ID: 1157416873

View in Genome Browser
Species Human (GRCh38)
Location 18:47510776-47510798
Sequence GTGGCCTAGAGGACTGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157416873_1157416878 11 Left 1157416873 18:47510776-47510798 CCACTCTCAGTCCTCTAGGCCAC No data
Right 1157416878 18:47510810-47510832 AACCCATTGCAATGTACACATGG No data
1157416873_1157416881 23 Left 1157416873 18:47510776-47510798 CCACTCTCAGTCCTCTAGGCCAC No data
Right 1157416881 18:47510822-47510844 TGTACACATGGATATCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157416873 Original CRISPR GTGGCCTAGAGGACTGAGAG TGG (reversed) Intergenic
No off target data available for this crispr