ID: 1157394496

View in Genome Browser
Species Human (GRCh38)
Location 18:47330577-47330599
Sequence GGGAACTGAAGCACAGAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157394496_1157394499 -5 Left 1157394496 18:47330577-47330599 CCCGTCTCTGTGCTTCAGTTCCC No data
Right 1157394499 18:47330595-47330617 TTCCCTCATCAGTAAAATAAGGG No data
1157394496_1157394498 -6 Left 1157394496 18:47330577-47330599 CCCGTCTCTGTGCTTCAGTTCCC No data
Right 1157394498 18:47330594-47330616 GTTCCCTCATCAGTAAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157394496 Original CRISPR GGGAACTGAAGCACAGAGAC GGG (reversed) Intergenic
No off target data available for this crispr