ID: 1157385790

View in Genome Browser
Species Human (GRCh38)
Location 18:47259406-47259428
Sequence TTGGCTTCTCTAGGAAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157385790_1157385801 14 Left 1157385790 18:47259406-47259428 CCAGTGTTTCCTAGAGAAGCCAA No data
Right 1157385801 18:47259443-47259465 GGCCTGCAGCCTAGGAGGAAGGG No data
1157385790_1157385805 26 Left 1157385790 18:47259406-47259428 CCAGTGTTTCCTAGAGAAGCCAA No data
Right 1157385805 18:47259455-47259477 AGGAGGAAGGGTTTCTTCTTGGG No data
1157385790_1157385799 9 Left 1157385790 18:47259406-47259428 CCAGTGTTTCCTAGAGAAGCCAA No data
Right 1157385799 18:47259438-47259460 GCATAGGCCTGCAGCCTAGGAGG No data
1157385790_1157385800 13 Left 1157385790 18:47259406-47259428 CCAGTGTTTCCTAGAGAAGCCAA No data
Right 1157385800 18:47259442-47259464 AGGCCTGCAGCCTAGGAGGAAGG No data
1157385790_1157385798 6 Left 1157385790 18:47259406-47259428 CCAGTGTTTCCTAGAGAAGCCAA No data
Right 1157385798 18:47259435-47259457 CTGGCATAGGCCTGCAGCCTAGG No data
1157385790_1157385804 25 Left 1157385790 18:47259406-47259428 CCAGTGTTTCCTAGAGAAGCCAA No data
Right 1157385804 18:47259454-47259476 TAGGAGGAAGGGTTTCTTCTTGG No data
1157385790_1157385794 -7 Left 1157385790 18:47259406-47259428 CCAGTGTTTCCTAGAGAAGCCAA No data
Right 1157385794 18:47259422-47259444 AAGCCAAAAGGCCCTGGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157385790 Original CRISPR TTGGCTTCTCTAGGAAACAC TGG (reversed) Intergenic
No off target data available for this crispr