ID: 1157415981 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:47503452-47503474 |
Sequence | CTGTGGCCAAGCACAGAGTG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1157415980_1157415981 | -9 | Left | 1157415980 | 18:47503438-47503460 | CCATGGGAAATTCACTGTGGCCA | No data | ||
Right | 1157415981 | 18:47503452-47503474 | CTGTGGCCAAGCACAGAGTGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1157415981 | Original CRISPR | CTGTGGCCAAGCACAGAGTG AGG | Intergenic | ||
No off target data available for this crispr |