ID: 1157393998

View in Genome Browser
Species Human (GRCh38)
Location 18:47326736-47326758
Sequence TGCCTGACTCGGTGTTAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157393998_1157394003 22 Left 1157393998 18:47326736-47326758 CCTCCCTAACACCGAGTCAGGCA No data
Right 1157394003 18:47326781-47326803 TTGTTTTTTTTTTTTTTCCTTGG No data
1157393998_1157394002 -10 Left 1157393998 18:47326736-47326758 CCTCCCTAACACCGAGTCAGGCA No data
Right 1157394002 18:47326749-47326771 GAGTCAGGCACATTAGTAGCTGG No data
1157393998_1157394004 23 Left 1157393998 18:47326736-47326758 CCTCCCTAACACCGAGTCAGGCA No data
Right 1157394004 18:47326782-47326804 TGTTTTTTTTTTTTTTCCTTGGG 0: 3
1: 96
2: 1107
3: 18829
4: 41556

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157393998 Original CRISPR TGCCTGACTCGGTGTTAGGG AGG (reversed) Intergenic
No off target data available for this crispr