ID: 1157416472

View in Genome Browser
Species Human (GRCh38)
Location 18:47507633-47507655
Sequence TAAATTAGCCCTGAAAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157416472_1157416480 6 Left 1157416472 18:47507633-47507655 CCTGGGTTTTCAGGGCTAATTTA No data
Right 1157416480 18:47507662-47507684 CTATAGAAGGAGGGTGGGGAGGG No data
1157416472_1157416481 7 Left 1157416472 18:47507633-47507655 CCTGGGTTTTCAGGGCTAATTTA No data
Right 1157416481 18:47507663-47507685 TATAGAAGGAGGGTGGGGAGGGG No data
1157416472_1157416483 17 Left 1157416472 18:47507633-47507655 CCTGGGTTTTCAGGGCTAATTTA No data
Right 1157416483 18:47507673-47507695 GGGTGGGGAGGGGGTGTGAAAGG No data
1157416472_1157416474 -4 Left 1157416472 18:47507633-47507655 CCTGGGTTTTCAGGGCTAATTTA No data
Right 1157416474 18:47507652-47507674 TTTAAGAGCTCTATAGAAGGAGG No data
1157416472_1157416478 2 Left 1157416472 18:47507633-47507655 CCTGGGTTTTCAGGGCTAATTTA No data
Right 1157416478 18:47507658-47507680 AGCTCTATAGAAGGAGGGTGGGG No data
1157416472_1157416477 1 Left 1157416472 18:47507633-47507655 CCTGGGTTTTCAGGGCTAATTTA No data
Right 1157416477 18:47507657-47507679 GAGCTCTATAGAAGGAGGGTGGG No data
1157416472_1157416475 -3 Left 1157416472 18:47507633-47507655 CCTGGGTTTTCAGGGCTAATTTA No data
Right 1157416475 18:47507653-47507675 TTAAGAGCTCTATAGAAGGAGGG No data
1157416472_1157416473 -7 Left 1157416472 18:47507633-47507655 CCTGGGTTTTCAGGGCTAATTTA No data
Right 1157416473 18:47507649-47507671 TAATTTAAGAGCTCTATAGAAGG No data
1157416472_1157416484 27 Left 1157416472 18:47507633-47507655 CCTGGGTTTTCAGGGCTAATTTA No data
Right 1157416484 18:47507683-47507705 GGGGTGTGAAAGGATTCCTCTGG No data
1157416472_1157416476 0 Left 1157416472 18:47507633-47507655 CCTGGGTTTTCAGGGCTAATTTA No data
Right 1157416476 18:47507656-47507678 AGAGCTCTATAGAAGGAGGGTGG No data
1157416472_1157416482 8 Left 1157416472 18:47507633-47507655 CCTGGGTTTTCAGGGCTAATTTA No data
Right 1157416482 18:47507664-47507686 ATAGAAGGAGGGTGGGGAGGGGG No data
1157416472_1157416479 5 Left 1157416472 18:47507633-47507655 CCTGGGTTTTCAGGGCTAATTTA No data
Right 1157416479 18:47507661-47507683 TCTATAGAAGGAGGGTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157416472 Original CRISPR TAAATTAGCCCTGAAAACCC AGG (reversed) Intergenic
No off target data available for this crispr