ID: 1157409490

View in Genome Browser
Species Human (GRCh38)
Location 18:47451905-47451927
Sequence CTGTCTGCACAGAAGGTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157409488_1157409490 4 Left 1157409488 18:47451878-47451900 CCAGATGGAGTATACACACAAAA No data
Right 1157409490 18:47451905-47451927 CTGTCTGCACAGAAGGTAGAAGG No data
1157409486_1157409490 30 Left 1157409486 18:47451852-47451874 CCTAATAGAACTGTTAGCTATTA No data
Right 1157409490 18:47451905-47451927 CTGTCTGCACAGAAGGTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157409490 Original CRISPR CTGTCTGCACAGAAGGTAGA AGG Intergenic
No off target data available for this crispr