ID: 1157391610

View in Genome Browser
Species Human (GRCh38)
Location 18:47307948-47307970
Sequence GTGGCCTCTAAGACTTAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157391610_1157391619 9 Left 1157391610 18:47307948-47307970 CCACCTTAAGTCTTAGAGGCCAC No data
Right 1157391619 18:47307980-47308002 TCAGAAGGGCCTATCAGGCTGGG No data
1157391610_1157391618 8 Left 1157391610 18:47307948-47307970 CCACCTTAAGTCTTAGAGGCCAC No data
Right 1157391618 18:47307979-47308001 TTCAGAAGGGCCTATCAGGCTGG No data
1157391610_1157391620 15 Left 1157391610 18:47307948-47307970 CCACCTTAAGTCTTAGAGGCCAC No data
Right 1157391620 18:47307986-47308008 GGGCCTATCAGGCTGGGAAGTGG No data
1157391610_1157391613 -6 Left 1157391610 18:47307948-47307970 CCACCTTAAGTCTTAGAGGCCAC No data
Right 1157391613 18:47307965-47307987 GGCCACCTCTTGGCTTCAGAAGG No data
1157391610_1157391614 -5 Left 1157391610 18:47307948-47307970 CCACCTTAAGTCTTAGAGGCCAC No data
Right 1157391614 18:47307966-47307988 GCCACCTCTTGGCTTCAGAAGGG No data
1157391610_1157391622 21 Left 1157391610 18:47307948-47307970 CCACCTTAAGTCTTAGAGGCCAC No data
Right 1157391622 18:47307992-47308014 ATCAGGCTGGGAAGTGGTTCTGG No data
1157391610_1157391617 4 Left 1157391610 18:47307948-47307970 CCACCTTAAGTCTTAGAGGCCAC No data
Right 1157391617 18:47307975-47307997 TGGCTTCAGAAGGGCCTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157391610 Original CRISPR GTGGCCTCTAAGACTTAAGG TGG (reversed) Intergenic
No off target data available for this crispr