477217 GCCTCCCCTGTCTCCCCCGATGG - Exonic
1151843778 17:76636680-76636702 GGCGCCCCCGACCTCCCAGACGG - Intronic
1152058758 17:78052703-78052725 ACCTCCCCTGGCCCACCAGCTGG + Intronic
1152174951 17:78781730-78781752 TCCGCCCCGAGCCCCGCAGAGGG + Intronic
1152672774 17:81618613-81618635 GGCGCCCCTCACCTCCCAGACGG - Intronic
1152704033 17:81833627-81833649 GCCGCCCCTGGCCCACGGGTGGG + Exonic
1152777747 17:82213104-82213126 GCCGCCCCCGGCCCGGCCGAGGG + Intergenic
1152824166 17:82453771-82453793 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1152889626 17:82873138-82873160 GCTGCATCTGGCCCCTCAGATGG + Intronic
1152961160 18:81332-81354 GCCGCCTGTGGCCCCACAGAAGG - Intergenic
1153201746 18:2655113-2655135 GGCGCTCCAGGGCCCCCAGAGGG + Intergenic
1153882128 18:9430569-9430591 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1154265271 18:12874333-12874355 GGCGCCCCTCACCTCCCAGACGG - Intronic
1154405882 18:14090648-14090670 GGCTCCCCTGGACCCTCAGATGG - Intronic
1156326225 18:36077571-36077593 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1156450505 18:37263842-37263864 GCCTCTCCTGGTCACCCAGAGGG + Intronic
1156454536 18:37285529-37285551 GCCATTCCTGGCCCCCCAGAGGG - Intronic
1156489270 18:37486697-37486719 GCCACCCATGGCCCCAGAGAAGG + Intronic
1157383809 18:47246648-47246670 GCCGCCCCTGGCCCCCCAGAAGG - Intronic
1157933145 18:51845253-51845275 GCTGCCCCTGGGCCGCAAGAAGG - Intergenic
1158148687 18:54343577-54343599 GGCGCCCCTCACCTCCCAGACGG - Intronic
1160505854 18:79426596-79426618 ACCGTCCCCGGACCCCCAGAGGG + Intronic
1160904712 19:1446669-1446691 GCCGCCCCCGCCGCCCCAGCTGG - Intronic
1161283149 19:3456474-3456496 GGCGGCCCTGGCCCCAGAGAGGG - Intronic
1161317149 19:3622633-3622655 GCCTCCCCTCGGCCCCCAGAGGG + Intronic
1161627386 19:5335196-5335218 TCCGCTCCTGGACACCCAGAGGG - Intronic
1162022474 19:7874119-7874141 GCCTCCCCTGGCCTCCCCGAGGG + Intronic
1162369650 19:10271060-10271082 ACCGCCCCTTGGCCCCCAGGTGG + Exonic
1162713692 19:12614836-12614858 GCCCACCTTGGCCTCCCAGAGGG + Intronic
1162871355 19:13589184-13589206 TCCGCCCCTGCCGCCCCAGTTGG + Intronic
1162997070 19:14342970-14342992 GGAGCCCGTGGTCCCCCAGAGGG - Intergenic
1163143094 19:15363259-15363281 GGCGCCCCTCACCTCCCAGACGG - Intronic
1163816025 19:19465064-19465086 GCTGCCTCTGGCCCCCAACAGGG + Intronic
1163905723 19:20149675-20149697 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1163905796 19:20149851-20149873 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1164016635 19:21260434-21260456 GGCGCTCCTCACCCCCCAGACGG + Intronic
1164081627 19:21865608-21865630 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1164105655 19:22106872-22106894 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1164105808 19:22107229-22107251 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1164105881 19:22107404-22107426 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1164186104 19:22871440-22871462 GCCGCCCCTCACCTCCCGGACGG + Intergenic
1164192232 19:22926454-22926476 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1164218700 19:23173426-23173448 GGCGCCCCTCACCTCCCAGATGG - Intergenic
1164499967 19:28810477-28810499 ACCCTCCCTGGCCTCCCAGAGGG - Intergenic
1164598290 19:29544714-29544736 GCAGCCCTGGGCTCCCCAGAGGG + Intronic
1164652369 19:29899331-29899353 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1164652628 19:29899913-29899935 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1164652964 19:29900670-29900692 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1165199516 19:34132952-34132974 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1165280412 19:34792572-34792594 ACCGCACCTGGCCCCTCACAAGG - Intergenic
1165349315 19:35267762-35267784 ACCGTCCCTGGGCCCCCAGCCGG + Intronic
1165377078 19:35450344-35450366 GCCGCCTCTGGGCCCCCACAAGG - Exonic
1165540919 19:36491423-36491445 GGCGCCCCTCGCCTCCCGGACGG - Intergenic
1165773007 19:38389280-38389302 GCCGCCCCTTCCCCTCCTGAAGG + Intronic
1165815071 19:38636983-38637005 TCTGCCCCTTGCCCACCAGAGGG + Intergenic
1165842604 19:38797937-38797959 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1166028353 19:40108269-40108291 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1166028428 19:40108445-40108467 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1166114910 19:40648080-40648102 GGCGCCCCTGACCTCCCGGACGG + Intergenic
1166180077 19:41102885-41102907 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1166180128 19:41103012-41103034 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1166261647 19:41644909-41644931 GGCGCCCCTCACCTCCCAGACGG - Intronic
1166278001 19:41768685-41768707 GGCGCCCCTCACCTCCCAGACGG + Intronic
1166640298 19:44489184-44489206 GGCGCCCCTCACCTCCCAGACGG - Intronic
1166764640 19:45245474-45245496 CCCGCCCCTGGCCCCAGAGAGGG - Intronic
1166888028 19:45973348-45973370 GCCGCCCCAGGCCCCCCCCATGG - Exonic
1168023126 19:53624332-53624354 GCCCTCCCTGGCCTCCCAAAGGG + Intergenic
1168316169 19:55485678-55485700 CCAGGCCCCGGCCCCCCAGAAGG - Exonic
1168403522 19:56099241-56099263 GCCTTGCCTGGCCCCCAAGACGG + Intronic
1168687174 19:58356005-58356027 GCCGCCCCTGCACTCCCAGCAGG + Exonic
925102995 2:1265533-1265555 GGCTCTCCTGGCCCCGCAGATGG - Intronic
