ID: 1157410730

View in Genome Browser
Species Human (GRCh38)
Location 18:47460760-47460782
Sequence CAGGACTCCTTGGCAAAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157410724_1157410730 7 Left 1157410724 18:47460730-47460752 CCAAATCTCGTGGTAACTGGGAG No data
Right 1157410730 18:47460760-47460782 CAGGACTCCTTGGCAAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157410730 Original CRISPR CAGGACTCCTTGGCAAAAAT TGG Intergenic
No off target data available for this crispr