ID: 1157402332

View in Genome Browser
Species Human (GRCh38)
Location 18:47398905-47398927
Sequence TTGCAGGCATGGGACATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157402323_1157402332 25 Left 1157402323 18:47398857-47398879 CCTCAATGATAAGGGGCAGGCAC No data
Right 1157402332 18:47398905-47398927 TTGCAGGCATGGGACATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157402332 Original CRISPR TTGCAGGCATGGGACATGGC AGG Intergenic
No off target data available for this crispr