925182098 2:1823990-1824012 GCCGCGCCTCCCCCCCCAGCGGG + Intronic
925400444 2:3569089-3569111 GGCGCCCCTCACCTCCCAGAAGG + Intergenic
925706281 2:6686856-6686878 GCGACCCCTGGAGCCCCAGAGGG + Intergenic
925847801 2:8049348-8049370 GCAGCCCCTGGACTCCCACATGG + Intergenic
926008782 2:9392570-9392592 GCAGCCCCTGGACCACCAGACGG - Intronic
926133251 2:10318721-10318743 GCTGCCCTTAGCCTCCCAGATGG - Intronic
926163799 2:10505552-10505574 GCCCCCTCTGGCCTCCCAGGAGG - Intergenic
926425775 2:12737237-12737259 ACCGCCCCTTGTCCCACAGATGG + Intronic
927717683 2:25363078-25363100 ACCGCGCCTGGCCCCAGAGATGG - Intergenic
927776833 2:25910302-25910324 GGCGCCCCTCACCTCCCAGACGG + Intergenic
928597051 2:32868954-32868976 GGCGCCCCTCACCTCCCAGACGG - Intergenic
929416152 2:41747245-41747267 GGCGCCCCTCACCTCCCAGACGG - Intergenic
929983168 2:46699428-46699450 GCCGCCCCGCGCGCCCCAAACGG + Intronic
930201996 2:48556477-48556499 GGCGCCCCTCACCTCCCAGACGG + Intronic
930699625 2:54446314-54446336 GCCACCCCTGGCCTCTCACATGG - Intergenic
930704017 2:54486129-54486151 GGCGCCCCTCACCTCCCAGACGG - Intronic
930821565 2:55651183-55651205 GGCGCCCCTCACCTCCCAGACGG - Intronic
932218279 2:69981019-69981041 GCCCACCTTGGCCTCCCAGAGGG + Intergenic
932807296 2:74795674-74795696 GGCGCCCCTCACCTCCCAGACGG + Intergenic
933250599 2:80024721-80024743 GCGACCCCTGGAGCCCCAGAGGG + Intronic
933868945 2:86548976-86548998 GGCGCTCCTAGCCTCCCAGATGG + Intronic
933868983 2:86549092-86549114 GACGCCCCTCACCTCCCAGACGG + Intronic
933869031 2:86549237-86549259 GGCGCTCCTCGCCTCCCAGACGG + Intronic
933869042 2:86549274-86549296 GGCGCTCCTCGCCTCCCAGACGG + Intronic
933869124 2:86549578-86549600 GACGCCCCTCCCCTCCCAGAAGG + Intronic
933869164 2:86549692-86549714 GACGCCCCTCACCTCCCAGATGG + Intronic
933869187 2:86549763-86549785 GGCGCTCCTCGCCTCCCAGACGG + Intronic
933869212 2:86549837-86549859 GGCGCTCCTCGCCTCCCAGATGG + Intronic
933869223 2:86549874-86549896 GGCGCTCCTCGCCTCCCAGACGG + Intronic
934309879 2:91852393-91852415 GGCGCCCCTCACCTCCCAGACGG - Intergenic
934658971 2:96133079-96133101 GCCACCACTCGCACCCCAGAGGG + Intronic
934703620 2:96462007-96462029 GGCGCCCCTCACCTCCCAGACGG - Intergenic
934755112 2:96819228-96819250 GCTGCCTCTGGCAGCCCAGATGG - Intronic
935636260 2:105251552-105251574 GGCGCCCCTCACCTCCCAGACGG - Intergenic
936086067 2:109470142-109470164 GCCACCCCAGCCACCCCAGAAGG - Intronic
936546319 2:113394756-113394778 GGCGCCCCTCACCTCCCAGACGG - Intergenic
936546393 2:113394932-113394954 GGCGCCCCTCACCTCCCAGACGG - Intergenic
937168590 2:119844059-119844081 GGCGCCCCTCACCTCCCAGACGG + Intronic
937168666 2:119844236-119844258 GGCGCCCCTCACCTCCCAGACGG + Intronic
937919400 2:127119616-127119638 GGCGCCCCTCACCTCCCAGACGG + Intergenic
937919470 2:127119791-127119813 GGCGCCCCTCACCTCCCAGACGG + Intergenic
938005847 2:127788153-127788175 GGCGCCCCTCACCTCCCAGACGG + Intronic
938080567 2:128367869-128367891 GGAGCCCCTAGCCTCCCAGATGG - Intergenic
938303429 2:130231620-130231642 GCCCCTACAGGCCCCCCAGATGG - Intergenic
941541031 2:166784654-166784676 CCCGCCCCCCACCCCCCAGAGGG + Intergenic
941769080 2:169327788-169327810 GGCGCCCCTCACCTCCCAGACGG - Intronic
941786746 2:169506034-169506056 GGCGCCCCTCGCCTCCCGGACGG - Exonic
941814653 2:169786198-169786220 GGCGCCCCTCACCTCCCAGACGG + Intergenic
942355641 2:175108265-175108287 GACGCTCCTGGCTTCCCAGACGG - Intronic
942595579 2:177589029-177589051 CCCAGCCCTGGCCCCTCAGAGGG - Intergenic
942630367 2:177946135-177946157 GGCGCCCCTCACCTCCCAGACGG - Intronic
943418369 2:187636923-187636945 GACGCCCCTCACCTCCCAGACGG + Intergenic
944262891 2:197696017-197696039 GGCGCCCCTCACCTCCCAGACGG + Intronic
944283352 2:197922860-197922882 GGCGCCCCTCACCTCCCAGACGG + Intronic
944283429 2:197923036-197923058 GGCGCCCCTCACCTCCCAGACGG + Intronic
944785661 2:203067022-203067044 GACGCCCCTCACCTCCCAGAAGG + Intronic
944988033 2:205201590-205201612 GCCCGCCTTGGCCCCCCAAAGGG - Intronic
945114893 2:206400823-206400845 GGCGCCCCTCACCTCCCAGACGG + Intergenic
945114966 2:206400998-206401020 GGCGCCCCTCACCTCCCAGACGG + Intergenic
946742691 2:222816597-222816619 GGCGCCCCTCACCTCCCAGACGG - Intergenic
947334824 2:229070673-229070695 GCCTCTCCTGCTCCCCCAGAAGG - Intronic
948430323 2:237914331-237914353 GCGGCCCCCGGGCCCCCAGGTGG + Intergenic
948642709 2:239385667-239385689 GCCACCCCAGGAGCCCCAGAAGG + Intronic
948771600 2:240253978-240254000 GCCTTCCCTGGCTTCCCAGAGGG + Intergenic
948802305 2:240438438-240438460 GCCGCCCAGGGGCCACCAGAGGG - Intronic
948828375 2:240585450-240585472 GCCCCACCTGGCCTCTCAGAGGG + Intergenic
948862816 2:240761080-240761102 GCCTGACCTGGCCCCCCAGAAGG - Intronic
1169462511 20:5808034-5808056 GCCCACCCTGGCCTCCCAAAGGG - Intronic
1169911888 20:10653704-10653726 GCCCCCTCTAGCTCCCCAGAAGG + Intronic
1171848354 20:30291568-30291590 GGCGCCCCTCACCTCCCAGATGG + Intergenic
1171956935 20:31470337-31470359 GGCGCCCCTCACCCCCCGGACGG + Intronic
1172051506 20:32122112-32122134 GGCGCCCCTCACCTCCCAGACGG + Intronic
1172059281 20:32176675-32176697 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1172059511 20:32177203-32177225 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1172183220 20:33016197-33016219 GCCACCCCACACCCCCCAGAGGG + Intronic
1172263240 20:33587509-33587531 GCCCCCCTTGGCCTCCCAAAGGG + Intronic
