ID: 1157423820

View in Genome Browser
Species Human (GRCh38)
Location 18:47568274-47568296
Sequence ATTGGGAAGCAGAGAGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1157423809_1157423820 23 Left 1157423809 18:47568228-47568250 CCATAGAAGCAGCCAAATAAGAT No data
Right 1157423820 18:47568274-47568296 ATTGGGAAGCAGAGAGGGGATGG No data
1157423810_1157423820 11 Left 1157423810 18:47568240-47568262 CCAAATAAGATGTGAAGACTAGG No data
Right 1157423820 18:47568274-47568296 ATTGGGAAGCAGAGAGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1157423820 Original CRISPR ATTGGGAAGCAGAGAGGGGA TGG Intergenic
No off target data available for this crispr