ID: 1157423820 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:47568274-47568296 |
Sequence | ATTGGGAAGCAGAGAGGGGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1157423809_1157423820 | 23 | Left | 1157423809 | 18:47568228-47568250 | CCATAGAAGCAGCCAAATAAGAT | No data | ||
Right | 1157423820 | 18:47568274-47568296 | ATTGGGAAGCAGAGAGGGGATGG | No data | ||||
1157423810_1157423820 | 11 | Left | 1157423810 | 18:47568240-47568262 | CCAAATAAGATGTGAAGACTAGG | No data | ||
Right | 1157423820 | 18:47568274-47568296 | ATTGGGAAGCAGAGAGGGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1157423820 | Original CRISPR | ATTGGGAAGCAGAGAGGGGA TGG | Intergenic | ||
No off target data available for this crispr |