ID: 1157413726

View in Genome Browser
Species Human (GRCh38)
Location 18:47485187-47485209
Sequence CTGCCTTGGTGGGGTGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157413726_1157413741 29 Left 1157413726 18:47485187-47485209 CCCCTCCCACCCCACCAAGGCAG No data
Right 1157413741 18:47485239-47485261 AACTGACATATCCTGAGCCCAGG No data
1157413726_1157413736 -6 Left 1157413726 18:47485187-47485209 CCCCTCCCACCCCACCAAGGCAG No data
Right 1157413736 18:47485204-47485226 AGGCAGACTCATTGGAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157413726 Original CRISPR CTGCCTTGGTGGGGTGGGAG GGG (reversed) Intergenic
No off target data available for this crispr