1172349317 20:34229395-34229417 GGCGCCCCTCACCTCCCAGACGG + Intronic
1172349467 20:34229747-34229769 GGCGCCCCTCACCTCCCAGACGG + Intronic
1172349640 20:34230148-34230170 GGCGCCCCTCACCTCCCAGACGG + Intronic
1172349714 20:34230324-34230346 GGCGCCCCTCACCTCCCAGACGG + Intronic
1172349789 20:34230500-34230522 GGCGCCCCTCACCTCCCAGACGG + Intronic
1172465644 20:35153863-35153885 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1172574979 20:36001450-36001472 GGCGCCCCTCACCTCCCAGACGG + Intronic
1172717661 20:36976664-36976686 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1172736009 20:37126434-37126456 GGCGCCCCTCACCTCCCAGACGG - Intronic
1172830384 20:37829102-37829124 CCTGCCCCCTGCCCCCCAGATGG - Intronic
1172918504 20:38461590-38461612 GGCGCCCCTCTCCTCCCAGACGG + Intergenic
1173276811 20:41591852-41591874 GCCTGCCTTGGCCTCCCAGAGGG - Intronic
1173769535 20:45645860-45645882 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1174407321 20:50310669-50310691 GCTGCCGCTGGGCCCCCAGGAGG - Intergenic
1175988423 20:62775907-62775929 GCCGCCCCAAGGCCCCCAAAAGG + Intergenic
1176021422 20:62964187-62964209 GCCGGCCCTGGCCCCCTCTAAGG + Intronic
1176430724 21:6573924-6573946 GTGGCCCCAGGGCCCCCAGACGG + Intergenic
1176797480 21:13380556-13380578 GGCGCTCCTCGCCTCCCAGATGG - Intergenic
1177178357 21:17720271-17720293 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1178075671 21:29011797-29011819 GGCGCCCCTCACCTCCCAGACGG - Intronic
1178888632 21:36501795-36501817 CCAGCCCCTGGCCCTCGAGAGGG + Intronic
1179195568 21:39159808-39159830 GTGGCCCATGGCCCCTCAGAAGG + Intergenic
1179706118 21:43181386-43181408 GTGGCCCCAGGGCCCCCAGACGG + Intergenic
1179939470 21:44628478-44628500 GCCCCCCGAGGCCCCCCAGCTGG - Intronic
1179969264 21:44825107-44825129 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1180056144 21:45360105-45360127 GCCGCCCTTCCCCGCCCAGAGGG + Intergenic
1180068228 21:45423491-45423513 CCCGCCCCCCGCCCCCCGGAGGG + Intronic
1180098749 21:45574512-45574534 GTCACCCCTGGCCCCACAGGAGG + Intergenic
1180831900 22:18910866-18910888 GCCGCCCCCGGCCCCACGGCAGG + Exonic
1180995465 22:19963208-19963230 GCCGCCCCAGGGCCCCAAGGTGG + Intronic
1181090961 22:20472343-20472365 GCCTGCCTTGGCCTCCCAGAGGG - Intronic
1181283923 22:21738933-21738955 GCTGCCCAAGGCCACCCAGAAGG - Intergenic
1181617506 22:24065102-24065124 GGCGCCCCTCACCTCCCAGACGG + Intronic
1181657879 22:24317396-24317418 GGCGCCCCTCACCTCCCAGATGG + Intronic
1181657951 22:24317567-24317589 GGCGCCCCTCGCCTCCCGGACGG + Intronic
1182199351 22:28553481-28553503 GACGCTCCTCGCCTCCCAGACGG - Intronic
1182616246 22:31591860-31591882 GGCGCCCCTCACCTCCCAGACGG + Intronic
1182616373 22:31592136-31592158 GGCGCCCCTCACCTCCCAGACGG + Intronic
1182616445 22:31592312-31592334 GGCGCCCCTCACCTCCCAGACGG + Intronic
1182616573 22:31592588-31592610 GGCGCCCCTCACCTCCCAGACGG + Intronic
1182616645 22:31592764-31592786 GGCGCCCCTCACCTCCCAGACGG + Intronic
1182665882 22:31959606-31959628 GGTTCCCCAGGCCCCCCAGAGGG - Intergenic
1182976154 22:34625861-34625883 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1183541823 22:38433834-38433856 GCCTCCTCTGGACCCCCAGGAGG - Intronic
1183543785 22:38444739-38444761 GCAGCCCGTGGCCCCCCCCATGG - Intronic
1183595298 22:38807286-38807308 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1183595372 22:38807462-38807484 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1183824793 22:40377588-40377610 GCCTGCCTTGGCCTCCCAGAGGG - Intronic
1183841116 22:40501283-40501305 GGCGCCCCTCACCTCCCAGACGG + Intronic
1183841190 22:40501459-40501481 GGCGCCCCTCACCTCCCAGACGG + Intronic
1183841264 22:40501635-40501657 GGCGCCCCTCACCTCCCAGACGG + Intronic
1183841313 22:40501762-40501784 GGCGCCCCTCACCTCCCAGACGG + Intronic
1183841386 22:40501938-40501960 GGCGCCCCTCACCTCCCAGACGG + Intronic
1183845379 22:40537271-40537293 GGCGCCCCTCACCTCCCAGACGG - Intronic
1183845453 22:40537447-40537469 GGCGCCCCTCACCTCCCAGACGG - Intronic
1183845527 22:40537623-40537645 GGCGCCCCTCACCTCCCAGACGG - Intronic
1183845626 22:40537849-40537871 GGCGCCCCTCACCTCCCAGACGG - Intronic
1183929902 22:41229986-41230008 GCTGCCACTGCCCTCCCAGAAGG + Intronic
1184169445 22:42750537-42750559 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1185014142 22:48333669-48333691 GCCTCCACTGCCCTCCCAGAGGG - Intergenic
1203281978 22_KI270734v1_random:136137-136159 GCCGCCCCCGGCCCCACGGCAGG + Intergenic
949988806 3:9560291-9560313 GGCGCCCCTCACCTCCCAGACGG - Intergenic
950194358 3:10998747-10998769 GCCTCCCCCTGCACCCCAGAGGG - Intronic
950253624 3:11487547-11487569 GGCGCCCCTCACCTCCCAGACGG + Intronic
950949249 3:16980708-16980730 GACGCCCCTCGCTTCCCAGACGG + Intronic
951013332 3:17704782-17704804 GGCGCCCCTCACCTCCCAGACGG + Intronic
951013405 3:17704958-17704980 GGCGCCCCTCACCTCCCAGACGG + Intronic
952418864 3:33113918-33113940 GCCGCCCCTCCCCACCCAGCCGG - Intergenic
953307151 3:41841313-41841335 GACGCCCCTCACCTCCCAGACGG - Intronic
953307196 3:41841460-41841482 GACGCCCCTCACCTCCCAGACGG - Intronic
953426163 3:42798115-42798137 GGCGCCCCTCACCTCCCAGACGG - Intronic
953426343 3:42798520-42798542 GGCGCCCCTCACCTCCCAGACGG - Intronic
953470175 3:43159592-43159614 GCCACCCATGGCCCCACACATGG + Intergenic
