ID: 1157404615

View in Genome Browser
Species Human (GRCh38)
Location 18:47412507-47412529
Sequence AAGTGTGTATGGAGGGCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157404615_1157404620 -2 Left 1157404615 18:47412507-47412529 CCCTGCGCCCTCCATACACACTT No data
Right 1157404620 18:47412528-47412550 TTCCTTGCCTGAATGATGTTAGG No data
1157404615_1157404623 29 Left 1157404615 18:47412507-47412529 CCCTGCGCCCTCCATACACACTT No data
Right 1157404623 18:47412559-47412581 TGTGACTTGCTTTGACTTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157404615 Original CRISPR AAGTGTGTATGGAGGGCGCA GGG (reversed) Intergenic
No off target data available for this crispr