ID: 1157416481

View in Genome Browser
Species Human (GRCh38)
Location 18:47507663-47507685
Sequence TATAGAAGGAGGGTGGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157416472_1157416481 7 Left 1157416472 18:47507633-47507655 CCTGGGTTTTCAGGGCTAATTTA No data
Right 1157416481 18:47507663-47507685 TATAGAAGGAGGGTGGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157416481 Original CRISPR TATAGAAGGAGGGTGGGGAG GGG Intergenic
No off target data available for this crispr