953855280 3:46495090-46495112 GGCGCCCCTCACCTCCCAGACGG - Intergenic
954059529 3:48056521-48056543 GGCGCCCCTCACCTCCCAGACGG - Intronic
954059603 3:48056697-48056719 GGCGCCCCTCACCTCCCAGACGG - Intronic
954080865 3:48211844-48211866 GGCGCCCCTCACCTCCCAGACGG - Intergenic
954080939 3:48212020-48212042 GGCGCCCCTCACCTCCCAGACGG - Intergenic
954162943 3:48734768-48734790 GGCGCCCCTCACCTCCCAGACGG - Intronic
954162974 3:48734846-48734868 GGCGCCCCTCACCTCCCAGACGG - Intronic
954299105 3:49689799-49689821 GCCGTCCTTGGGCTCCCAGACGG + Intronic
954364596 3:50139295-50139317 GCAGCCCCAAGCCCCCCAGGTGG + Intergenic
954483473 3:50823751-50823773 GGCGCCCCTCACCTCCCAGACGG + Intronic
954992862 3:54855950-54855972 GCCTCCCCTTCCCCCACAGAGGG + Intronic
955297587 3:57747989-57748011 GGCGCCCCTCACCTCCCAGACGG - Intergenic
955362960 3:58290251-58290273 GGCGCCCCTCACCTCCCAGACGG + Intronic
955394734 3:58549883-58549905 GGCGCCCCTCACCTCCCAGACGG + Intergenic
955394784 3:58550010-58550032 GGCGCCCCTCACCTCCCAGACGG + Intergenic
955434884 3:58890521-58890543 GGCGCCCCTCACCTCCCAGACGG + Intronic
956270570 3:67444416-67444438 GGCGCCCCTCACCTCCCAGACGG - Intronic
956270699 3:67444722-67444744 GGCGCCCCTCACCTCCCAGACGG - Intronic
957316648 3:78583166-78583188 GGCGCCCCTCACCTCCCAGACGG + Intergenic
957316723 3:78583342-78583364 GGCGCCCCTCACCTCCCAGACGG + Intergenic
958560733 3:95744748-95744770 GGCGCCCCTCACCTCCCAGATGG + Intergenic
958808644 3:98837600-98837622 GGCGCCCCTCACCTCCCAGACGG + Intronic
958808720 3:98837776-98837798 GGCGCCCCTCACCTCCCAGACGG + Intronic
959042829 3:101439805-101439827 GGCGCCCCTCACCTCCCAGACGG - Intronic
959042902 3:101439980-101440002 GGCGCCCCTCACCTCCCAGACGG - Intronic
959419276 3:106111688-106111710 GGCGCCCCTCACCTCCCAGACGG + Intergenic
960358206 3:116678980-116679002 GCGGCCCCTGGAGCCCCCGAGGG - Intronic
960388705 3:117050887-117050909 GGCGCCCCTCACCTCCCAGACGG - Intronic
960862209 3:122164962-122164984 GGCGCCCCTCACCTCCCAGACGG - Intergenic
961108065 3:124259145-124259167 GCCTCCCCAGTCTCCCCAGAAGG - Intronic
961114640 3:124318303-124318325 GCCCCATTTGGCCCCCCAGAGGG + Intronic
961306351 3:125960815-125960837 GCAGCTCCTGACCCACCAGATGG - Intergenic
961729365 3:128954772-128954794 GGCGCCCCTCACCTCCCAGACGG - Intronic
962063315 3:131952650-131952672 GGCGCCCCTCACCTCCCAGACGG - Intronic
962112765 3:132470749-132470771 GGCGCCCCTCACCTCCCAGACGG + Intronic
962245025 3:133785028-133785050 GGCGCCCCTCACCTCCCAGACGG - Intronic
962245099 3:133785204-133785226 GGCGCCCCTCACCTCCCAGACGG - Intronic
962572265 3:136723688-136723710 GGCGCCCCTCACCTCCCAGACGG - Intronic
962808491 3:138943319-138943341 ACCGCTCCTGGCCCACCAGCCGG + Intergenic
963248912 3:143086379-143086401 GGCGCCCCTCACCTCCCAGACGG + Intergenic
963635110 3:147784890-147784912 GCCCACCTTGGCCCCCCAAAGGG + Intergenic
963844900 3:150145180-150145202 CCTGCCCCTGCCCCCCAAGACGG - Intergenic
963911392 3:150820557-150820579 GGCGCCCCTCACCTCCCAGACGG + Intergenic
964147062 3:153476423-153476445 GCTGCACCTGCCCTCCCAGAGGG + Intergenic
966359793 3:179120473-179120495 GGCGCCCCTCACCTCCCAGACGG - Intergenic
966359863 3:179120649-179120671 GGCGCCCCTCACCTCCCAGACGG - Intergenic
966360115 3:179121199-179121221 GGCGCCCCTCACCTCCCAGACGG - Intergenic
967789281 3:193529994-193530016 GCCACCCATGGCACCCCAGTTGG + Intronic
967985847 3:195094865-195094887 TCTGCCACTGGCCCTCCAGAAGG + Intronic
968481331 4:834417-834439 GCCGCCCCCGGCCAAGCAGAGGG - Intergenic
968660688 4:1797623-1797645 GCTGCTCGAGGCCCCCCAGAAGG - Intronic
968667604 4:1829303-1829325 GGCGCCCCTCACCTCCCAGACGG + Intronic
968833124 4:2943418-2943440 GCAGCTCCTCACCCCCCAGAGGG + Intronic
968924204 4:3538737-3538759 GGCGCCCCTCACCTCCCAGATGG + Intergenic
968924296 4:3538962-3538984 GGCGCCCCTCACCTCCCAGACGG + Intergenic
969344765 4:6563735-6563757 GCCGCCCATGGCCCAGCAGCCGG - Intergenic
969635304 4:8365717-8365739 GATGCCCCTGGAGCCCCAGACGG + Intergenic
972288331 4:37669087-37669109 GGCGCCCCTCACCTCCCAGACGG - Intronic
972426951 4:38942469-38942491 CTCTCCCCTGGCCACCCAGAAGG + Intronic
973021281 4:45207902-45207924 GGCGCTCCTTGCCTCCCAGACGG - Intergenic
973281281 4:48363526-48363548 GGCGCCCCTCACCTCCCAGACGG + Intronic
973281355 4:48363702-48363724 GGCGCCCCTCACCTCCCAGACGG + Intronic
973593614 4:52465362-52465384 GGCGCCCCTCACCTCCCAGACGG - Intergenic
975666976 4:76741802-76741824 CCCGGCCCTGGCCCCCCAGGAGG - Exonic
975908919 4:79245789-79245811 GGGGCCCCTCACCCCCCAGACGG - Intronic
977136123 4:93306906-93306928 ACCGCGCCTGGCCCCACAGTAGG - Intronic
979641537 4:123016119-123016141 GGCGCCCCTCACCTCCCAGACGG + Intronic
980118885 4:128707491-128707513 GCCCGCCTTGGCCCCCCAAAGGG - Intergenic
980411255 4:132422809-132422831 ACCGCGCCTGGCCCCCAATAAGG - Intergenic
981524212 4:145694404-145694426 GGCGCCCCTCACCTCCCAGACGG - Intronic
981677523 4:147358143-147358165 GGCGCCCCTCACCTCCCAGACGG - Intergenic
981970705 4:150660159-150660181 GGCGCCCCTCACCTCCCAGATGG - Intronic
982615755 4:157636763-157636785 GGCGCCCCTCACCTCCCAGACGG + Intergenic
982615873 4:157637040-157637062 GGCGCCCCTCACCTCCCAGACGG + Intergenic
982820682 4:159939299-159939321 GGCGCCCCTCACCTCCCAGACGG + Intergenic
982820862 4:159939699-159939721 GGCGCCCCTCACCTCCCAGACGG + Intergenic
