ID: 1157402008

View in Genome Browser
Species Human (GRCh38)
Location 18:47396475-47396497
Sequence CACTATGAGGGGAGGGAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157401995_1157402008 28 Left 1157401995 18:47396424-47396446 CCATATATGCCTGGCACATGACA No data
Right 1157402008 18:47396475-47396497 CACTATGAGGGGAGGGAAGTAGG No data
1157401994_1157402008 29 Left 1157401994 18:47396423-47396445 CCCATATATGCCTGGCACATGAC No data
Right 1157402008 18:47396475-47396497 CACTATGAGGGGAGGGAAGTAGG No data
1157401998_1157402008 19 Left 1157401998 18:47396433-47396455 CCTGGCACATGACACAGGGCTTT No data
Right 1157402008 18:47396475-47396497 CACTATGAGGGGAGGGAAGTAGG No data
1157401993_1157402008 30 Left 1157401993 18:47396422-47396444 CCCCATATATGCCTGGCACATGA No data
Right 1157402008 18:47396475-47396497 CACTATGAGGGGAGGGAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157402008 Original CRISPR CACTATGAGGGGAGGGAAGT AGG Intergenic
No off target data available for this crispr