ID: 1157389495

View in Genome Browser
Species Human (GRCh38)
Location 18:47289246-47289268
Sequence ACTTCCTTCAGAAGTGGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157389490_1157389495 -5 Left 1157389490 18:47289228-47289250 CCAGGGAACACCCCACTGACTTC No data
Right 1157389495 18:47289246-47289268 ACTTCCTTCAGAAGTGGTACAGG No data
1157389484_1157389495 30 Left 1157389484 18:47289193-47289215 CCTGTACCAGTGTGATGTGACTT No data
Right 1157389495 18:47289246-47289268 ACTTCCTTCAGAAGTGGTACAGG No data
1157389485_1157389495 24 Left 1157389485 18:47289199-47289221 CCAGTGTGATGTGACTTTTCCAG No data
Right 1157389495 18:47289246-47289268 ACTTCCTTCAGAAGTGGTACAGG No data
1157389489_1157389495 5 Left 1157389489 18:47289218-47289240 CCAGGTAGAGCCAGGGAACACCC No data
Right 1157389495 18:47289246-47289268 ACTTCCTTCAGAAGTGGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157389495 Original CRISPR ACTTCCTTCAGAAGTGGTAC AGG Intergenic
No off target data available for this crispr