984004697 4:174294629-174294651 GGCGCCCCTCACCTCCCAGACGG + Intronic
985173479 4:187176688-187176710 GACGGCCCTGGACCCCGAGACGG - Intergenic
985255689 4:188068132-188068154 GGCGCCCCTCACCTCCCAGACGG - Intergenic
985552207 5:539495-539517 GCCGCATCTGGCCTCTCAGATGG + Intergenic
985654664 5:1123628-1123650 GCGGCCCCCGGCCCCTCAGCGGG - Intergenic
985682187 5:1261850-1261872 GCCGCCCTTGGTCACCCAGCTGG - Intronic
985869717 5:2544777-2544799 GCAGCCCCTGGGCTCCCAGCTGG - Intergenic
986030515 5:3888942-3888964 GCTGGCTCTGGGCCCCCAGATGG - Intergenic
986163151 5:5249656-5249678 GCGACCCCTGGAGCCCCAGAGGG + Intronic
988532866 5:32040976-32040998 GACGCCCCTCACCTCCCAGACGG - Intronic
988532879 5:32041013-32041035 GGCGCCCCTCACCTCCCAGACGG - Intronic
988552189 5:32208506-32208528 GGCGCCCCTCACCTCCCAGACGG - Intergenic
988552422 5:32209044-32209066 GGCGCCCCTCACCTCCCAGACGG - Intergenic
988651983 5:33162534-33162556 GCTGCCCCTGGGCCGCAAGAAGG + Intergenic
988760517 5:34306538-34306560 GGCGCCCCTCACCTCCCAGACGG + Intergenic
989252746 5:39334599-39334621 GGCGCCCCTCACCTCCCAGACGG - Intronic
989575114 5:42980784-42980806 GGCGCCCCTCACCTCCCAGACGG - Intergenic
989977948 5:50608146-50608168 GATGCCCCTCGCCTCCCAGATGG - Intergenic
990709211 5:58563661-58563683 GACGCCCCTCACCTCCCAGACGG + Intergenic
991977176 5:72194891-72194913 GCAGCCACTGGCCACCCAAAAGG + Exonic
992374048 5:76172018-76172040 GGCGCCCCTCACCTCCCAGACGG - Intronic
992443074 5:76812603-76812625 GGCGCCCCTCACCTCCCAGACGG - Intergenic
992469816 5:77043090-77043112 GGCGCCCCTCACCTCCCAGACGG + Intronic
992469890 5:77043266-77043288 GGCGCCCCTCACCTCCCAGACGG + Intronic
992469964 5:77043442-77043464 GGCGCCCCTCACCTCCCAGACGG + Intronic
992544271 5:77795077-77795099 GGCGCCCCTCACCTCCCAGACGG + Intronic
992690627 5:79237013-79237035 GCAGCCGCGGGTCCCCCAGAAGG - Exonic
992978060 5:82139745-82139767 GGCGCCCCTCGCCTCCCGGACGG - Intronic
992978210 5:82140098-82140120 GGCGCCCCTCACCTCCCAGACGG - Intronic
993162897 5:84312692-84312714 GGCGCCCCTCACCTCCCAGACGG + Intronic
993274824 5:85843797-85843819 GCAACCCCTGACGCCCCAGAGGG + Intergenic
993657581 5:90595295-90595317 GGCGCCCCTCACCTCCCAGACGG + Intronic
995161781 5:108992587-108992609 GGCGCCCCTTACCTCCCAGATGG + Intronic
995193403 5:109341681-109341703 GGCGCCCCTCACCTCCCAGACGG - Intronic
995193503 5:109341906-109341928 GGCGCCCCTCACCTCCCAGACGG - Intronic
997565242 5:134881900-134881922 GGCGCCCCTGACCTCCCGGACGG + Intronic
997612711 5:135226423-135226445 GCCAAGCCTGGCCTCCCAGAGGG + Intronic
997874665 5:137537580-137537602 GGCGCCCCTCACCTCCCAGACGG + Intronic
998142921 5:139709959-139709981 GCCGCACCTGACCCACCGGATGG - Intergenic
998332187 5:141339036-141339058 CCCGGCCCTGGCCTCCCACAGGG - Exonic
998431916 5:142075894-142075916 GGCGCCCCTCACCTCCCAGACGG + Intergenic
998431992 5:142076070-142076092 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1000032931 5:157419644-157419666 GACGCCCCTCACCTCCCAGATGG - Intronic
1000985580 5:167859814-167859836 GGCGCCCCTCACCTCCCAGACGG - Intronic
1001382054 5:171311648-171311670 GGCGCCCCGGACCCCCCAGGCGG + Exonic
1001394026 5:171403819-171403841 GGCGCCCCTCACCTCCCAGACGG + Intronic
1002013738 5:176305221-176305243 GGCGCCCCTCACCTCCCAGACGG - Intronic
1002013829 5:176305436-176305458 GGCGCCCCTCACCTCCCAGACGG - Intronic
1002013905 5:176305612-176305634 GGCGCCCCTCACCTCCCAGACGG - Intronic
1002031670 5:176434224-176434246 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1002105989 5:176879642-176879664 GCCCCCCCTGGCCCACCCCAGGG - Intronic
1002115917 5:176961798-176961820 GGCGCCCCTCACCTCCCAGACGG - Intronic
1002626647 5:180534194-180534216 GCCCCCACTGGCCCCACAGATGG - Intronic
1002658268 5:180771261-180771283 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1003284840 6:4725472-4725494 GCCTCCCCAGGCCTCCCAGCGGG - Intronic
1003385902 6:5667272-5667294 GCCCACCTTGGCCCCCCAAAGGG - Intronic
1004066136 6:12246238-12246260 GCTGCCCCTTGCCCACCAGGTGG - Intergenic
1004388262 6:15189394-15189416 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1004414773 6:15415400-15415422 GGCGCCCCTCACCTCCCAGACGG + Intronic
1004414931 6:15415777-15415799 GGCGCCCCTCACCTCCCAGACGG + Intronic
1004640863 6:17514072-17514094 ACCGCGCCTGGCCCTCCACATGG - Intronic
1005063294 6:21796844-21796866 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1005606830 6:27485141-27485163 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1005606903 6:27485317-27485339 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1005933203 6:30498899-30498921 GACGCCCCTCACCTCCCAGACGG + Intergenic
1006039676 6:31243935-31243957 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1006039776 6:31244161-31244183 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1006039852 6:31244337-31244359 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1006044671 6:31284300-31284322 GCAGCCCCAGGACCCCCAGCAGG - Intronic
1006054055 6:31367493-31367515 GCAGCCCCAGGACCCCCAGAAGG - Intergenic
1006128299 6:31854047-31854069 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1006337487 6:33428098-33428120 GACACCCCTGGCCCCCCCGGGGG + Intronic
1006492478 6:34398003-34398025 GGCGCCCCTCACCTCCCAGACGG - Intronic
1006492550 6:34398179-34398201 GGCGCCCCTCACCTCCCAGACGG - Intronic
