ID: 1157415981

View in Genome Browser
Species Human (GRCh38)
Location 18:47503452-47503474
Sequence CTGTGGCCAAGCACAGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157415980_1157415981 -9 Left 1157415980 18:47503438-47503460 CCATGGGAAATTCACTGTGGCCA No data
Right 1157415981 18:47503452-47503474 CTGTGGCCAAGCACAGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157415981 Original CRISPR CTGTGGCCAAGCACAGAGTG AGG Intergenic
No off target data available for this crispr