ID: 1157417729

View in Genome Browser
Species Human (GRCh38)
Location 18:47520178-47520200
Sequence CCTGCTTTGTAGGCACTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157417720_1157417729 21 Left 1157417720 18:47520134-47520156 CCCAAGGCATCATGTTGCCCGAG No data
Right 1157417729 18:47520178-47520200 CCTGCTTTGTAGGCACTGTCTGG No data
1157417721_1157417729 20 Left 1157417721 18:47520135-47520157 CCAAGGCATCATGTTGCCCGAGG No data
Right 1157417729 18:47520178-47520200 CCTGCTTTGTAGGCACTGTCTGG No data
1157417724_1157417729 4 Left 1157417724 18:47520151-47520173 CCCGAGGCAGCATATTGGATGAG No data
Right 1157417729 18:47520178-47520200 CCTGCTTTGTAGGCACTGTCTGG No data
1157417725_1157417729 3 Left 1157417725 18:47520152-47520174 CCGAGGCAGCATATTGGATGAGA No data
Right 1157417729 18:47520178-47520200 CCTGCTTTGTAGGCACTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157417729 Original CRISPR CCTGCTTTGTAGGCACTGTC TGG Intergenic
No off target data available for this crispr