1006617644 6:35340724-35340746 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1006623774 6:35384341-35384363 GGCGCCCCTCACCTCCCAGACGG - Intronic
1006623924 6:35384692-35384714 GGCGCCCCTCACCTCCCAGACGG - Intronic
1006624000 6:35384867-35384889 GGCGCCCCTCACCTCCCAGACGG - Intronic
1006864579 6:37198915-37198937 GCCTACCCTGGCCTCCCAAAGGG - Intergenic
1007674214 6:43580848-43580870 GGCGCCCCTCACCTCCCAGACGG + Intronic
1007747706 6:44053292-44053314 TCCTCCCCTGGCCCCACAGCGGG + Intergenic
1007749680 6:44064265-44064287 TCCTCCCCTGGCCCCACAGCGGG - Intergenic
1007810500 6:44482389-44482411 GCCGCCCCTGCCCCGCTAGAAGG + Intergenic
1008841480 6:55909903-55909925 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1008841555 6:55910079-55910101 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1008965665 6:57311184-57311206 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1009392800 6:63164153-63164175 GATGCCCCTCGCCTCCCAGATGG - Intergenic
1009392856 6:63164337-63164359 GACGCCCCTCACCTCCCAGATGG - Intergenic
1010030326 6:71266220-71266242 GGCGCCCCTCACCTCCCAGATGG + Intergenic
1011405126 6:87009967-87009989 GGCGCCCCTCACCTCCCAGACGG + Intronic
1011476039 6:87751133-87751155 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1012912901 6:105137233-105137255 GCCGCCCCGCGCCCCCCGGCGGG + Intergenic
1013078475 6:106791741-106791763 GCAGCCCCTGGCCTCCCTGGTGG - Intergenic
1013243954 6:108270089-108270111 GGCGCCCCTCACCTCCCAGAGGG - Intergenic
1013326076 6:109047073-109047095 GGCGCCCCTCACCTCCCAGATGG - Intronic
1013326152 6:109047249-109047271 GGCGCCCCTCACCTCCCAGACGG - Intronic
1014556832 6:122848807-122848829 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1015476858 6:133665238-133665260 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1015476929 6:133665414-133665436 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1015643576 6:135363849-135363871 GGCGCCCCTCACCCCCCGGACGG + Intronic
1016035670 6:139380349-139380371 GCCTCCCCTGATCCCCTAGATGG + Intergenic
1017465146 6:154687330-154687352 GACGCCCCTCACCTCCCAGACGG - Intergenic
1017739983 6:157398085-157398107 GCCCCCCCCGGCTCCCCAGATGG + Intronic
1017843517 6:158239722-158239744 GGCGCCCCTCACCTCCCAGACGG + Intronic
1017843696 6:158240125-158240147 GGCGCCCCTCACCTCCCAGACGG + Intronic
1017843823 6:158240428-158240450 GGCGCCCCTCACCTCCCAGACGG + Intronic
1017843897 6:158240605-158240627 GGCGCCCCTCACCTCCCAGACGG + Intronic
1018901449 6:168053836-168053858 GCTGCCCCGGGCCTCCCAGATGG + Intergenic
1019128357 6:169856725-169856747 GACGCCCCTCACCTCCCAGATGG + Intergenic
1019439400 7:1038738-1038760 GGCGCCCCTCACCTCCCAGACGG - Intronic
1019439473 7:1038914-1038936 GGCGCCCCTCACCTCCCAGACGG - Intronic
1019669227 7:2268630-2268652 GGCGCCCCTCACCTCCCAGACGG - Intronic
1019674627 7:2303363-2303385 GGCGCCCCTCACCTCCCAGACGG - Intronic
1020616219 7:10465309-10465331 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1020616269 7:10465436-10465458 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1020616319 7:10465563-10465585 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1021872464 7:25018911-25018933 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1021872514 7:25019040-25019062 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1022083427 7:27045204-27045226 GGCGCCCCTCGCCTCCCAGAAGG - Intergenic
1022318091 7:29263799-29263821 GACGCCCCTCACCTCCCAGACGG - Intronic
1022441693 7:30438210-30438232 GCCGCACCTGTCCACCAAGATGG - Intronic
1022469690 7:30674641-30674663 GCAGCCCCTTGCCCCCCTGGAGG - Intronic
1023160758 7:37293127-37293149 GGCGCCCCTCACCTCCCAGACGG - Intronic
1023873642 7:44275779-44275801 GCCCCCACTGAGCCCCCAGAAGG + Intronic
1023954041 7:44871230-44871252 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1023954068 7:44871304-44871326 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1023954137 7:44871535-44871557 GACGCCCCTCACCTCCCAGACGG + Intergenic
1023954233 7:44871832-44871854 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1024313510 7:47991889-47991911 GCCCCGCCTGGCCCAGCAGAGGG + Intronic
1024538803 7:50459962-50459984 GGCGCCCCTCACCTCCCAGATGG - Intronic
1024989044 7:55220018-55220040 GGCGCCCCTCACCTCCCAGACGG + Intronic
1025796096 7:64739138-64739160 GACGCCCCTCACCTCCCAGACGG + Intergenic
1025808401 7:64856625-64856647 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1025808474 7:64856801-64856823 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1026163088 7:67888115-67888137 GCCCTCCTTGGCCTCCCAGAGGG + Intergenic
1026465025 7:70646577-70646599 ACCGCCTCTGGCCCCCCAAGGGG + Intronic
1026783244 7:73284052-73284074 GGCGCCCCTCACCTCCCAGATGG + Intergenic
1027214199 7:76173593-76173615 TCAGCCCCTGGCCCCCAGGATGG - Intergenic
1027371284 7:77509684-77509706 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1027371359 7:77509860-77509882 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1027371410 7:77509987-77510009 GGCGCCCCTCGCCTCCCGGACGG - Intergenic
1028621928 7:92835396-92835418 CCCCCCACTCGCCCCCCAGACGG + Intronic
1029007561 7:97226492-97226514 TCCGCCCCTGCCCCACGAGATGG - Intergenic
1029468811 7:100741695-100741717 GGCGCCCCTCACCTCCCAGACGG + Intronic
