ID: 1157414246

View in Genome Browser
Species Human (GRCh38)
Location 18:47488974-47488996
Sequence TAGAGTTTACAGAAGTAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157414244_1157414246 7 Left 1157414244 18:47488944-47488966 CCAAAGGAAGTGAGAGAGATGTC No data
Right 1157414246 18:47488974-47488996 TAGAGTTTACAGAAGTAGCAGGG No data
1157414242_1157414246 20 Left 1157414242 18:47488931-47488953 CCAGGAAGGTGACCCAAAGGAAG No data
Right 1157414246 18:47488974-47488996 TAGAGTTTACAGAAGTAGCAGGG No data
1157414238_1157414246 23 Left 1157414238 18:47488928-47488950 CCCCCAGGAAGGTGACCCAAAGG No data
Right 1157414246 18:47488974-47488996 TAGAGTTTACAGAAGTAGCAGGG No data
1157414241_1157414246 21 Left 1157414241 18:47488930-47488952 CCCAGGAAGGTGACCCAAAGGAA No data
Right 1157414246 18:47488974-47488996 TAGAGTTTACAGAAGTAGCAGGG No data
1157414240_1157414246 22 Left 1157414240 18:47488929-47488951 CCCCAGGAAGGTGACCCAAAGGA No data
Right 1157414246 18:47488974-47488996 TAGAGTTTACAGAAGTAGCAGGG No data
1157414243_1157414246 8 Left 1157414243 18:47488943-47488965 CCCAAAGGAAGTGAGAGAGATGT No data
Right 1157414246 18:47488974-47488996 TAGAGTTTACAGAAGTAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157414246 Original CRISPR TAGAGTTTACAGAAGTAGCA GGG Intergenic
No off target data available for this crispr