ID: 1157411059

View in Genome Browser
Species Human (GRCh38)
Location 18:47463948-47463970
Sequence CAGAATCAGGAGAGGGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157411059_1157411064 -5 Left 1157411059 18:47463948-47463970 CCACTCTCCCTCTCCTGATTCTG No data
Right 1157411064 18:47463966-47463988 TTCTGCTTAGTTATTTTCATGGG No data
1157411059_1157411063 -6 Left 1157411059 18:47463948-47463970 CCACTCTCCCTCTCCTGATTCTG No data
Right 1157411063 18:47463965-47463987 ATTCTGCTTAGTTATTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157411059 Original CRISPR CAGAATCAGGAGAGGGAGAG TGG (reversed) Intergenic
No off target data available for this crispr