1029706562 7:102279621-102279643 GCCGCTCCTTGGCCACCAGAGGG + Intronic
1029746490 7:102517969-102517991 CCCGCCCCTCACGCCCCAGACGG - Intergenic
1029764427 7:102616948-102616970 CCCGCCCCTCACGCCCCAGACGG - Intronic
1029935569 7:104420849-104420871 ACCGCGCCCGGCCCCCCAAAGGG + Intronic
1030288228 7:107847976-107847998 GACGCCCCTCACCTCCCAGAGGG - Intergenic
1030336299 7:108330844-108330866 GCCTCCTCTGGCCCCCAAAATGG - Intronic
1032519193 7:132529892-132529914 ACCGCGCCTGGCCCCCCTAATGG + Intronic
1033323815 7:140362455-140362477 GGCGCCCCTCACCTCCCAGACGG - Intronic
1033605197 7:142921986-142922008 GCAGGCTCTGGCCTCCCAGAGGG + Intronic
1034234381 7:149555254-149555276 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1034322591 7:150198836-150198858 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1034723360 7:153314938-153314960 GGCGCCCCTCGCCTCCCGGACGG + Intergenic
1035266908 7:157693976-157693998 GCCGCCCCAGGACCCCCAGACGG - Intronic
1036536564 8:9657382-9657404 GGCGCCCCTCACCTCCCAGACGG + Intronic
1036536638 8:9657558-9657580 GGCGCCCCTCACCTCCCAGACGG + Intronic
1036664805 8:10731141-10731163 GCCGCCCCTGGCTCTCAGGAGGG + Intronic
1037032576 8:14126971-14126993 CCTCCCCCTGACCCCCCAGATGG - Intronic
1039062924 8:33586016-33586038 GTCACCCTTGGCCCCCCGGAAGG + Intergenic
1039276640 8:35939800-35939822 GCCTGCCCTGGCCTCCCAAAGGG - Intergenic
1040834665 8:51719064-51719086 GGCGCCCCTCACCTCCCAGACGG - Intronic
1041070835 8:54125524-54125546 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1041796455 8:61752813-61752835 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1042049135 8:64686134-64686156 GGCGCCCCTCACCTCCCAGACGG - Intronic
1042303598 8:67311016-67311038 GGCGCCCCTCACCTCCCAGACGG - Intronic
1042303647 8:67311143-67311165 GGCGCCCCTCACCTCCCAGACGG - Intronic
1042601838 8:70506479-70506501 GAAGCCCTTGGCCCCCAAGAAGG - Intergenic
1044582031 8:93833861-93833883 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1044582043 8:93833898-93833920 GACGCCCCTCACCTCCCAGACGG + Intergenic
1044582081 8:93834011-93834033 GACGCCCCTCACCTCCCAGACGG + Intergenic
1044582169 8:93834302-93834324 GACGCCCCTCACCTCCCAGACGG + Intergenic
1044582193 8:93834373-93834395 GACGCCCCTCACCTCCCAGATGG + Intergenic
1044582215 8:93834453-93834475 GACGCCCCTCACCTCCCAGATGG + Intergenic
1044660782 8:94591154-94591176 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1044660857 8:94591331-94591353 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1046636855 8:116680108-116680130 GGCGCCCCTCACCTCCCAGACGG - Intronic
1046703655 8:117427126-117427148 GGCGCTCCTCGCCTCCCAGACGG - Intergenic
1047015621 8:120720210-120720232 ACCTTCCCTGGCACCCCAGATGG + Intronic
1047266939 8:123315612-123315634 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1047266990 8:123315739-123315761 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1047463611 8:125091755-125091777 TCCGCCCCTGACTCCCCAGGCGG + Exonic
1047687369 8:127316658-127316680 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1047847945 8:128826192-128826214 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1049414385 8:142488652-142488674 GCAGGCCCTGGCCCCAGAGAGGG - Intronic
1049432979 8:142573826-142573848 CCCACCCCTGTCTCCCCAGATGG - Intergenic
1049612150 8:143560790-143560812 GCCACGCCTGGCCCCCCACGTGG + Intronic
1051258185 9:15234438-15234460 GGCGCCCCTCACCTCCCAGACGG - Intronic
1051277080 9:15407137-15407159 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1052259135 9:26492843-26492865 GGCGCTCCTCGCCTCCCAGATGG - Intergenic
1052259177 9:26492999-26493021 GGCGCTCCTCGCCTCCCAGACGG - Intergenic
1052259203 9:26493070-26493092 GACGCCCCTCACCTCCCAGACGG - Intergenic
1052289268 9:26823690-26823712 GATGCCCCTGGACCTCCAGAGGG + Intergenic
1053081872 9:35183823-35183845 GGCGCTCCTCGCCTCCCAGACGG + Intronic
1053081884 9:35183860-35183882 GGCGCTCCTTGCCTCCCAGACGG + Intronic
1053457387 9:38242496-38242518 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1053457461 9:38242672-38242694 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1055137175 9:72840741-72840763 GGCGCCCCTCACCTCCCAGATGG + Intergenic
1055137374 9:72841191-72841213 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1055242267 9:74198052-74198074 GGCGCCCCTTGCCTCCCAGACGG - Intergenic
1055414057 9:76063915-76063937 GGCGCCCCTCACCTCCCAGACGG + Intronic
1055414129 9:76064091-76064113 GGCGCCCCTCACCTCCCAGACGG + Intronic
1055948472 9:81710770-81710792 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1055948547 9:81710946-81710968 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1056152546 9:83804154-83804176 GGCGCCCCTCACCTCCCAGACGG - Intronic
1056229181 9:84526886-84526908 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1056229207 9:84526959-84526981 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1056229232 9:84527033-84527055 GACGCCCCTCACCTCCCAGATGG + Intergenic
1056229298 9:84527217-84527239 GACGCCCCTCACCTCCCAGACGG + Intergenic
1056229324 9:84527297-84527319 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1056409642 9:86312521-86312543 GGCGCCCCTCACCTCCCAGACGG - Intronic
1057154663 9:92830650-92830672 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1057674765 9:97130352-97130374 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1057751589 9:97796827-97796849 GGCGCCCCTCACCTCCCAGATGG - Intergenic
1058244144 9:102603341-102603363 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1058375451 9:104316630-104316652 GGCGCCCCTCACCTCCCAGATGG - Intergenic
1058375499 9:104316777-104316799 GGCGCACCTTGCCTCCCAGACGG - Intergenic
1058659746 9:107257236-107257258 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1058722672 9:107776523-107776545 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1059118121 9:111617519-111617541 GACGCTCCTGGCTTCCCAGACGG + Intergenic
1059121014 9:111641258-111641280 GGCGCCCCTCACCTCCCAGACGG - Intronic
1059211206 9:112514709-112514731 GGCGCCCCTCACCTCCCAGACGG - Intronic
1059388744 9:113985517-113985539 AGTCCCCCTGGCCCCCCAGAGGG - Intronic
1060065124 9:120496060-120496082 GGCGCCCCTCACCTCCCAGACGG - Intronic
1060065198 9:120496236-120496258 GGCGCCCCTCACCTCCCAGACGG - Intronic
1060520332 9:124290623-124290645 CCAGCCCCTGGTCCCCAAGAGGG - Intronic
1060687256 9:125624064-125624086 GGCGCCCCTCACCTCCCAGACGG - Intronic
1060687328 9:125624240-125624262 GGCGCCCCTCACCTCCCAGACGG - Intronic
1060771950 9:126338242-126338264 GCCGGGCCTGGCCTGCCAGAGGG - Intronic
1061584340 9:131556255-131556277 GCAGCCACTGGCGCCCCAGTGGG + Intergenic
1061762081 9:132858052-132858074 GCCGCTCCTGGCCACAGAGAAGG + Intronic
1061872489 9:133528286-133528308 GCTTCTCCTGACCCCCCAGAGGG + Intronic
1061982696 9:134115593-134115615 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1061982846 9:134115945-134115967 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1061983020 9:134116347-134116369 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1061983094 9:134116523-134116545 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1061983170 9:134116699-134116721 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1061983321 9:134117052-134117074 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1061983395 9:134117228-134117250 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1061983471 9:134117404-134117426 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1061983645 9:134117806-134117828 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1061983719 9:134117982-134118004 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1061983795 9:134118158-134118180 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1062290629 9:135792763-135792785 GCGTCCCCAGGTCCCCCAGAGGG + Exonic
1062382551 9:136294495-136294517 GCTGGCCCTGGCCCCCATGAAGG + Intronic
1062474721 9:136721304-136721326 GCAGCTCCTGGCCCTTCAGATGG + Intronic
1062478669 9:136741703-136741725 GCAGCCCCTGGGACCCCACATGG - Intronic
1062533807 9:137012963-137012985 ACTGCCCCTGCCCCCCCAGCAGG + Intronic
1062736999 9:138142804-138142826 GCCGCCTGTGGCCCCACAGAAGG + Intergenic
1203405736 Un_KI270539v1:709-731 GGCGCCCCTCACCCCCCGGACGG - Intergenic
1186630702 X:11345637-11345659 GCAGCCCCTTGGCCCCCAGCTGG - Intronic
1188477289 X:30602755-30602777 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1189210523 X:39278419-39278441 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1189268200 X:39732131-39732153 GCAGCACCTGGAACCCCAGAGGG - Intergenic
1189351762 X:40280779-40280801 ACCGCGCCTGGCCTCCCAGACGG + Intergenic
1189421655 X:40862492-40862514 GGCGCTCCTTGCCTCCCAGACGG - Intergenic
1189421666 X:40862529-40862551 GGCGCTCCTCGCCTCCCAGACGG - Intergenic
1189421678 X:40862566-40862588 GGCGCTCCTCGCCTCCCAGACGG - Intergenic
1189421749 X:40862784-40862806 GACGCCCCTCACCTCCCAGACGG - Intergenic
1189506109 X:41613040-41613062 GGCGCCCCTCACCTCCCAGACGG - Intronic
1189955911 X:46275748-46275770 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1190052162 X:47158365-47158387 CCCACCCCTGGCCACCCAGCTGG + Intronic
1190693764 X:52934701-52934723 CCCCCCCCTCGCCCGCCAGAAGG + Intronic
1190779330 X:53579103-53579125 GGCGCCCCTCACCTCCCAGACGG - Intronic
1191828695 X:65392498-65392520 GGCGCCCCTCACCTCCCAGATGG - Intronic
1191840843 X:65512810-65512832 GCTGCCCCTGGCTCCAGAGAAGG + Exonic
1192082714 X:68063857-68063879 CCGGCCCCTGGCCCACCACAAGG - Exonic
1192504967 X:71676063-71676085 GACGCCCCTCACCTCCCAGATGG - Intergenic
1192621389 X:72681752-72681774 GGCGCCCCTCACCTCCCAGATGG - Intronic
1192663917 X:73069039-73069061 GACGCCCCTCACCTCCCAGATGG - Intergenic
1193345148 X:80396859-80396881 GGCGCCCCTCACCTCCCAGACGG + Intronic
1194991928 X:100555638-100555660 GGCGCCCCTCACCTCCCAGATGG - Intergenic
1194991981 X:100555766-100555788 GGCGCCCCTCACCTCCCAGATGG - Intergenic
1195036010 X:100972442-100972464 GGCGCCCCTCACCTCCCAGACGG + Intronic
1195278756 X:103310134-103310156 GGCTCCCCTCGCCCCCCCGAGGG - Intronic
1195313675 X:103657473-103657495 GCAGACCCAGACCCCCCAGAAGG - Intergenic
1196404328 X:115347398-115347420 GGCGCCCCTCACCTCCCAGACGG + Intergenic
1197759411 X:130016892-130016914 GAATCCCCTGGTCCCCCAGAAGG + Intronic
1200399184 X:156008777-156008799 GCCTCCTGTGGCCCCACAGAAGG + Intronic
1202028826 Y:20551981-20552003 GGCGCTCCTCGCCTCCCAGACGG - Intergenic
1202028896 Y:20552208-20552230 GGCGCCCCTCACCTCCCAGACGG - Intergenic
1202202398 Y:22367243-22367265 GCCTCCCCTGGCCCCGCTGTGGG - Intronic